ID: 1167855720

View in Genome Browser
Species Human (GRCh38)
Location 19:52238032-52238054
Sequence TGTAATCTGAGCACTTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167855720_1167855727 15 Left 1167855720 19:52238032-52238054 CCTCCTGAAGTGCTCAGATTACA No data
Right 1167855727 19:52238070-52238092 GCTCAGCCAAAAGGGGCCAAAGG No data
1167855720_1167855724 7 Left 1167855720 19:52238032-52238054 CCTCCTGAAGTGCTCAGATTACA No data
Right 1167855724 19:52238062-52238084 GCCACTTTGCTCAGCCAAAAGGG No data
1167855720_1167855729 19 Left 1167855720 19:52238032-52238054 CCTCCTGAAGTGCTCAGATTACA No data
Right 1167855729 19:52238074-52238096 AGCCAAAAGGGGCCAAAGGGTGG No data
1167855720_1167855723 6 Left 1167855720 19:52238032-52238054 CCTCCTGAAGTGCTCAGATTACA No data
Right 1167855723 19:52238061-52238083 AGCCACTTTGCTCAGCCAAAAGG No data
1167855720_1167855726 8 Left 1167855720 19:52238032-52238054 CCTCCTGAAGTGCTCAGATTACA No data
Right 1167855726 19:52238063-52238085 CCACTTTGCTCAGCCAAAAGGGG No data
1167855720_1167855728 16 Left 1167855720 19:52238032-52238054 CCTCCTGAAGTGCTCAGATTACA No data
Right 1167855728 19:52238071-52238093 CTCAGCCAAAAGGGGCCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167855720 Original CRISPR TGTAATCTGAGCACTTCAGG AGG (reversed) Intergenic
No off target data available for this crispr