ID: 1167862589

View in Genome Browser
Species Human (GRCh38)
Location 19:52297334-52297356
Sequence GAGACGCCTGAATTTGGTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 35}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167862589_1167862601 29 Left 1167862589 19:52297334-52297356 CCCCGACCAAATTCAGGCGTCTC 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1167862601 19:52297386-52297408 TGTTTAAATCGCTCGGCGGCGGG 0: 1
1: 0
2: 2
3: 1
4: 11
1167862589_1167862597 22 Left 1167862589 19:52297334-52297356 CCCCGACCAAATTCAGGCGTCTC 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1167862597 19:52297379-52297401 CCCTGTGTGTTTAAATCGCTCGG 0: 1
1: 1
2: 2
3: 7
4: 75
1167862589_1167862600 28 Left 1167862589 19:52297334-52297356 CCCCGACCAAATTCAGGCGTCTC 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1167862600 19:52297385-52297407 GTGTTTAAATCGCTCGGCGGCGG 0: 1
1: 0
2: 1
3: 1
4: 14
1167862589_1167862599 25 Left 1167862589 19:52297334-52297356 CCCCGACCAAATTCAGGCGTCTC 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1167862599 19:52297382-52297404 TGTGTGTTTAAATCGCTCGGCGG 0: 1
1: 0
2: 1
3: 4
4: 51
1167862589_1167862593 -10 Left 1167862589 19:52297334-52297356 CCCCGACCAAATTCAGGCGTCTC 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1167862593 19:52297347-52297369 CAGGCGTCTCCGTGAGAGTCAGG 0: 2
1: 0
2: 0
3: 3
4: 75
1167862589_1167862594 -7 Left 1167862589 19:52297334-52297356 CCCCGACCAAATTCAGGCGTCTC 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1167862594 19:52297350-52297372 GCGTCTCCGTGAGAGTCAGGCGG 0: 1
1: 0
2: 1
3: 0
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167862589 Original CRISPR GAGACGCCTGAATTTGGTCG GGG (reversed) Intronic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
922406217 1:225316199-225316221 GGGACTCCTGAGCTTGGTCGGGG - Intronic
1072803838 10:98411619-98411641 GAGAGGCCTGAATTTGGCTTTGG + Intronic
1073301894 10:102475909-102475931 GAGACGCCTGCACATGGTCAAGG + Exonic
1098255391 12:68610911-68610933 TACACGCCTGAATCTGGGCGAGG - Exonic
1101717908 12:107327007-107327029 GCCACACCTGAAGTTGGTCGTGG + Intronic
1104443779 12:128817177-128817199 GAGATGTCTGCATTTGGTCTAGG - Intronic
1111589412 13:90324269-90324291 AAGACACCTGTATTTGGTAGAGG - Intergenic
1114246629 14:20920523-20920545 GAGATGACTAAATTTGGTCAAGG - Intergenic
1139137954 16:64227760-64227782 CAGAAGGCTGAATTTGGTGGGGG - Intergenic
1167427123 19:49435048-49435070 GAGAAGCCTGGATTTGGGGGTGG - Intronic
1167859218 19:52269743-52269765 GGGACGCATGAATTTACTCGGGG - Intronic
1167862589 19:52297334-52297356 GAGACGCCTGAATTTGGTCGGGG - Intronic
1167866929 19:52336401-52336423 GAGACGCCTGAATTTACACGGGG - Exonic
931226285 2:60334726-60334748 GAGAGGCCTGAGTTTGGTTCTGG - Intergenic
933548606 2:83744938-83744960 GAGAAGCCTGAATATTGTTGTGG - Intergenic
939840613 2:147182801-147182823 GGGATGCCTGAGCTTGGTCGGGG + Intergenic
940209989 2:151246452-151246474 CAGACACATGAATTTGGTAGTGG + Intergenic
940594005 2:155766919-155766941 GAGACGCTGGAGCTTGGTCGGGG - Intergenic
941185670 2:162318766-162318788 GAGACGCCACCTTTTGGTCGGGG + Intergenic
1178566607 21:33692163-33692185 GAGAAGCCTGAGTTTGGTCAAGG + Intronic
1179094644 21:38301744-38301766 TAGACCCCTGAATTTGGCCCGGG - Exonic
952987785 3:38802004-38802026 GAGAAGCTTGATTTTGGTGGAGG - Intergenic
960664398 3:120095240-120095262 GAGATGCCTGACTCGGGTCGTGG + Intergenic
969267123 4:6071763-6071785 GAGACGCCTGCATGTGGTCCAGG + Intronic
975212974 4:71722522-71722544 GAGATGACTGAGTTTGGTTGGGG - Intergenic
992374424 5:76174329-76174351 TACACGCCTGAATCTGGGCGAGG + Intronic
999341962 5:150780121-150780143 GGGATGCCTGAATTAGGTGGAGG + Intronic
1019992224 7:4700183-4700205 GAGACACCTGAGTTTTGTTGGGG + Intronic
1026137812 7:67678895-67678917 GAAACGTCTGAACTTGGGCGTGG + Intergenic
1027609916 7:80347948-80347970 GATACTCCTGACTTTGGTGGAGG + Intergenic
1039916070 8:41861206-41861228 GCGACCCCTGAATTTGATGGAGG - Intronic
1041798580 8:61772910-61772932 GACACGCCTAGATTTGGGCGTGG + Intergenic
1043329299 8:79094123-79094145 CAGTCGGCTGAATTTGGTCTGGG - Intergenic
1191086126 X:56569152-56569174 GAGACACCTGTATTTGGGTGTGG + Intergenic
1192183402 X:68930142-68930164 GAGACGCCAGGATTTGATGGCGG - Intergenic
1197142200 X:123129937-123129959 GGGATGCTTGAACTTGGTCGGGG + Intergenic
1197391803 X:125877253-125877275 GAGCCACCTGAATCTGGTGGTGG + Intergenic
1197593744 X:128441585-128441607 GGGCTGCCTGAATTTGGTCTGGG - Intergenic