ID: 1167864788

View in Genome Browser
Species Human (GRCh38)
Location 19:52315764-52315786
Sequence TCCTTCCTACACATAGGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167864788 Original CRISPR TCCTTCCTACACATAGGGCT TGG Intronic
900855919 1:5183800-5183822 TCCGTCAGTCACATAGGGCTTGG - Intergenic
903687687 1:25143918-25143940 TCCTTGCTACAGAAAGGGCTTGG + Intergenic
914783078 1:150803461-150803483 TTTTTTATACACATAGGGCTGGG - Intronic
915013433 1:152711466-152711488 GCCTTACTATACATAGTGCTTGG - Intergenic
915466193 1:156099496-156099518 TCCTAGCTACACATGAGGCTGGG + Intronic
915525328 1:156472512-156472534 GCTTTCCTACACAGAGGGCTGGG + Intronic
919941147 1:202287113-202287135 TCCTTCCTACAGATATGGGAGGG - Intronic
920192869 1:204205392-204205414 TCTTTCCAACAGATAGTGCTGGG - Intronic
920772105 1:208897814-208897836 TCCTTTCAACAAATAGTGCTGGG - Intergenic
1065428598 10:25631208-25631230 TCCCTCCTACACTTCTGGCTTGG + Intergenic
1067582932 10:47456965-47456987 TGCTTCCTGCACATAAGGCATGG + Intergenic
1068630264 10:59290774-59290796 TCTTTTCTACACATTGCGCTAGG - Intronic
1070698144 10:78578231-78578253 TAGTCCCTACACATAGGCCTGGG + Intergenic
1071072329 10:81709390-81709412 TCTTTCACACACATATGGCTAGG + Intergenic
1072632706 10:97157645-97157667 ACCTTCCTACAGAAAGGGCCTGG + Intronic
1075834551 10:125442716-125442738 TCCAACATGCACATAGGGCTTGG - Intergenic
1077529807 11:3089915-3089937 TCCTTCCTGCACCGAGGGCATGG + Exonic
1078621791 11:12915110-12915132 CCCTTCCTATCCAGAGGGCTTGG - Intronic
1079352617 11:19704701-19704723 TTCTTCCCACACATATGACTAGG - Intronic
1081721576 11:45293363-45293385 TGCTTCCTACACATCAGGCTTGG + Intergenic
1081876402 11:46411326-46411348 TCCTTCCTAAACATGGGTGTTGG + Intronic
1084964683 11:72738496-72738518 TCCTTGCTCCCCATAGGGCTAGG - Intronic
1085136473 11:74093778-74093800 TCCTTCCTAGGCATAGGACTGGG + Intronic
1087265548 11:96056813-96056835 TGCCTCCCACACGTAGGGCTTGG - Intronic
1088909840 11:114182533-114182555 TCCTTCCTACACACGGGGGCTGG - Intronic
1090643335 11:128747510-128747532 TACTTCCTACCCATCCGGCTAGG + Intronic
1090792591 11:130104639-130104661 TCCTTCCTACACATATCTTTAGG + Intronic
1094826146 12:34270662-34270684 CCTTTCCTACACATAAAGCTTGG + Intergenic
1095122230 12:38433317-38433339 TCCTTTCTAAATATATGGCTAGG - Intergenic
1095321623 12:40835338-40835360 TCCTTCCTACAAATATTCCTGGG - Intronic
1095330453 12:40955314-40955336 TCTTTACTACACATAGGGGTGGG + Intronic
1097007672 12:55931030-55931052 TCCTTCTTACACCTGGGGGTGGG - Exonic
1097106997 12:56631846-56631868 TCCTTACTCCACAGAGGGGTGGG + Intronic
1097817009 12:64085885-64085907 ACCTTTCTTCACATAGGGCCAGG - Intronic
1098416141 12:70237364-70237386 CCCTACCTATACATAGGGCAAGG + Intergenic
1098977295 12:76916348-76916370 ATCTTCCCACTCATAGGGCTTGG - Intergenic
1099552537 12:84066127-84066149 ACCCTCCTAGACATTGGGCTAGG - Intergenic
1104475228 12:129065491-129065513 TGCTTCATTCACACAGGGCTAGG + Intergenic
1106794937 13:33195713-33195735 GCCTTCCTTCACTTAGGGCTTGG - Intronic
1114552809 14:23543629-23543651 CCCTTCCTTCACACAGGGCATGG - Intronic
1115724053 14:36193903-36193925 TCCTTCTTCCACATATGGCAGGG + Intergenic
1119270355 14:73298309-73298331 TCCTGGCTACACGTGGGGCTGGG - Intronic
1119861971 14:77942560-77942582 TGCTCCCTACACCTATGGCTTGG + Intergenic
1120062633 14:80002064-80002086 TTCTCCCTACACCTAGGGCTGGG - Intergenic
1120182791 14:81362878-81362900 TCCTGCTTACACAAAGGTCTCGG + Intronic
1122413309 14:101536967-101536989 TCCTTCCTCCACATACTGTTGGG - Intergenic
1124594812 15:31083603-31083625 TCCTTTCTGCATATAAGGCTGGG - Intronic
1131257917 15:90873647-90873669 TCCTTCCATCCCCTAGGGCTGGG + Intronic
1132029747 15:98430094-98430116 TCCTTACTCCAGAGAGGGCTGGG - Intergenic
1132750687 16:1456057-1456079 TCCTTCCAACACACAGGGCGAGG + Intronic
1132899477 16:2245348-2245370 TCCTTCCTGCAGACAGGGCGGGG - Intronic
1136297687 16:29312992-29313014 TCCTTCCTTCTGAGAGGGCTGGG + Intergenic
1136475936 16:30513406-30513428 TCCTTCCAACACACACTGCTGGG - Intronic
1138477270 16:57279113-57279135 TCATTCCCACATATAGTGCTAGG + Intronic
1140020925 16:71237892-71237914 CCCATCCTCCACATAGGACTGGG - Intergenic
1141033779 16:80611163-80611185 TCCTTCCAAGACAGAGAGCTGGG + Intronic
1142059241 16:88019070-88019092 TCCTTCCTTCTGAGAGGGCTGGG + Intronic
1143357667 17:6342586-6342608 TGCCTCCTAAACAGAGGGCTGGG + Intergenic
1143625582 17:8108789-8108811 TCCTTCCTGCACAGGGGCCTGGG + Intronic
1144959152 17:19035137-19035159 TCCTTCCTACTCTTAGGCCTTGG - Intronic
1144976007 17:19139387-19139409 TCCTTCCTACTCTTAGGCCTTGG + Intronic
1146227805 17:31082342-31082364 TCCTTCCAACAAATACTGCTGGG - Intergenic
1147479274 17:40743848-40743870 TCCTTCCTTCACGTAGTGTTTGG + Intergenic
1148578169 17:48725662-48725684 TCCTTCCTGCACCTTAGGCTGGG - Exonic
1154934223 18:21034556-21034578 TCCTTTCAACACATAGTGTTAGG + Intronic
1158080155 18:53580708-53580730 TCCTTTCTACACAGTGGCCTTGG - Intergenic
1159031723 18:63238763-63238785 TTCTTCCTACGCAGAGGGCTGGG + Intronic
1159107203 18:64016085-64016107 TCCTTCCCAGAAAGAGGGCTGGG + Intergenic
1160178582 18:76615505-76615527 TCCCTCCTCCACCTGGGGCTGGG + Intergenic
1160387092 18:78503369-78503391 TCCCTCCCACATACAGGGCTCGG + Intergenic
1160981822 19:1819755-1819777 TCCGTCCTACACAGAAGCCTGGG + Intronic
1161770742 19:6229407-6229429 TCCTTCCTCCTCATGGGGCATGG - Intronic
1161983220 19:7641251-7641273 TCCTAGCTACTCATGGGGCTGGG + Intronic
1163503067 19:17687606-17687628 TCCTCTTTACACCTAGGGCTGGG + Intronic
1166419497 19:42625543-42625565 TCCTTCCACTACATTGGGCTTGG + Intronic
1167860905 19:52283215-52283237 TGCTGCCTAAACAGAGGGCTTGG + Intronic
1167864788 19:52315764-52315786 TCCTTCCTACACATAGGGCTTGG + Intronic
1167875199 19:52406445-52406467 TCCTCCCTAAATACAGGGCTTGG + Intronic
1167878569 19:52435010-52435032 TCCTACCTAAATATAGGGCTTGG + Intronic
1167900464 19:52617884-52617906 TCCTACAGAAACATAGGGCTGGG - Intronic
1167923831 19:52807259-52807281 TCCTACAGAAACATAGGGCTGGG - Intronic
1167936681 19:52914457-52914479 TCCTACTGAAACATAGGGCTGGG - Intergenic
926527240 2:13995846-13995868 ACCCTCCTACACATTGGGTTAGG + Intergenic
926702126 2:15810775-15810797 TCCTCCCTCCACACAGGGCCCGG + Intergenic
928373543 2:30758001-30758023 TCCATCCTTCACAGAGCGCTTGG - Intronic
929940509 2:46330331-46330353 CTCTTCCTACACGTAGAGCTAGG + Intronic
932084504 2:68746395-68746417 TCCTTCCTCCTCACAGGGCAAGG + Intronic
934739095 2:96706256-96706278 TTCTTCTTACACCTTGGGCTTGG - Intronic
935932094 2:108138319-108138341 TCTGTCCTACACAGAGGGCAAGG - Intergenic
936615974 2:114048158-114048180 TCCTCCCTGCACATAGGGAAGGG + Intergenic
937125291 2:119471513-119471535 GCCTTCCTCCACATAGAGCAAGG + Intronic
937833016 2:126444426-126444448 TCTCCCCTACAGATAGGGCTGGG - Intergenic
940639472 2:156332105-156332127 TCCCTCGTATACATAGGACTTGG + Intronic
946890030 2:224265667-224265689 TCCTTCCTATACACAGCTCTAGG - Intergenic
948597158 2:239087492-239087514 TCCTTCCCTCCCTTAGGGCTGGG - Intronic
1170309023 20:14972410-14972432 ACCTTCCTAAGCATAGGGTTGGG + Intronic
1170653651 20:18265946-18265968 GCCTTCCTACACAGAAGGATAGG + Intergenic
1172272914 20:33664421-33664443 TCACTCCTACACATTGTGCTTGG + Intronic
1172682380 20:36726723-36726745 TCCCTCCTACTCATATGACTAGG - Intronic
1176105237 20:63382661-63382683 TCCCTCCTTCCCTTAGGGCTGGG + Intergenic
1176373009 21:6073799-6073821 CCCTTCTTACAGATGGGGCTTGG - Intergenic
1178403104 21:32304112-32304134 TCCTTCCTAAAAATAGTGCAGGG - Intronic
1179750468 21:43464444-43464466 CCCTTCTTACAGATGGGGCTTGG + Intergenic
1179756176 21:43497301-43497323 TCCTTCCATCAAATAGTGCTGGG + Intergenic
1181139802 22:20796136-20796158 TCCTTCCTACCTTTAGGGCAGGG + Exonic
1183332859 22:37230583-37230605 TCCTTCCTTCAAATCTGGCTGGG + Intronic
1185392623 22:50570832-50570854 GCCCTCCTACACGCAGGGCTTGG - Intronic
949608607 3:5680837-5680859 TTCTTCCTACTCATAGGCTTTGG - Intergenic
950694070 3:14684014-14684036 CTCTTCCTACCCATAGGCCTGGG - Intronic
950894984 3:16440531-16440553 TCCTTACTGGACAGAGGGCTTGG + Intronic
951582331 3:24179115-24179137 TCATTCCTCTAGATAGGGCTGGG - Intronic
958676436 3:97273961-97273983 CCTTTCCTACACATAAAGCTCGG - Intronic
960400962 3:117198302-117198324 TCCTTCAAACTCATAGGGTTAGG + Intergenic
962523571 3:136218721-136218743 CCCTTCCTACACATCAAGCTTGG - Intergenic
962780862 3:138715109-138715131 TCTTTCCTACACATAGAGAAGGG - Intronic
964417142 3:156459248-156459270 TCCTTCCTGCCCCTAAGGCTGGG - Intronic
967084031 3:186078068-186078090 TCCTTCCTTCTCAGGGGGCTGGG + Intronic
968648889 4:1752684-1752706 GCCCTCCTCCACATAGGCCTGGG + Intergenic
969257169 4:6010124-6010146 TCCTACATTCACATAGGGCATGG + Intergenic
970856246 4:20651888-20651910 TCCTCCCTTCTCATAGGGATGGG - Intergenic
971745477 4:30574429-30574451 CCCTGCCTACACCTAGGGTTTGG + Intergenic
972318031 4:37945593-37945615 TCCTTCTTTGACATAGAGCTGGG - Intronic
972784077 4:42310983-42311005 CCCTTCCTACTCCTAGGGCTGGG + Intergenic
974162790 4:58161679-58161701 TTCTTCCCACGCATAGGGCAGGG + Intergenic
988277479 5:29100246-29100268 TCCACCCTACAGATGGGGCTAGG + Intergenic
994688600 5:102988332-102988354 TCCTTCCCAAGGATAGGGCTGGG - Intronic
997235224 5:132268560-132268582 TCCTTCCTCCACCCTGGGCTAGG - Intronic
998036860 5:138924779-138924801 TCCTTCCTCACCACAGGGCTGGG - Intronic
998294968 5:140960466-140960488 TCCTTCTTACACAGAGGTGTAGG + Intronic
1000223121 5:159233396-159233418 TCCTTCCAACACATATGCCATGG - Intergenic
1001204334 5:169747965-169747987 TCCTTCCCAAACACAGGGATAGG - Intronic
1002962594 6:1930097-1930119 TCCTACCTCCACATAGTCCTTGG + Exonic
1003188405 6:3852184-3852206 TCCCTCCTATACTCAGGGCTGGG - Intergenic
1006515285 6:34542063-34542085 TCCTCCCCACCCACAGGGCTAGG - Intronic
1007637214 6:43306695-43306717 TCCCTAATACACATAGGGATGGG - Intronic
1010690013 6:78899264-78899286 ACCTTCCTAAACATATTGCTGGG - Exonic
1010887333 6:81261152-81261174 TCCTGCTTTCACACAGGGCTGGG + Intergenic
1012001201 6:93657475-93657497 TCCATTCTAGACATAGGCCTTGG - Intergenic
1012396326 6:98801530-98801552 TACTTCCTACTCATAAGGATGGG + Intergenic
1013471287 6:110468715-110468737 TCCATCCTAGACAGAGGGGTTGG + Intronic
1015330585 6:131974076-131974098 TGGTTCCTACTCCTAGGGCTTGG - Intergenic
1015888723 6:137947228-137947250 TCCTTCCTGCTCAGAGGCCTTGG + Intergenic
1018432984 6:163737435-163737457 TCCTTCCAAGACAAAGGCCTCGG - Intergenic
1019671769 7:2283723-2283745 TCCTTCAAACACAGAGGGCTGGG + Intronic
1023647521 7:42333877-42333899 TCCTTTCAACAAATAGTGCTGGG + Intergenic
1024715747 7:52077591-52077613 ACCTCCCTAAAAATAGGGCTTGG - Intergenic
1031450391 7:121910124-121910146 TTTTTCCAACACATGGGGCTTGG + Intronic
1031459051 7:122022977-122022999 TCCTTCCAACAGATGGTGCTAGG + Intronic
1042358613 8:67856513-67856535 TCATTCCTGCACATAGGCCAAGG - Intergenic
1042495717 8:69452813-69452835 TCCATCCTGCACACAGGCCTCGG + Intergenic
1047013176 8:120693868-120693890 TCCTTTCTTCACATAGGGCGTGG + Exonic
1048051828 8:130825320-130825342 TCCTTCCTACAGAGAGGGGTTGG - Intronic
1048493091 8:134912803-134912825 TGACTCCTACACACAGGGCTTGG + Intergenic
1051605377 9:18913042-18913064 TTCTTCCAACACATAGAACTTGG - Intergenic
1052380389 9:27764707-27764729 TCCTTCCCACCCAATGGGCTTGG + Intergenic
1055911263 9:81354973-81354995 TCCTTCCAACAAATGGTGCTGGG + Intergenic
1061948608 9:133922606-133922628 TCGTTCCAACACATGGTGCTGGG + Intronic
1061949333 9:133927471-133927493 TCTTTTCAACAAATAGGGCTGGG + Intronic
1202630834 M:15026-15048 CTCTTCCTACACATCGGGCGAGG + Intergenic
1187747357 X:22424043-22424065 TCCTTCCTTCACTAATGGCTGGG - Intergenic
1191771902 X:64769900-64769922 AGCTTCTGACACATAGGGCTTGG + Intergenic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1193492278 X:82164792-82164814 TCCCTCCAACACACATGGCTTGG - Intergenic
1193779256 X:85683019-85683041 CCCTTCCTGCACATAGTTCTTGG - Intergenic
1199014289 X:142794474-142794496 TCTTTCCAACAAATAGTGCTGGG - Intergenic