ID: 1167865652

View in Genome Browser
Species Human (GRCh38)
Location 19:52325344-52325366
Sequence CGCTGCAGTGCTTTCCACAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1585
Summary {0: 1, 1: 2, 2: 6, 3: 163, 4: 1413}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167865652_1167865653 30 Left 1167865652 19:52325344-52325366 CCATTGTGGAAAGCACTGCAGCG 0: 1
1: 2
2: 6
3: 163
4: 1413
Right 1167865653 19:52325397-52325419 TCAACCCAGCATCCCATTACTGG 0: 1
1: 5
2: 25
3: 83
4: 640

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167865652 Original CRISPR CGCTGCAGTGCTTTCCACAA TGG (reversed) Exonic
900692632 1:3990286-3990308 CACCACACTGCTTTCCACAATGG + Intergenic
901377810 1:8852165-8852187 TGCTGAACTGTTTTCCACAATGG - Intergenic
901451414 1:9338827-9338849 CTCTGCTGTGCTTTCCTGAATGG + Intronic
904600732 1:31671326-31671348 CTCTGCTGCGCTTTCCACAGTGG - Intronic
905154563 1:35964696-35964718 TGCCACACTGCTTTCCACAATGG + Intronic
905431272 1:37925930-37925952 GCCTGCAGAGCTTCCCACAACGG + Intronic
905955716 1:41993571-41993593 CGCCGCACTGAATTCCACAATGG - Intronic
906159639 1:43638350-43638372 CGCTGCACTGTCTTCCACAATGG - Intergenic
906877562 1:49555950-49555972 CGCTACACTGTCTTCCACAATGG - Intronic
907624555 1:56016375-56016397 CGCCATACTGCTTTCCACAATGG - Intergenic
907982225 1:59494922-59494944 CACCAAAGTGCTTTCCACAATGG + Intronic
908482809 1:64559067-64559089 CGCCATACTGCTTTCCACAATGG - Intronic
908550942 1:65208103-65208125 CTCCACAGTGCTTTCCACAGTGG + Intronic
908681385 1:66665541-66665563 CGCCACACTGCCTTCCACAATGG + Intronic
908935296 1:69368536-69368558 CACCACAATGCTTTCCACAATGG + Intergenic
909025247 1:70474356-70474378 CACCACAGTGTTTTCCACAATGG - Intergenic
909060716 1:70876009-70876031 CACTGCAGTGCTTTCCACAATGG + Intronic
909246510 1:73292008-73292030 CGCCGCACTGACTTCCACAATGG - Intergenic
909373719 1:74916261-74916283 CGCCACACTGCTTTCCACAATGG + Intergenic
909442781 1:75716539-75716561 CGCCACATTGCTTTCCACAGTGG - Intergenic
909458167 1:75873991-75874013 TGCCACACTGCTTTCCACAATGG + Intronic
909596228 1:77409332-77409354 TGCCGTACTGCTTTCCACAATGG + Intronic
910339925 1:86174416-86174438 CACCACACTGCTTTCCACAATGG + Intergenic
910421365 1:87067141-87067163 CGCCACATTGTTTTCCACAATGG + Intronic
911244898 1:95506054-95506076 CGCCATACTGCTTTCCACAATGG + Intergenic
911252753 1:95596726-95596748 CACCACACTGCTTTCCACAATGG - Intergenic
911535224 1:99091479-99091501 CGCCACACTGATTTCCACAATGG + Intergenic
911567357 1:99478748-99478770 CTCTAAACTGCTTTCCACAATGG - Intergenic
911652753 1:100408487-100408509 CACCACACTGCTTTCCACAATGG + Intronic
911659358 1:100483161-100483183 TGCCACACTGCTTTCCACAATGG + Intronic
911667369 1:100568788-100568810 CGTTGCACTGTCTTCCACAATGG - Intergenic
911714372 1:101114060-101114082 CGCTACACTGTCTTCCACAATGG - Intergenic
911795113 1:102065834-102065856 CGCTACACTGACTTCCACAATGG - Intergenic
912038273 1:105350294-105350316 TGCCACACTGCTTTCCACAATGG - Intergenic
912256394 1:108063139-108063161 CACCACACTGCTTTCCACAATGG - Intergenic
912279290 1:108296545-108296567 TGCCACACTGCTTTCCACAATGG + Intergenic
912288936 1:108397812-108397834 TGCCACACTGCTTTCCACAATGG - Intronic
912589116 1:110796548-110796570 CACCACACTGCTTTCCACAATGG + Intergenic
912609081 1:111024829-111024851 CACCGCATTGCTTTCCACAGTGG - Intergenic
912665277 1:111573307-111573329 TGCCACACTGCTTTCCACAATGG + Intronic
912803766 1:112739839-112739861 TGCCACACTGCTTTCCACAATGG - Intergenic
912822124 1:112876278-112876300 TGCCACACTGCTTTCCACAATGG - Intergenic
912894313 1:113570461-113570483 CGCCACAGTGTCTTCCACAATGG + Intronic
913302047 1:117381755-117381777 CGCCACACTGATTTCCACAATGG + Intronic
913649875 1:120903105-120903127 CACCACACTGCTTTCCACAATGG - Intergenic
914076807 1:144360405-144360427 CGCCACACTGCTTTCCACAATGG + Intergenic
914102371 1:144606092-144606114 CGCCACACTGCTTTCCACAATGG - Intergenic
914171257 1:145225982-145226004 CGCCACACTGCTTTCCACAATGG + Intergenic
914296528 1:146331107-146331129 CGCCACACTGCTTTCCACAATGG + Intergenic
914388054 1:147191253-147191275 CGCCACAGTGACTTCCACAATGG + Intronic
914443882 1:147732917-147732939 TGCCACAATGCTTTCCACAATGG - Intergenic
914472121 1:147990033-147990055 CGCCACACTGCCTTCCACAATGG + Intronic
914526367 1:148469955-148469977 CGCCACACTGCTTTCCACAATGG + Intergenic
915631477 1:157156195-157156217 CGCTACAATACTTTCCACCAGGG - Intergenic
915751638 1:158216372-158216394 CGCTACACTGACTTCCACAATGG + Intergenic
915779579 1:158531566-158531588 CTCTACACTGGTTTCCACAATGG + Intergenic
916205478 1:162312152-162312174 CGCCACACTGATTTCCACAATGG + Intronic
916363979 1:164003049-164003071 CTCCACAGTGCTTTCCACAGTGG - Intergenic
916934525 1:169613846-169613868 CCCTACAATGCTTTTCACAAGGG - Intronic
917007672 1:170433131-170433153 TGCGACAGTGCCTTCCACAATGG - Intergenic
917039392 1:170787518-170787540 TGCTACACTGCTTTCCACAGTGG - Intergenic
917184879 1:172342179-172342201 CGCCACACTGCTTTCCACAATGG - Intronic
917251443 1:173066413-173066435 CACCACACTGCTTTCCACAATGG - Intergenic
917363417 1:174202220-174202242 CGCTACACTGACTTCCACAATGG + Intronic
917755121 1:178091392-178091414 CGCCACAGTGTCTTCCACAATGG - Intergenic
918542080 1:185643476-185643498 CACTACACTGATTTCCACAATGG - Intergenic
918877692 1:190070756-190070778 TGTTGTATTGCTTTCCACAATGG + Intergenic
918926762 1:190796560-190796582 CACTAAACTGCTTTCCACAAAGG - Intergenic
918956474 1:191215156-191215178 CGACACACTGCTTTCCACAATGG - Intergenic
919137805 1:193532592-193532614 GGATACAGTGCTTTCCACAATGG - Intergenic
919186463 1:194157588-194157610 CGCCGCACTGTCTTCCACAATGG + Intergenic
919198216 1:194315899-194315921 CGCCACACTGATTTCCACAATGG - Intergenic
919203767 1:194393710-194393732 CACCACACTGCTTTCCACAATGG - Intergenic
919207408 1:194435592-194435614 CGCTACACTGACTTCCACAATGG + Intergenic
919295882 1:195699170-195699192 CTCTCCATTTCTTTCCACAAAGG - Intergenic
919329839 1:196157710-196157732 CGCCGCACTGACTTCCACAATGG - Intergenic
919845824 1:201641577-201641599 GGCTAGAGGGCTTTCCACAAAGG + Intronic
920573941 1:207041802-207041824 CGCCACACTGTTTTCCACAATGG + Intronic
920595937 1:207270072-207270094 CACCACACTGCTTTCCACAATGG + Intergenic
921104768 1:211965368-211965390 CACCACAGTGCTTTCCACGATGG - Intronic
921120722 1:212134460-212134482 CACCACATTGCTTTCCACAATGG - Intergenic
921335407 1:214080590-214080612 CACTACAGTACTTTCCACAATGG + Intergenic
921504745 1:215954135-215954157 CGCCACACTGATTTCCACAATGG - Intronic
921513112 1:216056137-216056159 CTCTGTAGTTCTTACCACAAAGG - Intronic
921787652 1:219250875-219250897 CGCCATACTGCTTTCCACAATGG + Intergenic
923121283 1:230994102-230994124 CCCTTCAGTGTTTTCCACACTGG + Intronic
923193980 1:231646629-231646651 CGCCGCACTGTCTTCCACAATGG + Intronic
923227043 1:231948029-231948051 CGCTACACTGTCTTCCACAATGG - Intronic
923675566 1:236078026-236078048 CGCCATACTGCTTTCCACAATGG - Intergenic
923762188 1:236857100-236857122 CGCTGCACTGCCTTCCACAATGG + Intronic
923875012 1:238037681-238037703 CGCCACACTGATTTCCACAATGG + Intergenic
923938981 1:238798187-238798209 CGCCACACTGCCTTCCACAATGG + Intergenic
923947615 1:238905833-238905855 CGCCACATTGCCTTCCACAATGG - Intergenic
924206816 1:241720373-241720395 CGCTACACTGCCTTCCACAGTGG + Intronic
924413647 1:243834080-243834102 TGCTGAACTGCTTTCCACAGCGG - Intronic
924649549 1:245912933-245912955 CGCCACACTGTTTTCCACAATGG - Intronic
924686659 1:246299413-246299435 CGCCACACTGTTTTCCACAATGG - Intronic
1062803010 10:394119-394141 CACTGGAGTGTTATCCACAAGGG + Intronic
1063704246 10:8415473-8415495 CGCCACACTGCCTTCCACAATGG + Intergenic
1064675243 10:17753681-17753703 CGTTGCAGTACTATTCACAATGG - Intronic
1064762192 10:18632827-18632849 CACTGCACTGACTTCCACAATGG - Intronic
1064763756 10:18649667-18649689 CCCTTCAGTACTTTTCACAAAGG + Intronic
1064853594 10:19738848-19738870 CACCACACTGCTTTCCACAATGG + Intronic
1064975093 10:21105756-21105778 CGCCACACTGTTTTCCACAATGG + Intronic
1064975655 10:21112161-21112183 CGCCACACTGTTTTCCACAATGG - Intronic
1065051882 10:21801554-21801576 CGCCATACTGCTTTCCACAATGG - Intronic
1065157994 10:22890515-22890537 CGCCACACTGCCTTCCACAATGG - Intergenic
1065406205 10:25368654-25368676 CACCACACTGCTTTCCACAATGG - Intronic
1066035226 10:31474632-31474654 CGCCGCACTGACTTCCACAATGG - Intronic
1066077585 10:31895660-31895682 CGCCACACTGCCTTCCACAATGG - Intronic
1066143977 10:32537071-32537093 CACTACACTGCTTTCTACAATGG + Intronic
1066146523 10:32564222-32564244 CGCCACACTGCCTTCCACAATGG - Intronic
1066155828 10:32676791-32676813 CGCCACACTGCCTTCCACAATGG - Intronic
1066176972 10:32917765-32917787 CGCTACACTGTCTTCCACAATGG - Intronic
1066356872 10:34693170-34693192 TGCCACACTGCTTTCCACAATGG - Intronic
1066524351 10:36260175-36260197 CACCACACTGCTTTCCACAATGG - Intergenic
1066667553 10:37800689-37800711 CGCTAAACTGCTTTCCACAGTGG + Intronic
1067235868 10:44448811-44448833 CACTGCACTGTCTTCCACAATGG + Intergenic
1067367968 10:45653738-45653760 CTCCACATTGCTTTCCACAATGG - Intronic
1068015155 10:51506723-51506745 CGCCACAATGCCTTCCACAAGGG - Intronic
1068086613 10:52381461-52381483 CGCCGTACTGCTTTCCACAATGG + Intergenic
1068554732 10:58446812-58446834 CGCCCAACTGCTTTCCACAATGG + Intergenic
1068640469 10:59399323-59399345 CGCCACACTGTTTTCCACAATGG + Intergenic
1069120304 10:64561718-64561740 CGCTACACTGTCTTCCACAATGG + Intergenic
1069326382 10:67236082-67236104 CGCCACAGTGACTTCCACAATGG - Intronic
1069344340 10:67450217-67450239 CGCCACACTGCGTTCCACAATGG - Intronic
1069358769 10:67617673-67617695 TGCCGCACTGTTTTCCACAATGG + Intronic
1069825232 10:71250730-71250752 CGCTGCAGTGGTTTCCTGAAGGG + Intronic
1070233950 10:74603819-74603841 CGCCACACTGTTTTCCACAATGG + Intronic
1070413499 10:76166863-76166885 CACCACACTGCTTTCCACAATGG + Intronic
1070871080 10:79753895-79753917 CACCACACTGCTTTCCACAATGG - Intergenic
1071095836 10:81973478-81973500 CGCCACAGTGTCTTCCACAATGG + Intronic
1071319837 10:84443563-84443585 CGCTACACTGTCTTCCACAATGG - Intronic
1071343511 10:84669527-84669549 CACCACACTGCTTTCCACAATGG - Intergenic
1071421033 10:85499614-85499636 CGCCGCACTGTCTTCCACAATGG + Intergenic
1071638011 10:87276100-87276122 CACCACACTGCTTTCCACAATGG - Intergenic
1071657233 10:87461852-87461874 CACCACACTGCTTTCCACAATGG + Intergenic
1071740309 10:88350801-88350823 CGCCGCACTGTATTCCACAAGGG + Intronic
1071929155 10:90446411-90446433 AGCCACACTGCTTTCCACAATGG + Intergenic
1072407272 10:95167364-95167386 CGCTGCACTGTCTTCCACAATGG - Intergenic
1072802571 10:98403333-98403355 CGCTGCAGCGGTTCCCAAAATGG - Intronic
1073089974 10:100927658-100927680 CGCCACACTGTTTTCCACAATGG + Intronic
1073687879 10:105776091-105776113 CGCCACACTGATTTCCACAATGG + Intergenic
1073784252 10:106871271-106871293 CGCCATACTGCTTTCCACAACGG - Intronic
1073863686 10:107776122-107776144 AACTACACTGCTTTCCACAATGG - Intergenic
1073880830 10:107977794-107977816 TGCCACACTGCTTTCCACAATGG - Intergenic
1074013746 10:109510945-109510967 CACCACACTGCTTTCCACAATGG + Intergenic
1074204824 10:111273705-111273727 CAGTCAAGTGCTTTCCACAAGGG - Intergenic
1074287196 10:112109369-112109391 CGCCACACTGCCTTCCACAATGG - Intergenic
1074845666 10:117395141-117395163 CGCCAAACTGCTTTCCACAATGG - Intergenic
1074885841 10:117692749-117692771 CACCACACTGCTTTCCACAATGG + Intergenic
1075188066 10:120281165-120281187 CACCACACTGCTTTCCACAATGG - Intergenic
1075235938 10:120728736-120728758 CGCCACACTGATTTCCACAATGG + Intergenic
1075345514 10:121679323-121679345 CACTGCAGGACTTTCCCCAATGG + Intergenic
1075363087 10:121857526-121857548 CTCTACACTGCTTTCCACAGTGG - Intronic
1075449112 10:122535808-122535830 CGCCACACTGTTTTCCACAATGG + Intergenic
1075901647 10:126047714-126047736 GACTGCACTGTTTTCCACAATGG - Intronic
1076254191 10:129007515-129007537 CACAACACTGCTTTCCACAATGG + Intergenic
1076254458 10:129010795-129010817 CGCTACACTGACTTCCACAATGG + Intergenic
1076413312 10:130266904-130266926 CCAGGCAGAGCTTTCCACAATGG - Intergenic
1076592634 10:131596898-131596920 CGCCATACTGCTTTCCACAATGG - Intergenic
1076592955 10:131601588-131601610 CGCCATACTGCTTTCCACAATGG - Intergenic
1077148668 11:1057993-1058015 CGCCGCAGCGCTGTCCACTACGG - Intergenic
1077407630 11:2389690-2389712 CGCTGCTGTGGTTTCCAAGATGG - Intronic
1077780311 11:5321085-5321107 CAATGAAGTGCTTTGCACAAAGG + Intronic
1077792764 11:5459801-5459823 CACCACACTGCTTTCCACAATGG - Intronic
1077852752 11:6090167-6090189 GGCCACACTGCTTTCCACAATGG + Intergenic
1077984366 11:7335912-7335934 CGCCACACTGCTTTCCACGATGG + Intronic
1078113285 11:8418657-8418679 CGCCACACTGCTTCCCACAATGG + Intronic
1078259785 11:9694879-9694901 CGCCACACTGCCTTCCACAATGG - Intronic
1078484798 11:11711860-11711882 CGCCACACTGATTTCCACAATGG + Intergenic
1078946827 11:16077380-16077402 CACCACACTGCTTTCCACAATGG - Intronic
1078952211 11:16146924-16146946 CGCCGCACTGTCTTCCACAATGG - Intronic
1078994544 11:16684152-16684174 CGCTACACTGTCTTCCACAATGG - Intronic
1079142604 11:17822549-17822571 CGCTCCAGAGGTTTCCCCAAAGG - Intronic
1079493528 11:21015592-21015614 AGCTGCTGACCTTTCCACAATGG - Intronic
1079809723 11:24982179-24982201 CGCCATACTGCTTTCCACAATGG - Intronic
1079821903 11:25141983-25142005 CGCCACACTGATTTCCACAATGG + Intergenic
1080741451 11:35068297-35068319 CACTACACTGTTTTCCACAATGG + Intergenic
1081194785 11:40148253-40148275 TGCCGCACTGTTTTCCACAATGG + Intronic
1081257602 11:40916118-40916140 CGCTACACTGACTTCCACAATGG - Intronic
1081529671 11:43949271-43949293 CCCTGCAGTTCTTCCCAAAATGG - Intergenic
1082057346 11:47830281-47830303 CACCACACTGCTTTCCACAATGG - Intronic
1082140123 11:48599183-48599205 CGCTTCACTGACTTCCACAATGG + Intergenic
1082208702 11:49470149-49470171 CACTGCACTGACTTCCACAATGG + Intergenic
1082575925 11:54803201-54803223 CGCCACAGTGACTTCCACAATGG - Intergenic
1082600061 11:55138257-55138279 CGCTGCTCTGATGTCCACAATGG - Intergenic
1082665577 11:55971691-55971713 CGTCACACTGCTTTCCACAATGG - Intergenic
1082676825 11:56115122-56115144 CACCACACTGCTTTCCACAATGG - Intergenic
1082808937 11:57467059-57467081 ATTTGCAGTGCTTTCTACAATGG + Intronic
1082871639 11:57948117-57948139 CGCCGCACTGTCTTCCACAATGG + Intergenic
1084794978 11:71499357-71499379 CTCTGCACTGCCTTCCACAATGG + Intronic
1085003897 11:73066904-73066926 CGCTACACTGTCTTCCACAATGG - Intronic
1085141328 11:74145138-74145160 CGCCACACTGCTTTCCAGAACGG + Intronic
1085556169 11:77424079-77424101 AGCTGCAGTGGTTTCCTCATTGG - Intronic
1085661444 11:78370984-78371006 TGCTGTAGTTCTCTCCACAATGG + Intronic
1085964303 11:81501975-81501997 CGCTACACTGTCTTCCACAATGG - Intergenic
1086030744 11:82352161-82352183 TGCCACACTGCTTTCCACAATGG + Intergenic
1086115290 11:83243046-83243068 CGCCAAACTGCTTTCCACAATGG + Intronic
1086172880 11:83856402-83856424 TGCCACACTGCTTTCCACAATGG + Intronic
1086280228 11:85177026-85177048 TGCTGCACTGTCTTCCACAATGG - Intronic
1086313972 11:85569804-85569826 CTCCAAAGTGCTTTCCACAATGG - Intronic
1086517221 11:87626763-87626785 CGCTACACTGACTTCCACAATGG - Intergenic
1086526450 11:87732668-87732690 TGCTACACTGCTTTTCACAATGG + Intergenic
1086820302 11:91428046-91428068 CACTGCAGCGCTATTCACAATGG - Intergenic
1086822257 11:91448229-91448251 AGCCACACTGCTTTCCACAATGG - Intergenic
1086840993 11:91684078-91684100 CGCCGCACTGACTTCCACAATGG - Intergenic
1086870594 11:92032316-92032338 CGCCGCACTGACTTCCACAATGG - Intergenic
1086900312 11:92360049-92360071 CGCTACACTGACTTCCACAATGG + Intronic
1087112699 11:94488374-94488396 CGTCACACTGCTTTCCACAATGG - Intronic
1087362232 11:97175602-97175624 CACCACACTGCTTTCCACAATGG - Intergenic
1087512806 11:99119707-99119729 CGCCACCCTGCTTTCCACAATGG + Intronic
1087663420 11:101014141-101014163 CGCCACACTGTTTTCCACAATGG + Intergenic
1087670998 11:101106636-101106658 TGCTGCACTGTCTTCCACAATGG - Intronic
1087912119 11:103766207-103766229 CACTACACTGCTTTCCAAAATGG + Intergenic
1087935653 11:104031564-104031586 CGCCACATTGCCTTCCACAATGG - Intronic
1088066960 11:105731447-105731469 CGCCACACTGCCTTCCACAATGG - Intronic
1088161580 11:106878199-106878221 CGCCACATTGTTTTCCACAATGG - Intronic
1088424124 11:109683054-109683076 TGCCGCACTGCTTTCCACAGTGG - Intergenic
1088453219 11:110004577-110004599 CGCCACACTGCTTTCCACAATGG + Intergenic
1088594900 11:111433971-111433993 CGCTACATTGTCTTCCACAATGG - Intronic
1088730284 11:112674868-112674890 TGCCACACTGCTTTCCACAATGG - Intergenic
1088779076 11:113116383-113116405 GGCTGCAGTGCTTTCTCCAAGGG + Intronic
1089106464 11:116010465-116010487 CGCCACACTGATTTCCACAATGG - Intergenic
1090169553 11:124587862-124587884 CTCTGCATTGTTTTCCATAATGG - Intergenic
1090591470 11:128274781-128274803 TGCCACACTGCTTTCCACAATGG + Intergenic
1090689367 11:129161717-129161739 CGCCGCACTGTCTTCCACAATGG - Intronic
1091527376 12:1316654-1316676 CGCCACAGTGTCTTCCACAATGG - Intronic
1091711834 12:2746751-2746773 CGCCACACTGTTTTCCACAACGG + Intergenic
1091901819 12:4150299-4150321 CTCCACAGTGCTTTTCACAATGG + Intergenic
1092514107 12:9190063-9190085 CGCCACACTGCTTTCCATAATGG - Intronic
1092519439 12:9252766-9252788 CGCCACACTGTTTTCCACAATGG - Intergenic
1092587722 12:9917677-9917699 TGCCACACTGCTTTCCACAATGG + Intronic
1092620158 12:10255164-10255186 CTCCGTACTGCTTTCCACAAGGG - Intergenic
1092627360 12:10341027-10341049 CACTACACTGTTTTCCACAATGG + Intergenic
1093097753 12:14991332-14991354 TGTTGTACTGCTTTCCACAATGG - Intergenic
1093218528 12:16390878-16390900 CGCCACACTTCTTTCCACAATGG + Intronic
1093219874 12:16407484-16407506 TGCCTCACTGCTTTCCACAATGG - Intronic
1093253658 12:16839342-16839364 CGCCACATTGTTTTCCACAATGG - Intergenic
1093498393 12:19782946-19782968 GGCCACACTGCTTTCCACAATGG - Intergenic
1093502165 12:19825847-19825869 CCCCACACTGCTTTCCACAATGG - Intergenic
1093689670 12:22096145-22096167 TGCCACACTGCTTTCCACAATGG + Intronic
1094062868 12:26333325-26333347 CGCCGCACTGTCTTCCACAATGG + Intergenic
1094128862 12:27053176-27053198 CGCCACACTGCTTTCCACAATGG + Intronic
1094156231 12:27339525-27339547 TGCCACACTGCTTTCCACAATGG + Intronic
1094299345 12:28944225-28944247 CACCGCAGTGTCTTCCACAATGG + Intergenic
1094464635 12:30738974-30738996 TGCCACACTGCTTTCCACAATGG - Intronic
1095147012 12:38742095-38742117 CGCCACACTGATTTCCACAATGG - Intronic
1095186287 12:39203984-39204006 CACCACACTGCTTTCCACAATGG - Intergenic
1095194675 12:39299523-39299545 TGCCACACTGCTTTCCACAATGG - Intronic
1095489031 12:42713824-42713846 CGCTACACTGTCTTCCACAATGG - Intergenic
1095535536 12:43241831-43241853 GACTGGAATGCTTTCCACAAAGG - Intergenic
1095551685 12:43449055-43449077 CGCCACACTGCTTTCCACAGTGG - Intronic
1095674778 12:44903459-44903481 CGCTACACTGTTTTCCACAATGG - Intronic
1096338135 12:50773335-50773357 TGCTGCACTGTCTTCCACAATGG + Intronic
1096884748 12:54705875-54705897 TGCCACACTGCTTTCCACAATGG + Intergenic
1096949972 12:55458201-55458223 CGCCACACTGCTTTCCACAATGG - Intergenic
1097320006 12:58214863-58214885 CTCTGGACTGCTTTCCACAGTGG + Intergenic
1097337337 12:58397533-58397555 CACCACACTGCTTTCCACAATGG + Intergenic
1097364459 12:58695961-58695983 TGCTACTCTGCTTTCCACAAGGG - Intronic
1097467939 12:59951151-59951173 CGCCACACTGTTTTCCACAATGG - Intergenic
1097468187 12:59953706-59953728 CGCCACACTGTTTTCCACAATGG - Intergenic
1097471897 12:60003629-60003651 CGCCACACTGTTTTCCACAATGG + Intergenic
1097535931 12:60870638-60870660 TGCCACACTGCTTTCCACAATGG + Intergenic
1097565815 12:61266762-61266784 CGCCACAGTGTCTTCCACAACGG - Intergenic
1097763541 12:63496931-63496953 CACTACACTGCTTTCCACAGTGG - Intergenic
1097838513 12:64297955-64297977 CGCCACACTGCCTTCCACAATGG + Intronic
1097950430 12:65421036-65421058 TGCCACACTGCTTTCCACAATGG + Intronic
1098145637 12:67495220-67495242 CACTACACTGCTTTTCACAATGG - Intergenic
1098409161 12:70161368-70161390 TGCTGCACTGCTTTCCACGATGG + Intergenic
1098803846 12:74996764-74996786 CGCCACACTGATTTCCACAATGG - Intergenic
1098822183 12:75246735-75246757 CGCCACACTGATTTCCACAATGG + Intergenic
1098844387 12:75518001-75518023 CGCCACACTGATTTCCACAATGG + Intergenic
1098864750 12:75748942-75748964 CGCCACAGTGTCTTCCACAATGG - Intergenic
1099358219 12:81664608-81664630 CGCCACAGTGACTTCCACAATGG - Intronic
1099436561 12:82653000-82653022 CGCTACACTGACTTCCACAATGG + Intergenic
1099486611 12:83236421-83236443 CGCCACACTGTTTTCCACAATGG - Intergenic
1099486698 12:83237507-83237529 CGCCACACTGTTTTCCACAATGG + Intergenic
1099571115 12:84320114-84320136 CTCCACACTGCTTTCCACAATGG + Intergenic
1099618230 12:84966448-84966470 CACCGCAGTGTCTTCCACAATGG + Intergenic
1099663236 12:85593575-85593597 CACCACACTGCTTTCCACAATGG + Intergenic
1099687172 12:85905312-85905334 CTCTGCACTGCTTTCCATAATGG + Intergenic
1099696721 12:86032333-86032355 CGCAACACTGCTTTCCACAGTGG + Intronic
1099701533 12:86088814-86088836 CACCACACTGCTTTCCACAACGG - Intronic
1099720093 12:86350214-86350236 GGCTGCAGAGCTTTCAGCAATGG - Intronic
1099868448 12:88315383-88315405 CACTACACTGTTTTCCACAATGG + Intergenic
1099962307 12:89408376-89408398 CGCCACAGTGTCTTCCACAATGG + Intergenic
1099991616 12:89728456-89728478 CACCGAACTGCTTTCCACAATGG - Intergenic
1100350946 12:93781914-93781936 CGCCACACTGATTTCCACAATGG - Intronic
1100564327 12:95780722-95780744 CGCCACAGTGTCTTCCACAATGG - Intronic
1100931671 12:99617213-99617235 TGCTGCACTGTCTTCCACAATGG - Intronic
1101186738 12:102288749-102288771 CGCCACACTGATTTCCACAATGG + Intergenic
1101979275 12:109391633-109391655 CGCCACACTGTTTTCCACAATGG + Intronic
1102142767 12:110629665-110629687 CGCCGCACTGTCTTCCACAATGG - Intronic
1102537931 12:113595381-113595403 TGCCACACTGCTTTCCACAATGG + Intergenic
1103428218 12:120857395-120857417 CGCCACAGTGTCTTCCACAATGG - Intronic
1104305341 12:127605473-127605495 CACCCCACTGCTTTCCACAATGG + Intergenic
1104331403 12:127849689-127849711 TGCCACACTGCTTTCCACAATGG + Intergenic
1104612375 12:130240130-130240152 CGCCACACTGCTTTCCACAGTGG - Intergenic
1105477853 13:20744254-20744276 CGCCACACTGTTTTCCACAATGG + Intronic
1105785196 13:23741240-23741262 TGCCACACTGCTTTCCACAATGG - Intronic
1106578013 13:30993751-30993773 CGCTACACTGACTTCCACAATGG - Intergenic
1106615744 13:31325972-31325994 AGGTGCTGTGCTTTCAACAAAGG - Intronic
1106873808 13:34050195-34050217 CACTGTACTGTTTTCCACAATGG + Intergenic
1106963597 13:35032220-35032242 CGCCATACTGCTTTCCACAATGG + Intronic
1107116148 13:36747803-36747825 TGCCACACTGCTTTCCACAATGG + Intergenic
1107134392 13:36927781-36927803 CGCTGTATTGTTGTCCACAATGG + Intergenic
1107258498 13:38461206-38461228 TGCTACACTGCTTTCCACAATGG - Intergenic
1107333978 13:39333787-39333809 TGCTGCACTGTCTTCCACAATGG - Intergenic
1107347642 13:39479430-39479452 CCCTGCAGTTCTTTCCAGAGTGG + Intronic
1107380196 13:39848842-39848864 TGCTGCACTGTCTTCCACAATGG + Intergenic
1107389623 13:39950496-39950518 CACCACACTGCTTTCCACAATGG - Intergenic
1107970345 13:45635737-45635759 CGCCACAGTGTCTTCCACAATGG + Intergenic
1108103095 13:46978908-46978930 CGCCACAGTGACTTCCACAATGG + Intergenic
1108241676 13:48470981-48471003 CGCTACACTGACTTCCACAATGG - Intronic
1108264252 13:48688827-48688849 CGCCGCACTGCCTTCCACAATGG + Intronic
1108467841 13:50735926-50735948 AGCCACACTGCTTTCCACAATGG - Intronic
1108711857 13:53041047-53041069 CACCACACTGCTTTCCACAATGG - Intronic
1108787834 13:53927370-53927392 TGCTATACTGCTTTCCACAATGG + Intergenic
1108795673 13:54027100-54027122 CACCACACTGCTTTCCACAATGG - Intergenic
1108854845 13:54780358-54780380 CACTGCACTACTTTCCACAATGG - Intergenic
1108917243 13:55630156-55630178 CGCCAAACTGCTTTCCACAATGG + Intergenic
1109158329 13:58939760-58939782 CACCACACTGCTTTCCACAATGG + Intergenic
1109198670 13:59407420-59407442 CGCCACACTGCTTTCCACAATGG + Intergenic
1109227041 13:59709666-59709688 CGCCACACTGCCTTCCACAACGG - Intronic
1109531391 13:63653204-63653226 TGCCGCAGTGTGTTCCACAATGG + Intergenic
1109598635 13:64592943-64592965 CACTAAACTGCTTTCCACAATGG + Intergenic
1109635055 13:65104484-65104506 CGCCACAGTGTCTTCCACAATGG + Intergenic
1109759971 13:66815343-66815365 TGCTGAACTGCTTTCCACAATGG - Intronic
1110030328 13:70603493-70603515 TGCCACACTGCTTTCCACAATGG - Intergenic
1110035228 13:70673862-70673884 CACCACACTGCTTTCCACAATGG - Intergenic
1110060977 13:71037687-71037709 TGCTACACTGCTTTCCACAATGG + Intergenic
1110246442 13:73330259-73330281 CGTCACAGTGCTTTTCACAATGG - Intergenic
1110290373 13:73798832-73798854 GGCCACACTGCTTTCCACAATGG - Intronic
1110334663 13:74313659-74313681 CACCACACTGCTTTCCACAATGG + Intergenic
1110431892 13:75434081-75434103 TGCTGTACTGCTTTCCACGATGG - Intronic
1110529710 13:76581919-76581941 CGCTACACTGACTTCCACAATGG - Intergenic
1110531772 13:76606366-76606388 CGCTACACTGACTTCCACAATGG - Intergenic
1110536179 13:76653403-76653425 TGCCACACTGCTTTCCACAATGG - Intergenic
1110743136 13:79020537-79020559 TGCCACACTGCTTTCCACAATGG - Intergenic
1110789943 13:79576436-79576458 CGCCATACTGCTTTCCACAATGG + Intergenic
1110803689 13:79730278-79730300 CACCACACTGCTTTCCACAATGG + Intergenic
1110824406 13:79955876-79955898 CGCCGCACTGTCTTCCACAATGG - Intergenic
1110994850 13:82094262-82094284 CACCACACTGCTTTCCACAATGG - Intergenic
1111040625 13:82742352-82742374 CGCGACACTGATTTCCACAATGG - Intergenic
1111287650 13:86116702-86116724 CTCCACAGTGTTTTCCACAATGG + Intergenic
1111295596 13:86274478-86274500 CGCCGCACTGACTTCCACAATGG - Intergenic
1111299078 13:86322918-86322940 CGCTATAGTGACTTCCACAAGGG - Intergenic
1111325004 13:86682822-86682844 CGCTACACTGACTTCCACAATGG - Intergenic
1111374673 13:87363307-87363329 CGCCGCACTGTCTTCCACAATGG + Intergenic
1111412902 13:87899598-87899620 CACCACACTGCTTTCCACAATGG - Intergenic
1111439945 13:88268376-88268398 TGCCACACTGCTTTCCACAATGG - Intergenic
1111752894 13:92357286-92357308 TGCCACACTGCTTTCCACAATGG + Intronic
1111814138 13:93129392-93129414 CACCACACTGCTTTCCACAATGG + Intergenic
1112099903 13:96177192-96177214 CGCCATACTGCTTTCCACAATGG - Intronic
1112293165 13:98162892-98162914 CGCCACACTGCTTTCCACAACGG - Intronic
1112336161 13:98518144-98518166 CACTGCTGTCCTTTACACAAGGG + Intronic
1112416082 13:99204642-99204664 CGCTGCAGAGATTTTCAAAACGG + Intronic
1112721172 13:102247660-102247682 CACCACACTGCTTTCCACAATGG - Intronic
1112964652 13:105173275-105173297 CTCTACATTGCTTTCCATAATGG - Intergenic
1113068703 13:106396931-106396953 TGCCGCACTGCTTTCCACAATGG + Intergenic
1113395569 13:109944396-109944418 TGCTGCACTGTCTTCCACAATGG - Intergenic
1113729439 13:112629529-112629551 CATTGCAGTGCTTTCAACCATGG - Intergenic
1114005014 14:18302820-18302842 AGCTGCAGGGCTGTTCACAATGG + Intergenic
1114132048 14:19802437-19802459 CGCCACACTGCTTTCCATAATGG + Intronic
1114133031 14:19815241-19815263 CGCTACACTGTCTTCCACAATGG + Intronic
1114279300 14:21176388-21176410 AGCCACACTGCTTTCCACAATGG - Intergenic
1114330375 14:21630963-21630985 CGCCATACTGCTTTCCACAATGG + Intergenic
1114366539 14:22033087-22033109 CGCCACACTGCCTTCCACAATGG + Intergenic
1114698312 14:24648694-24648716 CGCTGCACTGTCTTCCACAATGG - Intergenic
1114741256 14:25100088-25100110 CGCCACATTGCCTTCCACAATGG - Intergenic
1115005132 14:28473305-28473327 CTCTGAACTGCTTTCCACAGTGG + Intergenic
1115046181 14:28997488-28997510 CACCACACTGCTTTCCACAATGG - Intergenic
1115235376 14:31204317-31204339 CGCCACACTGTTTTCCACAATGG + Intronic
1115412687 14:33093540-33093562 CGCCGCACTGTCTTCCACAATGG - Intronic
1115886708 14:37980136-37980158 TGCCACACTGCTTTCCACAATGG + Intronic
1115939798 14:38596015-38596037 CGCCACACTGCCTTCCACAATGG + Intergenic
1116150401 14:41134198-41134220 CGCCGCACTGACTTCCACAATGG - Intergenic
1116202315 14:41813762-41813784 CGCTACACTGTCTTCCACAATGG + Intronic
1116231285 14:42220910-42220932 CGCTGAACTGCTTTCCACAATGG - Intergenic
1116279331 14:42882640-42882662 CGCCACAGTGACTTCCACAAGGG - Intergenic
1116285483 14:42966493-42966515 TGGAGCTGTGCTTTCCACAAAGG + Intergenic
1116320770 14:43459641-43459663 CGCTACACTGTTTTCCACAATGG - Intergenic
1116331526 14:43602811-43602833 CGCTACACTGACTTCCACAATGG - Intergenic
1116417687 14:44698508-44698530 GGCTGCACTGTCTTCCACAATGG - Intergenic
1116535533 14:46024090-46024112 CGCCATACTGCTTTCCACAATGG - Intergenic
1116553677 14:46275258-46275280 CACTGCACTGCTTTCCACAATGG - Intergenic
1116648442 14:47559969-47559991 CGCAACATTGTTTTCCACAATGG + Intronic
1116690371 14:48098719-48098741 CGCCGCACTGTCTTCCACAATGG + Intergenic
1116724519 14:48545503-48545525 CGCTAAAGTGTTTTCCACAGTGG + Intergenic
1116800149 14:49435117-49435139 CACCACATTGCTTTCCACAAAGG - Intergenic
1117001149 14:51372797-51372819 TGCCACAGTGCTTTGCACAATGG + Intergenic
1117080266 14:52144511-52144533 TGCCACACTGCTTTCCACAATGG + Intergenic
1117437153 14:55727193-55727215 CGCCACAGTGTCTTCCACAATGG + Intergenic
1117457976 14:55916904-55916926 TGCCACACTGCTTTCCACAATGG + Intergenic
1117458229 14:55919163-55919185 CGCCACACTGCCTTCCACAATGG - Intergenic
1117506526 14:56409180-56409202 CACCGAACTGCTTTCCACAACGG - Intergenic
1117526478 14:56611609-56611631 CGCCACATTGCTTTCCACAATGG - Intronic
1117952097 14:61092839-61092861 CGCCACACTGCCTTCCACAATGG + Intergenic
1118241057 14:64059576-64059598 CTCTGTAGTGGTTGCCACAAGGG - Intronic
1118479632 14:66151447-66151469 CACCACACTGCTTTCCACAATGG - Intergenic
1119094873 14:71820316-71820338 CACCACACTGCTTTCCACAATGG + Intergenic
1119876861 14:78067503-78067525 CCCCACATTGCTTTCCACAATGG + Intergenic
1120020173 14:79520838-79520860 CGCCACACTGTTTTCCACAATGG - Intronic
1120426423 14:84353466-84353488 TGCTATACTGCTTTCCACAAGGG - Intergenic
1120480914 14:85047958-85047980 AGCTACACTGCTTTCCACAATGG + Intergenic
1120743330 14:88131565-88131587 CGCCACACTGTTTTCCACAATGG + Intergenic
1121799811 14:96765204-96765226 CGCCACACTGATTTCCACAATGG + Intergenic
1123206331 14:106716872-106716894 CACCACACTGCTTTCCACAATGG + Intergenic
1123211412 14:106764281-106764303 CACCACACTGCTTTCCACAATGG + Intergenic
1202943819 14_KI270726v1_random:8486-8508 CGCCACACTGCCTTCCACAATGG + Intergenic
1123634991 15:22296227-22296249 CACTGCAGTGTTGTTCACAATGG - Intergenic
1123885425 15:24722498-24722520 CGCCACACTGTTTTCCACAATGG - Intergenic
1124122661 15:26903525-26903547 TGCCCCACTGCTTTCCACAATGG + Intronic
1124674302 15:31670350-31670372 CGCCACACTGTTTTCCACAATGG + Intronic
1124993030 15:34694639-34694661 CGCCACACTGCTTTCCACAATGG - Intergenic
1125235257 15:37505629-37505651 CTCTGAACTGCTTTCCACAGTGG - Intergenic
1125247796 15:37661360-37661382 GACTACACTGCTTTCCACAATGG + Intergenic
1125443530 15:39729159-39729181 TGCCACACTGCTTTCCACAATGG - Intronic
1125780795 15:42265279-42265301 TGCCACAGTGCTTTCCACAGTGG + Intronic
1125787765 15:42337054-42337076 CACCACATTGCTTTCCACAATGG - Intronic
1125912271 15:43451754-43451776 CGCCACAGTGACTTCCACAATGG + Intronic
1126285510 15:47006393-47006415 CGCCACACTGCCTTCCACAATGG + Intergenic
1126889454 15:53188633-53188655 CGCCACAGTGTCTTCCACAATGG - Intergenic
1126951646 15:53888123-53888145 CACTGCACTGTCTTCCACAATGG + Intergenic
1127055097 15:55123253-55123275 CGCCACACTGCTTTCCACAATGG - Intergenic
1127100472 15:55559401-55559423 CGCCGCACTGTCTTCCACAATGG - Intronic
1127182887 15:56442299-56442321 CGCCACAGTGCTTTTCACAGTGG - Intronic
1127538324 15:59912400-59912422 CGCCGCACTGTCTTCCACAATGG - Intergenic
1127760403 15:62133946-62133968 CGCCACACTGCCTTCCACAATGG + Intergenic
1127845949 15:62871124-62871146 CACCACACTGCTTTCCACAATGG + Intergenic
1127912576 15:63429984-63430006 CGCCACACTGCTTTCCACAATGG + Intergenic
1128063899 15:64752373-64752395 CCCTGCAGTGATTTCAACAGAGG + Intronic
1128435062 15:67638642-67638664 CACTGCACTGTCTTCCACAATGG + Intronic
1128850496 15:70950368-70950390 CTCCACACTGCTTTCCACAATGG + Intronic
1128851998 15:70968552-70968574 TGCTGCACTGTCTTCCACAATGG + Intronic
1129013170 15:72441262-72441284 CACCACACTGCTTTCCACAATGG + Intergenic
1129588470 15:76892742-76892764 CGCCACACTGTTTTCCACAATGG - Intronic
1130123498 15:81072547-81072569 TGCCACACTGCTTTCCACAATGG + Intronic
1130338837 15:82981431-82981453 CACTGTAGTGTTTTCCATAATGG - Intronic
1130366548 15:83245177-83245199 CGCTGCACTGCTTTCCACAATGG + Intergenic
1130619578 15:85447941-85447963 CGCTATACTGCTTTCCACAATGG + Intronic
1130750322 15:86704703-86704725 CGCCACACTGTTTTCCACAATGG - Intronic
1131297456 15:91163333-91163355 CGCCACACTGATTTCCACAATGG + Intronic
1131312527 15:91303965-91303987 CTCGCCAGTGCTTTCCACAGAGG + Intergenic
1131345376 15:91642781-91642803 CGCCACACTGCCTTCCACAATGG + Intergenic
1131505637 15:93015925-93015947 CTCTGCATTGTTTTCCATAATGG - Intronic
1131615816 15:94016410-94016432 CGCCATAGTGCTTCCCACAATGG - Intergenic
1131689183 15:94808043-94808065 CCCCACAGTGTTTTCCACAATGG + Intergenic
1131814243 15:96205993-96206015 CGCCACACTGTTTTCCACAATGG - Intergenic
1131848944 15:96517255-96517277 CACTACACTGCCTTCCACAATGG + Intergenic
1131887680 15:96935426-96935448 CGCCACACTGCCTTCCACAATGG + Intergenic
1132144687 15:99422190-99422212 CACCACACTGCTTTCCACAATGG + Intergenic
1132151136 15:99460297-99460319 CACCACACTGCTTTCCACAATGG + Intergenic
1132192844 15:99883660-99883682 CGCCGCACTGTCTTCCACAATGG - Intergenic
1132664848 16:1076676-1076698 CTCTTCAGTGCTGTCCACACTGG + Intergenic
1133883167 16:9802139-9802161 CGCCACACTGCTTTCCACAATGG - Intronic
1135346212 16:21690762-21690784 CGCTACACTGTCTTCCACAATGG + Intronic
1136311782 16:29417065-29417087 CGCCACACTGTTTTCCACAATGG - Intergenic
1136645872 16:31614474-31614496 CGCTGCACTGTCTTCCACAATGG - Intergenic
1137225017 16:46495412-46495434 CGCCACAGTGACTTCCACAATGG - Intergenic
1137544058 16:49387016-49387038 CACCACACTGCTTTCCACAATGG + Intronic
1137837186 16:51603879-51603901 CACCACACTGCTTTCCACAAAGG + Intergenic
1138082274 16:54101734-54101756 TGCTATACTGCTTTCCACAATGG + Intronic
1138234807 16:55373222-55373244 CACTCCAGTGCTTTCCAAAATGG + Intergenic
1138259448 16:55604220-55604242 CGCCACACTGATTTCCACAATGG - Intergenic
1138259762 16:55608340-55608362 TGCTACACCGCTTTCCACAATGG + Intergenic
1138745119 16:59354461-59354483 CTCCGTATTGCTTTCCACAATGG + Intergenic
1138752958 16:59446175-59446197 TGCCACACTGCTTTCCACAATGG + Intergenic
1138760641 16:59539721-59539743 CACCACAGTGCTTTCCACAATGG - Intergenic
1138826148 16:60322653-60322675 CGCCACACTGCTTTCCACAATGG + Intergenic
1139087468 16:63604854-63604876 TGCCGTACTGCTTTCCACAATGG - Intergenic
1139157999 16:64467583-64467605 CGCCACACTGTTTTCCACAATGG - Intergenic
1139238193 16:65362150-65362172 CGCCACACTGATTTCCACAATGG - Intergenic
1140636634 16:76922580-76922602 CACCACACTGCTTTCCACAATGG + Intergenic
1140648177 16:77057001-77057023 CACCACACTGCTTTCCACAATGG + Intergenic
1141536451 16:84684400-84684422 CCCTGCTATGCTTTCCACAAAGG + Intergenic
1141937340 16:87249684-87249706 TGCTGCACTTCTTTCCACAGTGG - Intronic
1143412167 17:6716002-6716024 CGCCACAGTGTCTTCCACAATGG + Intergenic
1143413229 17:6725277-6725299 CGCCACACTGCCTTCCACAATGG - Intergenic
1144117987 17:12119557-12119579 CACCACACTGCTTTCCACAATGG - Intronic
1144358918 17:14472289-14472311 CGCCGCACTGTCTTCCACAATGG + Intergenic
1144360892 17:14491040-14491062 CGCCGCACTGTCTTCCACAATGG + Intergenic
1144674397 17:17152689-17152711 CCCTTCAGTGCTCTCCACAAAGG - Intronic
1144890264 17:18490340-18490362 GGCTTCAGTGCTTTCCAAAGAGG - Intronic
1145111446 17:20165627-20165649 CGCTGCACTGTCTTCCACAATGG + Intronic
1145141952 17:20453978-20454000 GGCTTCAGTGCTTTCCAAAGAGG + Intronic
1145315758 17:21732173-21732195 TGCCACACTGCTTTCCACAATGG + Intergenic
1145714187 17:27004111-27004133 TGCCACACTGCTTTCCACAATGG + Intergenic
1145793949 17:27644921-27644943 GGCTTCAGTGCTTTCCAACAAGG - Intronic
1145878980 17:28340325-28340347 TGCCAAAGTGCTTTCCACAACGG - Exonic
1146089306 17:29860176-29860198 TGCCACACTGCTTTCCACAATGG + Intronic
1146751454 17:35385171-35385193 TGCCGCACTGCTTTCCACAATGG + Intergenic
1146930672 17:36775510-36775532 CGCTAAACTGCTTTCCACAATGG - Intergenic
1148360050 17:47004290-47004312 CGCCACAGTGTCTTCCACAATGG + Intronic
1149247946 17:54733558-54733580 TGCCACAATGCTTTCCACAATGG - Intergenic
1149972281 17:61230864-61230886 CTCCGAACTGCTTTCCACAACGG + Intronic
1151143970 17:72021719-72021741 CATTACACTGCTTTCCACAATGG - Intergenic
1151981882 17:77516777-77516799 CACCACACTGCTTTCCACAATGG + Intergenic
1203175803 17_KI270729v1_random:12091-12113 CACTGCATTGCATTCCACTAGGG + Intergenic
1153374809 18:4363827-4363849 CGCCACAGTGACTTCCACAATGG - Intronic
1153384086 18:4472714-4472736 CGCCACAGTGACTTCCACAATGG + Intergenic
1153526972 18:6005908-6005930 CGCCACACTGCTTTCCACAATGG + Intronic
1153548094 18:6230661-6230683 CACTACACTGCTTTCCACAATGG + Intronic
1153589323 18:6656767-6656789 CACCGTACTGCTTTCCACAATGG - Intergenic
1153697035 18:7653887-7653909 CATCACAGTGCTTTCCACAATGG + Intronic
1153876700 18:9379093-9379115 CGTTACACTGCTTTCCACAATGG - Intronic
1154374135 18:13794896-13794918 CGCTGCACTGTTTTCCACAATGG + Intergenic
1154374706 18:13799367-13799389 GGCTGCAGTGCCTTCCACATGGG - Intergenic
1154403942 18:14070515-14070537 CGCCACACTGTTTTCCACAATGG - Intronic
1154459055 18:14561133-14561155 CGCTACACTGTCTTCCACAATGG + Intergenic
1154532411 18:15361059-15361081 AGCTGCAGGGCTGTTCACAATGG - Intergenic
1155292186 18:24353489-24353511 CGCCACACTGATTTCCACAATGG - Intronic
1155335476 18:24760311-24760333 CGCCACACTGCTTTCCACAATGG - Intergenic
1155385420 18:25272333-25272355 CGCTACACTGTCTTCCACAATGG - Intronic
1155659003 18:28225663-28225685 CGCCACACTGATTTCCACAATGG + Intergenic
1155666099 18:28310422-28310444 CACCACACTGCTTTCCACAATGG - Intergenic
1155735787 18:29220791-29220813 CGCCGCATTGTCTTCCACAATGG - Intergenic
1156175139 18:34535062-34535084 CGCCACAGTGTGTTCCACAATGG + Intronic
1156532077 18:37827166-37827188 CGCCGCACTGACTTCCACAATGG + Intergenic
1156533598 18:37841524-37841546 CGCCACAGTGACTTCCACAATGG + Intergenic
1156797606 18:41066475-41066497 CCAGGCAGTGCTTTCAACAAAGG - Intergenic
1157024004 18:43821093-43821115 CTCCACAGTGTTTTCCACAATGG - Intergenic
1157029703 18:43890766-43890788 TGCTGCACTGTCTTCCACAATGG - Intergenic
1157064446 18:44331338-44331360 TGCTACATTGCTTTCCACAATGG + Intergenic
1158028091 18:52927836-52927858 CACCACACTGCTTTCCACAATGG - Intronic
1158281618 18:55834344-55834366 TGCCACACTGCTTTCCACAATGG - Intergenic
1158688725 18:59641047-59641069 CACTAAATTGCTTTCCACAATGG - Intronic
1158764335 18:60430998-60431020 CGCTACACTGACTTCCACAATGG + Intergenic
1159111314 18:64059481-64059503 CTCTAAACTGCTTTCCACAATGG + Intergenic
1159131996 18:64289821-64289843 CGCCACACTGATTTCCACAATGG + Intergenic
1159290539 18:66413154-66413176 TGCCACACTGCTTTCCACAATGG - Intergenic
1159972602 18:74672126-74672148 TGCCACACTGCTTTCCACAATGG + Intronic
1160048471 18:75409139-75409161 AGCTTGAGTGCTTCCCACAAAGG - Intronic
1160249994 18:77194368-77194390 CGCCTAACTGCTTTCCACAATGG + Intergenic
1160275176 18:77425655-77425677 TCCTACAGTGCTTTCCACAATGG + Intergenic
1160375922 18:78411611-78411633 TGCTGCACTGCTTTCTAAAATGG + Intergenic
1161585462 19:5103092-5103114 GGCAGCAGTGCCTTCCAAAAGGG - Intronic
1163379871 19:16958691-16958713 CACCACACTGCTTTCCACAATGG + Intronic
1164061842 19:21682358-21682380 TGCTGCACTGACTTCCACAAGGG - Intergenic
1164069854 19:21757531-21757553 CGCCACACTGCTTTTCACAATGG - Intronic
1164101690 19:22060224-22060246 CACTACATTGCTTTTCACAATGG + Intronic
1164110589 19:22153930-22153952 CGCTGCACTGTCTTCCACAATGG - Intergenic
1164114691 19:22208442-22208464 CACTACACTGCTTTTCACAATGG - Intergenic
1164176127 19:22776641-22776663 CGCCACACTGCTTTTCACAATGG - Intronic
1164819541 19:31236209-31236231 CTCTGCACTGTTTTCCACAATGG + Intergenic
1165609666 19:37140293-37140315 CATTGCAGTGCTATTCACAATGG + Intronic
1165968055 19:39601263-39601285 CACCACACTGCTTTCCACAATGG - Intergenic
1165978926 19:39703188-39703210 CACCACACTGCTTTCCACAATGG - Intergenic
1166021846 19:40038484-40038506 CGCCACACTGCCTTCCACAATGG + Intronic
1167857181 19:52251660-52251682 TGCCACACTGCTTTCCACAATGG + Intergenic
1167865652 19:52325344-52325366 CGCTGCAGTGCTTTCCACAATGG - Exonic
1168367779 19:55804184-55804206 CACTACACTGCTTTCCGCAATGG - Intronic
1168641909 19:58036317-58036339 GGCCACAGTGCTTTCCAGAAAGG + Intronic
925004235 2:428792-428814 CGCTGCTTTCCTTTCCACAATGG - Intergenic
925132979 2:1506453-1506475 CGCCACACTGCCTTCCACAATGG + Intronic
925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG + Intronic
925322273 2:2982361-2982383 CGCCACATTGTTTTCCACAATGG - Intergenic
925467097 2:4115874-4115896 AGCTGCACTGTCTTCCACAATGG + Intergenic
925528359 2:4830464-4830486 CACCACACTGCTTTCCACAATGG + Intergenic
925661386 2:6206825-6206847 CACCACACTGCTTTCCACAATGG + Intergenic
925963780 2:9043891-9043913 CGCCGCACTGACTTCCACAATGG - Intergenic
926319322 2:11737807-11737829 CGCTACACTGTCTTCCACAATGG - Intronic
926354795 2:12031812-12031834 CGCCATACTGCTTTCCACAATGG + Intergenic
926381270 2:12292498-12292520 CGCCGCACTGTCTTCCACAAAGG - Intergenic
926440055 2:12878954-12878976 CGCCACACTGTTTTCCACAATGG + Intergenic
926479341 2:13370525-13370547 CACTGCAGTGTTGTTCACAATGG - Intergenic
926514552 2:13825498-13825520 CGTCACACTGCTTTCCACAATGG - Intergenic
926595195 2:14782527-14782549 CACCACACTGCTTTCCACAATGG - Intergenic
927078301 2:19602448-19602470 CACCACACTGCTTTCCACAATGG - Intergenic
927266001 2:21151662-21151684 CGCTGCACTCTCTTCCACAATGG + Intergenic
927297777 2:21474944-21474966 CGCTGCACTGTCTTCCACAATGG + Intergenic
928159017 2:28904456-28904478 CGCTAAATTGCTTTCCAAAAGGG + Intronic
928457712 2:31438380-31438402 CGCCGCACTGACTTCCACAATGG - Intergenic
928461683 2:31479893-31479915 TGCTATACTGCTTTCCACAATGG + Intergenic
928463868 2:31501863-31501885 CGCCGCACTGACTTCCACAATGG - Intergenic
928665419 2:33546521-33546543 CGCCATACTGCTTTCCACAATGG - Intronic
928693592 2:33825627-33825649 TGCCACAGTGCTTTCCACAGTGG + Intergenic
928715969 2:34061127-34061149 GACTGCAGTGTTTTCCACATGGG - Intergenic
928755081 2:34514917-34514939 TGCTACACTGCTTTCCACAATGG - Intergenic
928810245 2:35215420-35215442 CGCTACACTGACTTCCACAATGG + Intergenic
929015691 2:37492237-37492259 CACTACACTGATTTCCACAATGG + Intergenic
929257231 2:39825558-39825580 CGCCGCACTGTCTTCCACAATGG + Intergenic
930149252 2:48041640-48041662 CGCCACAGTGTCTTCCACAATGG + Intergenic
930233597 2:48867632-48867654 CGCCCTACTGCTTTCCACAACGG - Intergenic
930282823 2:49391352-49391374 CACTACACTACTTTCCACAATGG - Intergenic
930528940 2:52567403-52567425 TGCTGCACTGCTTTCTACAATGG + Intergenic
930669930 2:54137852-54137874 TGCCACAGTGCTTTCCACAGTGG + Intronic
930700150 2:54451859-54451881 CGCCACACTACTTTCCACAATGG - Intergenic
930770565 2:55126597-55126619 TGCCCCACTGCTTTCCACAATGG - Intergenic
930900099 2:56495902-56495924 CGTCATAGTGCTTTCCACAAGGG - Intergenic
930967852 2:57353307-57353329 CGCCACACTGTTTTCCACAATGG + Intergenic
930983857 2:57560989-57561011 CGCCACAGTGACTTCCACAATGG - Intergenic
931107493 2:59072549-59072571 TGCCACACTGCTTTCCACAATGG - Intergenic
931454363 2:62396334-62396356 CACCACACTGCTTTCCACAATGG - Intergenic
931596055 2:63944958-63944980 CGCTACACTGTCTTCCACAATGG - Intronic
932033442 2:68214701-68214723 AGCTACACTGCTTCCCACAACGG - Intronic
932166290 2:69510619-69510641 CGCCACACTGCTTTCCACAATGG + Intronic
932310865 2:70739453-70739475 CACCACACTGCTTTCCACAACGG - Intronic
932371524 2:71193005-71193027 CGCCATACTGCTTTCCACAATGG + Intronic
932377679 2:71252137-71252159 CGCCAAACTGCTTTCCACAATGG + Intergenic
932415059 2:71568500-71568522 GGCAGCAGTCCTTTCCAGAAGGG + Intronic
932518709 2:72383569-72383591 CACCACACTGCTTTCCACAATGG - Intronic
932945510 2:76225023-76225045 CGCCACACTGATTTCCACAAAGG + Intergenic
933046593 2:77545761-77545783 CGCCACACTGCTTTCCACAATGG - Intronic
933047980 2:77563221-77563243 TGCCACACTGCTTTCCACAATGG - Intronic
933211478 2:79574787-79574809 TGCTACACTGCTTTCCAAAATGG + Intronic
933387708 2:81632581-81632603 AGTTGCAGTGCTATCCAGAAGGG + Intergenic
933438443 2:82278722-82278744 CACGACACTGCTTTCCACAATGG - Intergenic
933439361 2:82291869-82291891 TGCTACACTGCTTTCCACAATGG + Intergenic
933455310 2:82512185-82512207 TGCTAGACTGCTTTCCACAATGG - Intergenic
933603660 2:84359388-84359410 CGCCACACTGTTTTCCACAATGG - Intergenic
933680330 2:85094283-85094305 CGCCGCACTGACTTCCACAATGG + Intergenic
934041707 2:88132339-88132361 CACCACACTGCTTTCCACAATGG - Intergenic
935491158 2:103722148-103722170 CACCACACTGCTTTCCACAATGG - Intergenic
935884709 2:107604072-107604094 CGCCACAATGCCTTCCACAATGG - Intergenic
936621954 2:114109291-114109313 GGCTGCAGTGCATTCCACACTGG - Intergenic
936700187 2:115002932-115002954 CACCACACTGCTTTCCACAATGG - Intronic
937517177 2:122668632-122668654 CGCCGCACTGACTTCCACAATGG - Intergenic
937552913 2:123116682-123116704 TGCTGCACTGCTTTCCACGATGG + Intergenic
937902828 2:127035422-127035444 AGCGGCTGTGCCTTCCACAAGGG + Intergenic
938498187 2:131814811-131814833 CGCCACACTGATTTCCACAATGG + Intergenic
938531509 2:132192279-132192301 AGCTGCAGGGCTGTTCACAATGG - Intronic
938762871 2:134441510-134441532 AACAGCAGTGCCTTCCACAAAGG - Intronic
938952688 2:136269920-136269942 CTCCACACTGCTTTCCACAATGG - Intergenic
939008496 2:136817968-136817990 CGCCACACTGATTTCCACAATGG - Intronic
939038881 2:137164451-137164473 CGCCACAGTGTCTTCCACAATGG - Intronic
939150492 2:138466839-138466861 CGCCGCACTGACTTCCACAAGGG - Intergenic
939156452 2:138530401-138530423 CGCCACACTGTTTTCCACAATGG + Intronic
939363158 2:141199995-141200017 TGCCACATTGCTTTCCACAATGG - Intronic
939363356 2:141202486-141202508 TGCCACATTGCTTTCCACAATGG + Intronic
939923344 2:148144022-148144044 CGCTACACTGTCTTCCACAATGG + Intronic
940097856 2:149998656-149998678 CACCACACTGCTTTCCACAATGG - Intergenic
940309333 2:152260891-152260913 TGCCACACTGCTTTCCACAATGG - Intergenic
940447332 2:153791498-153791520 TGCCACATTGCTTTCCACAATGG - Intergenic
940576242 2:155507972-155507994 CTCTGGGGTGTTTTCCACAATGG - Intergenic
940674443 2:156711478-156711500 CCCTATACTGCTTTCCACAATGG + Intergenic
940702573 2:157063959-157063981 AGCTGCAGTCCTTTCCAGATGGG - Intergenic
940825001 2:158401122-158401144 CGCCACAGTGTCTTCCACAATGG - Intronic
941070642 2:160950863-160950885 CGCCACACTGATTTCCACAATGG - Intergenic
941075085 2:160998067-160998089 CGCCACACTGATTTCCACAATGG + Intergenic
941119890 2:161516046-161516068 CGCCACACTGCTTTCCACAATGG - Intronic
941124190 2:161566256-161566278 CGCCACACTGATTTCCACAATGG + Intronic
941136014 2:161719471-161719493 CGCCGCACTGACTTCCACAATGG + Intronic
941993679 2:171581111-171581133 TGCCACATTGCTTTCCACAATGG + Intergenic
942108146 2:172654190-172654212 CGCCACACTGTTTTCCACAATGG - Intergenic
942669900 2:178364029-178364051 GGCTGCTGTGGTTTCCAAAAGGG - Intronic
942868913 2:180711466-180711488 CACCACACTGCTTTCCACAATGG + Intergenic
942958938 2:181806595-181806617 CGTCACACTGCTTTCCACAATGG - Intergenic
943073254 2:183166637-183166659 TGCCACATTGCTTTCCACAATGG + Intergenic
943164755 2:184306775-184306797 CACTAAACTGCTTTCCACAATGG + Intergenic
943177204 2:184491954-184491976 CACCGAACTGCTTTCCACAATGG - Intergenic
943245004 2:185435534-185435556 CGCCACATTGCTTTCCACAATGG + Intergenic
943262403 2:185682943-185682965 CGCCACACTGCCTTCCACAATGG + Intergenic
943307332 2:186279744-186279766 CACCACACTGCTTTCCACAATGG + Intergenic
943316284 2:186392367-186392389 CTCTAAAGTGCTTTCCACAGTGG - Intergenic
943635148 2:190298325-190298347 CGCCACAGTGTCTTCCACAATGG + Intronic
943635284 2:190300234-190300256 CGCGACACCGCTTTCCACAATGG + Intronic
943777406 2:191781373-191781395 TGCCACACTGCTTTCCACAATGG + Intergenic
943884378 2:193196430-193196452 CGCCGCACTGTCTTCCACAATGG + Intergenic
943932920 2:193877883-193877905 CGCCACACTGATTTCCACAATGG + Intergenic
943945172 2:194051880-194051902 CGCCGCACTGCCTTACACAATGG - Intergenic
944142378 2:196471386-196471408 CACCACACTGCTTTCCACAAAGG - Intronic
944192788 2:197021370-197021392 TGCCACAGTGCCTTCCACAATGG + Intronic
944198167 2:197077076-197077098 TGCCACAGTGCCTTCCACAATGG + Intronic
944277910 2:197860447-197860469 CACTACACTGCTTTCCACAATGG + Intronic
944546180 2:200801270-200801292 CGCCACTCTGCTTTCCACAATGG - Intergenic
944569495 2:201029350-201029372 CGCTGCACTGTCTTCCACAATGG - Intronic
944604302 2:201336718-201336740 CTCTGTAGTGTTTTCCATAATGG + Intronic
945342758 2:208676825-208676847 CGCCACACTGCTTTCCACAGTGG + Intronic
945377487 2:209096555-209096577 CGCCACACTGTTTTCCACAATGG + Intergenic
945623605 2:212172335-212172357 CACCACAGTGTTTTCCACAATGG - Intronic
945909347 2:215630157-215630179 TGCTACACTGCTTTCTACAATGG + Intergenic
946103281 2:217346109-217346131 TGCCACACTGCTTTCCACAAGGG + Intronic
947245641 2:228045169-228045191 CGCCACACTGCCTTCCACAATGG - Intronic
947330198 2:229021100-229021122 CGCCACACTGCCTTCCACAATGG - Intronic
947424895 2:229974421-229974443 ATCTGCAGTGCTTGCCACAATGG - Intronic
948123627 2:235549019-235549041 CCCTGCAGTGCTTTCCACCCAGG - Intronic
948267294 2:236644328-236644350 CAGGGCAGTGCTCTCCACAAAGG - Intergenic
948343655 2:237277126-237277148 TGCCACATTGCTTTCCACAATGG - Intergenic
948618710 2:239219040-239219062 CGCCACACTGATTTCCACAATGG - Intronic
948810674 2:240474994-240475016 CACCACACTGCTTTCCACAATGG + Intergenic
1168921567 20:1541207-1541229 CACTGCACTGTCTTCCACAATGG + Intronic
1169294935 20:4387103-4387125 CGCCGCACTGACTTCCACAATGG + Intergenic
1169316650 20:4597201-4597223 CACCACACTGCTTTCCACAATGG - Intergenic
1169576612 20:6969340-6969362 CGCCACACTGATTTCCACAATGG + Intergenic
1170082067 20:12487552-12487574 CGCTACACTGACTTCCACAATGG + Intergenic
1170126792 20:12972462-12972484 TGCCACACTGCTTTCCACAATGG + Intergenic
1170391005 20:15874484-15874506 CGCCACACTGCCTTCCACAATGG + Intronic
1170827119 20:19806290-19806312 CGCCCCAGTGTTTTCCACAATGG + Intergenic
1171206378 20:23284434-23284456 CACTGCACTGTCTTCCACAATGG + Intergenic
1171337431 20:24397057-24397079 CGCCACACTGCCTTCCACAATGG + Intergenic
1171525845 20:25810218-25810240 GGCTACAGTGTCTTCCACAATGG - Intronic
1171550982 20:26045666-26045688 GGCTACAGTGTCTTCCACAATGG + Intergenic
1171748705 20:29026222-29026244 CGCCACAGTGACTTCCACAATGG - Intergenic
1171779005 20:29401210-29401232 CACTGTTGTGCTTTCCACAATGG - Intergenic
1172774388 20:37398589-37398611 CCCTGCAGTGCCTTCCACCCAGG - Intronic
1173091783 20:39978990-39979012 CGCCACACTGATTTCCACAATGG - Intergenic
1173146436 20:40528790-40528812 TGCCACACTGCTTTCCACAATGG + Intergenic
1173307813 20:41867087-41867109 CACTATACTGCTTTCCACAATGG + Intergenic
1173559916 20:43996084-43996106 TGCTATATTGCTTTCCACAATGG + Intronic
1173574384 20:44101834-44101856 CGCCAAACTGCTTTCCACAATGG - Intergenic
1175165016 20:57037355-57037377 CGCCGCACTGTCTTCCACAATGG + Intergenic
1175282402 20:57812871-57812893 CGTTACACTGCTTTCCACAAGGG + Intergenic
1175649644 20:60708354-60708376 CGCCACACTGATTTCCACAATGG - Intergenic
1176764949 21:13007151-13007173 AGCTGCAGGGCTGTTCACAATGG + Intergenic
1176815085 21:13592206-13592228 CGCTACACTGTCTTCCACAATGG - Intergenic
1176902947 21:14465525-14465547 CACTGCACTGTCTTCCACAATGG + Intergenic
1177009800 21:15718292-15718314 CCCCACACTGCTTTCCACAATGG - Intergenic
1177121064 21:17137692-17137714 CTCTGAATGGCTTTCCACAATGG - Intergenic
1177360518 21:20063329-20063351 TGCCACACTGCTTTCCACAATGG - Intergenic
1177545830 21:22558275-22558297 GGCCACACTGCTTTCCACAATGG + Intergenic
1177593151 21:23200316-23200338 CTCTGAACTGCTTTCCACAGTGG - Intergenic
1177764830 21:25445602-25445624 CACCGTATTGCTTTCCACAATGG - Intergenic
1177942864 21:27432520-27432542 CGCCACAGTGTCTTCCACAATGG + Intergenic
1178036717 21:28592120-28592142 CGCCACACTGTTTTCCACAAAGG + Intergenic
1178099273 21:29249731-29249753 CTCTGAACTGCTTTCCACAGTGG + Intronic
1178160202 21:29903703-29903725 CGCCACACTGTTTTCCACAATGG - Intronic
1178219457 21:30639645-30639667 CGCCACAGTGACTTCCACAATGG + Intergenic
1178232635 21:30804429-30804451 CGCCACACTGTTTTCCACAATGG - Intergenic
1178338894 21:31768597-31768619 CGCCACACTGTTTTCCACAATGG + Intergenic
1178511268 21:33207035-33207057 CGCTGCAGGGCTGTCCTCAGAGG - Intergenic
1178802442 21:35808675-35808697 CGCCATACTGCTTTCCACAATGG - Intronic
1178809142 21:35865335-35865357 CACTGCACTGTCTTCCACAATGG + Intronic
1179083339 21:38193733-38193755 CGCTACACTGCTTTCCACAGTGG + Intronic
1179253308 21:39692546-39692568 CACCACATTGCTTTCCACAATGG + Intergenic
1179431764 21:41326486-41326508 CGCAGGAGGGCTTTCCAGAAGGG - Intronic
1179979498 21:44888840-44888862 CGCTGCAGTTCTTCCCAAAGGGG + Exonic
1180020506 21:45122474-45122496 AGCTGAAGGGGTTTCCACAATGG - Intronic
1180023424 21:45143809-45143831 CGCTGCAGTCTTTTCCGCAATGG + Intronic
1180429526 22:15233610-15233632 AGCTGCAGGGCTGTTCACAATGG + Intergenic
1180927490 22:19566439-19566461 CGCTGCGCTGCTTTCCACATAGG + Intergenic
1181451109 22:23022085-23022107 TGCCACACTGCTTTCCACAATGG + Intergenic
1181972815 22:26705457-26705479 CGCCACACTGTTTTCCACAATGG + Intergenic
1182179714 22:28334421-28334443 CGCCACACTGATTTCCACAATGG + Intronic
1182952146 22:34386932-34386954 CGCCACACTGCCTTCCACAATGG + Intergenic
1182955911 22:34426173-34426195 CACCACACTGCTTTCCACAATGG - Intergenic
1184247847 22:43244743-43244765 CGCTGAGGTGCTTTTCACCAGGG + Intronic
1184307204 22:43612993-43613015 TGCCACACTGCTTTCCACAATGG - Intronic
1184716441 22:46285018-46285040 TGCTGCTGTGCTTTCTACACTGG + Intronic
1185236614 22:49717210-49717232 TGCTGCACTGTTTTCGACAAAGG - Intergenic
949223997 3:1671455-1671477 CGCTACACTGACTTCCACAAGGG + Intergenic
949664398 3:6320325-6320347 CGCCACACTGATTTCCACAATGG - Intergenic
949743168 3:7259861-7259883 CGCCACACTGCGTTCCACAATGG + Intronic
950947740 3:16967335-16967357 CGCCAAACTGCTTTCCACAATGG + Intronic
951005736 3:17613455-17613477 CGCCACACTGCCTTCCACAATGG + Intronic
951070364 3:18321062-18321084 TGCCACACTGCTTTCCACAATGG + Intronic
951271373 3:20628774-20628796 CACCACACTGCTTTCCACAATGG + Intergenic
951274161 3:20664615-20664637 TGCCACACTGCTTTCCACAATGG + Intergenic
951320914 3:21244168-21244190 CGCCACACTGTTTTCCACAATGG + Intergenic
951334757 3:21406791-21406813 CTCTACAGTATTTTCCACAATGG - Intergenic
951431331 3:22610874-22610896 CGCTACACTGTCTTCCACAATGG - Intergenic
951827716 3:26886922-26886944 CGCCACACTGCCTTCCACAATGG - Intergenic
951831764 3:26937458-26937480 CGCCACACTGCCTTCCACAATGG - Intergenic
951908551 3:27726559-27726581 CTCTGCTGTGCTTTCCAAAGAGG + Intergenic
951916632 3:27807612-27807634 CGCCGCACTGTCTTCCACAATGG + Intergenic
952113593 3:30153527-30153549 CACCGCACTGCCTTCCACAATGG + Intergenic
952437021 3:33281614-33281636 CGCCGCACTGTCTTCCACAATGG + Intronic
952546641 3:34427411-34427433 CACTACACTGCTTTCCATAATGG - Intergenic
952570277 3:34707621-34707643 CACCACAGTGCTTTCCACAATGG - Intergenic
952808819 3:37383293-37383315 CACCACACTGCTTTCCACAATGG - Intergenic
952809605 3:37389644-37389666 TGCCACACTGCTTTCCACAATGG + Intronic
952856544 3:37775749-37775771 AGCCACACTGCTTTCCACAATGG - Intronic
953079675 3:39604168-39604190 CACCACAGTGCTTTCCACAATGG + Intergenic
953541112 3:43819113-43819135 TGCCACACTGCTTTCCACAATGG + Intergenic
953667514 3:44936426-44936448 TGCCACACTGCTTTCCACAATGG - Intronic
954857244 3:53655387-53655409 TGATACACTGCTTTCCACAATGG + Intronic
954960493 3:54560155-54560177 CGCTACACTGTCTTCCACAATGG + Intronic
955357497 3:58243291-58243313 CACTGCACTGTCTTCCACAATGG + Intronic
955832323 3:63017110-63017132 CGCCACAGTGACTTCCACAATGG + Intergenic
955845941 3:63162738-63162760 CGCTACACTGTCTTCCACAATGG + Intergenic
955886281 3:63601902-63601924 CACCACACTGCTTTCCACAATGG + Intronic
955887922 3:63620196-63620218 CGCCACACTACTTTCCACAATGG + Intergenic
955921713 3:63963925-63963947 TGCTGGATTGCTTTCCAAAAAGG + Intronic
956076815 3:65514730-65514752 CGCCACACTGATTTCCACAATGG - Intronic
956220907 3:66902145-66902167 CACCACACTGCTTTCCACAATGG - Intergenic
956689915 3:71866673-71866695 TGCCACACTGCTTTCCACAATGG - Intergenic
957086139 3:75679396-75679418 CACTGTTGTGCTTTCCACAATGG + Intergenic
957433031 3:80138399-80138421 CACTATAGTGCTTTCCACAATGG - Intergenic
957486888 3:80872978-80873000 TGCCACACTGCTTTCCACAATGG - Intergenic
957679807 3:83419104-83419126 CGCTACACTGTCTTCCACAATGG - Intergenic
957736053 3:84204201-84204223 TGCCACACTGCTTTCCACAATGG - Intergenic
957803459 3:85116735-85116757 CTCTAAAGTCCTTTCCACAATGG - Intronic
957993833 3:87662528-87662550 TGCCACACTGCTTTCCACAATGG - Intergenic
958191287 3:90188220-90188242 CGCTACACTGTCTTCCACAATGG + Intergenic
958202639 3:90339511-90339533 CGCCACACTGATTTCCACAATGG - Intergenic
958465182 3:94448643-94448665 TGCTGCACTGTCTTCCACAATGG - Intergenic
958521945 3:95201864-95201886 CACCACACTGCTTTCCACAATGG + Intergenic
958527576 3:95283512-95283534 CGCCACACTGATTTCCACAATGG + Intergenic
958545400 3:95542019-95542041 TGCTGCACTGTCTTCCACAATGG + Intergenic
958742380 3:98090663-98090685 CGCCACACTGTTTTCCACAATGG + Intergenic
958834957 3:99134532-99134554 CGCTACACTGACTTCCACAATGG - Intergenic
958839411 3:99185979-99186001 CCCTGTATTGCTTTCCACTATGG - Intergenic
958848064 3:99289166-99289188 CGCTACACTGACTTCCACAATGG + Intergenic
959170202 3:102835251-102835273 CAACGCACTGCTTTCCACAATGG - Intergenic
959268787 3:104177740-104177762 TGCCACACTGCTTTCCACAATGG + Intergenic
959285375 3:104401790-104401812 TGCCACAGTGCTTTTCACAATGG - Intergenic
959788648 3:110331207-110331229 CACCACAATGCTTTCCACAATGG - Intergenic
959816283 3:110676938-110676960 CACCACACTGCTTTCCACAATGG - Intergenic
959874827 3:111370687-111370709 TGCAACACTGCTTTCCACAAAGG - Intronic
959976127 3:112462087-112462109 TGCCACACTGCTTTCCACAATGG - Intergenic
960257532 3:115526976-115526998 TGCCACACTGCTTTCCACAATGG + Intergenic
960382152 3:116976457-116976479 AGCTGCAGTATATTCCACAATGG - Intronic
960401917 3:117210515-117210537 CGCCACACTGATTTCCACAATGG - Intergenic
960470883 3:118063814-118063836 CGCCACAGTGACTTCCACAATGG - Intergenic
960591633 3:119372178-119372200 CACCACACTGCTTTCCACAACGG + Intronic
960688579 3:120319316-120319338 TGCCACACTGCTTTCCACAATGG - Intergenic
960766572 3:121136648-121136670 CTCTAGATTGCTTTCCACAATGG - Intronic
961320724 3:126072689-126072711 ACCTCCACTGCTTTCCACAATGG - Intronic
961926031 3:130481615-130481637 CGCCGCACTGTCTTCCACAATGG + Intronic
961938558 3:130612349-130612371 CACCACACTGCTTTCCACAATGG + Intronic
961956561 3:130810224-130810246 CGCCACACTGCCTTCCACAATGG - Intergenic
961988397 3:131161254-131161276 CGCCACACTGTTTTCCACAATGG - Intronic
961992092 3:131203000-131203022 CGCCACACTGCCTTCCACAATGG - Intronic
961998906 3:131274528-131274550 CGCTACACTGACTTCCACAATGG + Intronic
962002530 3:131313390-131313412 CTCCACACTGCTTTCCACAATGG + Intronic
962155685 3:132946575-132946597 CGCCACACTGATTTCCACAATGG + Intergenic
962850875 3:139307401-139307423 CTCTGCAGAGCCTTCCACACTGG + Intronic
962854933 3:139336188-139336210 CGCCACACTGATTTCCACAATGG - Intronic
962910157 3:139840864-139840886 CTCCACATTGCTTTCCACAATGG - Intergenic
962997049 3:140640308-140640330 CGCCATACTGCTTTCCACAATGG + Intergenic
963048066 3:141118073-141118095 CGCCACACTGCCTTCCACAATGG + Intronic
963050207 3:141135912-141135934 CGCCACACTGATTTCCACAATGG + Intronic
963307348 3:143667904-143667926 CGCTACATTGTCTTCCACAATGG - Intronic
963316222 3:143761762-143761784 CGCCACACTGTTTTCCACAATGG - Intronic
963337828 3:143997531-143997553 TGCCACACTGCTTTCCACAATGG + Intronic
963831172 3:150011200-150011222 TGTTACACTGCTTTCCACAATGG - Intronic
964134078 3:153324673-153324695 CACTACACTGTTTTCCACAAAGG + Intergenic
964136171 3:153347089-153347111 CGCCACAGTGTCTTCCACAATGG + Intergenic
964363965 3:155929106-155929128 CGCCACACTGATTTCCACAATGG + Intronic
964487018 3:157196522-157196544 CACCACACTGCTTTCCACAATGG - Intergenic
964529905 3:157656268-157656290 CACCACAGTGCTTTCCACAATGG + Intronic
964653121 3:159034057-159034079 CACCACACTGCTTTCCACAATGG + Intronic
964950322 3:162283757-162283779 CGCTACACTGTCTTCCACAATGG + Intergenic
965009447 3:163067118-163067140 CACCACACTGCTTTCCACAATGG - Intergenic
965248253 3:166305141-166305163 TGCAGCAATGCTTTCAACAAAGG - Intergenic
965303953 3:167040899-167040921 CGCTGCACTGTCTTCCACAATGG + Intergenic
965508686 3:169544433-169544455 CGCCACACTGCCTTCCACAATGG + Intronic
965587587 3:170332430-170332452 CGCCACACTGTTTTCCACAATGG + Intergenic
965650757 3:170930491-170930513 CACCACATTGCTTTCCACAAAGG - Intergenic
965686243 3:171305785-171305807 CTCCACATTGCTTTCCACAATGG - Intronic
965742275 3:171888087-171888109 CACCACACTGCTTTCCACAATGG + Intronic
966145740 3:176809710-176809732 TGCCACAATGCTTTCCACAATGG + Intergenic
966155098 3:176907569-176907591 CGCCAAACTGCTTTCCACAATGG + Intergenic
967254641 3:187577410-187577432 CATTGCAGTGCTATTCACAATGG + Intergenic
967255033 3:187582235-187582257 TGCCACACTGCTTTCCACAATGG + Intergenic
967637889 3:191825695-191825717 CCCTACACTGGTTTCCACAAAGG - Intergenic
967978605 3:195050199-195050221 CGTCACACTGCTTTCCACAATGG + Intergenic
968019278 3:195369828-195369850 CACCACACTGCTTTCCACAATGG + Intronic
968828500 4:2917104-2917126 CGCCACACTGCCTTCCACAATGG + Intronic
970048013 4:11877641-11877663 CATTGCAGTGCTGTTCACAATGG - Intergenic
970096309 4:12466862-12466884 CGCCACACTGATTTCCACAATGG - Intergenic
970209959 4:13698947-13698969 TGCCACACTGCTTTCCACAATGG + Intergenic
970555216 4:17225145-17225167 CGCCGCACTGCTTCCCACAATGG + Intergenic
970612052 4:17734752-17734774 CGCCGCACTGACTTCCACAATGG - Intronic
970729932 4:19090703-19090725 TGCCACACTGCTTTCCACAATGG - Intergenic
970749037 4:19335224-19335246 CGCCACACTGATTTCCACAATGG + Intergenic
970787799 4:19820934-19820956 CGCCGCACTGACTTCCACAATGG - Intergenic
970851873 4:20613074-20613096 CGCCACACTGTTTTCCACAATGG - Intronic
971340108 4:25760466-25760488 TGCTACACTGCTTTCCACAATGG + Intronic
971542731 4:27841282-27841304 CACCGTACTGCTTTCCACAATGG + Intergenic
971697492 4:29925297-29925319 CGCCACAGTGATTTCCACAATGG + Intergenic
972433037 4:39002455-39002477 CGCCGCACTGACTTCCACAATGG - Intronic
972684606 4:41339689-41339711 ATTTGCAGTGCTTTCCACTAAGG - Intergenic
972911124 4:43818226-43818248 CGCCACACTGATTTCCACAATGG + Intergenic
973086071 4:46062445-46062467 CGCCACACTGATTTCCACAATGG + Intronic
973132248 4:46662034-46662056 CGCCACAGTGACTTCCACAATGG + Intergenic
973147285 4:46842971-46842993 CGCCACACTGATTTCCACAATGG + Intronic
973151590 4:46895058-46895080 CGCAACGCTGCTTTCCACAATGG - Intronic
973719153 4:53705929-53705951 CTCTGCAGAGCTTAGCACAAGGG - Intronic
973873957 4:55195519-55195541 CACTGCACTGTCTTCCACAATGG + Intergenic
973927178 4:55750360-55750382 CACTACATTGCTTTCCATAATGG - Intergenic
974063835 4:57059166-57059188 CGCCATACTGCTTTCCACAATGG - Intronic
974182883 4:58405944-58405966 CGCCACACTGTTTTCCACAATGG - Intergenic
974247016 4:59333183-59333205 CGCTGCAATGACTTCCACAATGG - Intergenic
974256044 4:59456724-59456746 CGCCACAGTGACTTCCACAATGG + Intergenic
974261384 4:59529618-59529640 CGCTGCAATGACTTCCACAATGG + Intergenic
974309965 4:60192481-60192503 TGCTATACTGCTTTCCACAATGG - Intergenic
974442700 4:61940500-61940522 CGCCACAGTGACTTCCACAATGG + Intronic
974535125 4:63164617-63164639 TGCCACACTGCTTTCCACAATGG + Intergenic
974577386 4:63744563-63744585 GGCTGCACTGTCTTCCACAATGG - Intergenic
974711845 4:65607753-65607775 TGCCACAGTGTTTTCCACAATGG - Intronic
975031336 4:69621572-69621594 CACCACACTGCTTTCCACAATGG - Intronic
975158430 4:71097594-71097616 CACCACACTGCTTTCCACAATGG + Intergenic
975396411 4:73879091-73879113 TGCTGCACTGTCTTCCACAATGG + Intergenic
975746264 4:77478343-77478365 CACCACACTGCTTTCCACAATGG - Intergenic
975891952 4:79040266-79040288 CACTAAACTGCTTTCCACAATGG - Intergenic
975904310 4:79191242-79191264 TGCCACAGTGTTTTCCACAATGG + Intergenic
976697255 4:87930274-87930296 CGCTACACTGTCTTCCACAATGG + Intergenic
976976787 4:91175392-91175414 CGCCACACTGCCTTCCACAATGG + Intronic
977144075 4:93413166-93413188 CGCCACACTGCCTTCCACAATGG + Intronic
977538126 4:98280178-98280200 CGCCACACTGTTTTCCACAATGG + Intronic
977629271 4:99223647-99223669 CGCCACACTGCCTTCCACAATGG + Intergenic
977638971 4:99333501-99333523 TGCCACATTGCTTTCCACAATGG + Intergenic
977697056 4:99977411-99977433 TGCCACACTGCTTTCCACAATGG - Intergenic
977752603 4:100627338-100627360 CGCCACACTGTTTTCCACAATGG - Intronic
977896150 4:102367768-102367790 CACTACACTGCTTTCTACAATGG - Intronic
978049126 4:104173460-104173482 TGCTACACTGCTTTCCACAATGG - Intergenic
978131220 4:105200113-105200135 CGCTACACTGTCTTCCACAATGG + Intronic
978237994 4:106483262-106483284 TGCCACACTGCTTTCCACAATGG + Intergenic
978238698 4:106490858-106490880 CGCTACACTGACTTCCACAATGG - Intergenic
978240963 4:106515716-106515738 TGCTACACTGCTTTCCACGATGG + Intergenic
978338198 4:107692556-107692578 CACTGCACTGTCTTCCACAATGG - Intronic
978662682 4:111147614-111147636 CGCCACACTGATTTCCACAATGG + Intergenic
978667012 4:111195850-111195872 CGCCACACTGATTTCCACAATGG + Intergenic
978683280 4:111409376-111409398 TGCCGTACTGCTTTCCACAATGG + Intergenic
978952450 4:114577160-114577182 CACTATACTGCTTTCCACAATGG + Intergenic
978982784 4:114969883-114969905 TGCCACACTGCTTTCCACAATGG + Intronic
979188197 4:117824779-117824801 CACTGCTGTGAGTTCCACAAAGG + Intergenic
979706569 4:123726951-123726973 CGCCACAGTGACTTCCACAATGG - Intergenic
979729652 4:124008955-124008977 CGCCGCACCGCATTCCACAATGG + Intergenic
980024253 4:127746359-127746381 CACTATACTGCTTTCCACAATGG + Intronic
980118439 4:128703923-128703945 CTCCACACTGCTTTCCACAATGG + Intergenic
980399339 4:132259562-132259584 CGCCACAGTGTCTTCCACAATGG - Intergenic
980430475 4:132687168-132687190 AGCTGCACTGACTTCCACAATGG + Intergenic
980460166 4:133099759-133099781 CACTGCACTGTCTTCCACAATGG + Intergenic
980548662 4:134303936-134303958 CACCATAGTGCTTTCCACAATGG + Intergenic
980635667 4:135498650-135498672 CGCCACACTGCTTTCCACAATGG + Intergenic
980746844 4:137029171-137029193 TGCCCCACTGCTTTCCACAAAGG + Intergenic
980830179 4:138121588-138121610 GGCCACACTGCTTTCCACAATGG - Intergenic
980848454 4:138352785-138352807 CGCTACACTGTCTTCCACAATGG - Intergenic
981325818 4:143446363-143446385 CGCCACACTGATTTCCACAATGG + Intronic
981347480 4:143693519-143693541 CTCCACATTGCTTTCCACAATGG - Intronic
981450939 4:144896933-144896955 CGCCACACTGATTTCCACAATGG - Intergenic
981605932 4:146540312-146540334 TGCCACACTGCTTTCCACAATGG + Intergenic
981648056 4:147022178-147022200 CACCACACTGCTTTCCACAATGG + Intergenic
981655432 4:147107449-147107471 CGCCACACTGCTTTCCACAGTGG - Intergenic
982735453 4:159001916-159001938 CGCCACCCTGCTTTCCACAATGG + Intronic
982817805 4:159908107-159908129 CACTACAGTGCTTACCCCAAAGG + Intergenic
982886759 4:160791159-160791181 CGCCACACTGATTTCCACAATGG - Intergenic
982916201 4:161212622-161212644 CGCCCCACTGCTTTGCACAAAGG + Intergenic
983116624 4:163825513-163825535 CGCCAAACTGCTTTCCACAATGG + Intronic
983126588 4:163960226-163960248 CTCTATACTGCTTTCCACAACGG - Intronic
983172194 4:164548788-164548810 CGCTACACTGACTTCCACAATGG - Intergenic
983441507 4:167792362-167792384 CGCCACACTGTTTTCCACAATGG + Intergenic
983663497 4:170156127-170156149 CGCTGCACCGACTTCCACAAGGG + Intergenic
983755855 4:171334746-171334768 CGCCATGGTGCTTTCCACAATGG - Intergenic
983950853 4:173639475-173639497 CGCCGCACTGACTTCCACAATGG + Intergenic
984592066 4:181627906-181627928 CCCTGCACTGTCTTCCACAATGG + Intergenic
985324182 4:188749128-188749150 CGCCATACTGCTTTCCACAATGG + Intergenic
985345161 4:188996934-188996956 CGCTACACTGTCTTCCACAATGG + Intergenic
985367912 4:189252969-189252991 TGCCATAGTGCTTTCCACAATGG - Intergenic
985443880 4:190008474-190008496 CACTGTTGTGCTTTCCACAATGG - Intergenic
985921681 5:2982253-2982275 CTTTGAACTGCTTTCCACAACGG - Intergenic
986035603 5:3934022-3934044 CGCTGCAATGCTTTGCACAGGGG + Intergenic
986100794 5:4609189-4609211 CACCGTACTGCTTTCCACAATGG - Intergenic
986118922 5:4811950-4811972 CACTGCACTGTATTCCACAATGG + Intergenic
986347452 5:6847995-6848017 CTCCACACTGCTTTCCACAATGG + Intergenic
986353057 5:6898205-6898227 CGCCACACTGCGTTCCACAATGG - Intergenic
986562771 5:9079968-9079990 CGCTACACTGTCTTCCACAATGG - Intronic
986599887 5:9462394-9462416 CACCACACTGCTTTCCACAATGG - Intronic
986822160 5:11479569-11479591 TGCCACACTGCTTTCCACAATGG + Intronic
986880829 5:12168947-12168969 CACTGCACTGTCTTCCACAATGG - Intergenic
986904177 5:12473401-12473423 CACCACACTGCTTTCCACAATGG - Intergenic
986912747 5:12576877-12576899 CGCCACACTGCCTTCCACAAGGG - Intergenic
987270131 5:16299237-16299259 CACCACACTGCTTTCCACAATGG - Intergenic
987275641 5:16359574-16359596 CGCCACACTGTTTTCCACAATGG - Intergenic
987352029 5:17030742-17030764 CACTGCAGCACTGTCCACAATGG + Intergenic
987389007 5:17357920-17357942 CGCCAGAGTGCTTTCCACAATGG + Intergenic
987419481 5:17701941-17701963 CTCTAAACTGCTTTCCACAATGG - Intergenic
987419916 5:17707577-17707599 CGCCACACTGATTTCCACAATGG - Intergenic
987430454 5:17826321-17826343 TGTCACAGTGCTTTCCACAATGG - Intergenic
987694322 5:21308416-21308438 TGCCACACTGCTTTCCACAATGG - Intergenic
987784172 5:22477655-22477677 CACTACAGTGTCTTCCACAATGG + Intronic
987819429 5:22943100-22943122 CGCTACACTGACTTCCACAATGG + Intergenic
987908877 5:24115478-24115500 CACTAAACTGCTTTCCACAATGG + Intronic
988084465 5:26457522-26457544 CCCTGCACTGTCTTCCACAATGG + Intergenic
988370278 5:30359809-30359831 CGCCGCACTGTCTTCCACAATGG + Intergenic
988675146 5:33425474-33425496 CACCACACTGCTTTCCACAATGG + Intergenic
989413348 5:41145178-41145200 CGCCACACTGCTTTCCACAATGG + Intronic
989681744 5:44037626-44037648 TGCTACAGTGTCTTCCACAATGG + Intergenic
989782368 5:45283712-45283734 CACTGTACTGCTTTCCACAATGG - Intronic
989793089 5:45431016-45431038 TGCTACACTGCTTTCCACAATGG + Intronic
989863764 5:46420465-46420487 CGCCACACTGATTTCCACAATGG + Intergenic
989942395 5:50169363-50169385 CGCCACACTGATTTCCACAATGG + Intergenic
990292368 5:54365708-54365730 CACTGCACTGTCTTCCACAATGG - Intergenic
990295090 5:54393409-54393431 CGCCACACTGCTTTCTACAATGG + Intergenic
990348672 5:54894002-54894024 CACCACACTGCTTTCCACAATGG - Intergenic
990433961 5:55768698-55768720 CGCCACACTGTTTTCCACAATGG + Intronic
990769563 5:59227822-59227844 CACCACACTGCTTTCCACAATGG - Intronic
990771500 5:59251597-59251619 TGCCACACTGCTTTCCACAATGG - Intronic
990883019 5:60561037-60561059 CGCCACACTGATTTCCACAATGG - Intergenic
991265170 5:64709607-64709629 CGCCACAGTGACTTCCACAATGG + Intronic
991637320 5:68719285-68719307 CGCCACAGTGTCTTCCACAATGG - Intergenic
991745922 5:69741053-69741075 GGCCACACTGCTTTCCACAATGG + Intergenic
991751782 5:69814188-69814210 GGCCACACTGCTTTCCACAATGG - Intergenic
991797523 5:70321011-70321033 GGCCACACTGCTTTCCACAATGG + Intergenic
991825300 5:70616367-70616389 GGCCACACTGCTTTCCACAATGG + Intergenic
991831071 5:70689081-70689103 GGCCACACTGCTTTCCACAATGG - Intergenic
991889865 5:71320332-71320354 GGCCACACTGCTTTCCACAATGG + Intergenic
991937751 5:71818570-71818592 CACTGCAGAGTTCTCCACAAGGG + Intergenic
992309385 5:75479861-75479883 CGCCATACTGCTTTCCACAATGG + Intronic
992434392 5:76741287-76741309 CACCACACTGCTTTCCACAATGG - Intergenic
992803414 5:80313770-80313792 CGCCACACTGTTTTCCACAATGG + Intergenic
993161454 5:84297446-84297468 TGCTGCACTGTTTTCCACAATGG - Intronic
993177997 5:84513301-84513323 AGCTACATTGCTTTCCACAATGG + Intergenic
993230371 5:85227463-85227485 CGCTACACTGTTTTCCACAATGG + Intergenic
993247866 5:85475085-85475107 CGCCACAGTGTCTTCCACAATGG - Intergenic
993556677 5:89348182-89348204 TGCTGCACTGTCTTCCACAATGG - Intergenic
993633901 5:90320772-90320794 CACAACACTGCTTTCCACAATGG + Intergenic
993793105 5:92232129-92232151 TGCCCCACTGCTTTCCACAATGG + Intergenic
993801457 5:92348043-92348065 CACTATACTGCTTTCCACAATGG + Intergenic
993881155 5:93363004-93363026 CACCACACTGCTTTCCACAATGG - Intergenic
993944512 5:94101365-94101387 CGCTATACTGCTTTCCACAATGG - Intronic
993967757 5:94378676-94378698 TGCTACACTGCTTTCCACAAGGG + Intronic
993972415 5:94435692-94435714 CTCTGCACTGTCTTCCACAATGG + Intronic
994027310 5:95099694-95099716 CGCCGCACTGACTTCCACAATGG - Intronic
994093683 5:95829817-95829839 CGCCACACTGATTTCCACAAGGG + Intergenic
994346292 5:98691053-98691075 CATTGCAGTGCTATCCACAATGG - Intergenic
994423114 5:99547377-99547399 CACCACACTGCTTTCCACAATGG - Intergenic
994469082 5:100179384-100179406 CGCCACACTGCTTTCCACAAGGG - Intergenic
994598159 5:101865829-101865851 TGCTACACTGTTTTCCACAATGG - Intergenic
994601699 5:101913416-101913438 CGCTACACTGACTTCCACAATGG + Intergenic
994619772 5:102149360-102149382 CACCGCACTGCTTTCCACAATGG - Intergenic
994638201 5:102369630-102369652 TGCCACATTGCTTTCCACAATGG - Intergenic
994642612 5:102428868-102428890 CACCACACTGCTTTCCACAATGG + Intronic
994643851 5:102445141-102445163 TGCCACACTGCTTTCCACAATGG + Intronic
994795292 5:104291394-104291416 CGCCACACTGTTTTCCACAATGG + Intergenic
994868686 5:105315696-105315718 CGCCACAGTGACTTCCACAATGG + Intergenic
994944077 5:106362347-106362369 CTCTGGACTGCTTTCCACAGTGG + Intergenic
994962495 5:106623371-106623393 CGCCACAGTGACTTCCACAATGG + Intergenic
995210479 5:109531956-109531978 CGCTACACTGACTTCCACAATGG - Intergenic
995220116 5:109639149-109639171 CACCACAGTGCTTTCCACAATGG - Intergenic
995270031 5:110209382-110209404 CACCACACTGCTTTCCACAATGG + Intergenic
995381553 5:111540491-111540513 CACCACACTGCTTTCCACAATGG - Intergenic
995637520 5:114211131-114211153 CGCCACACTACTTTCCACAATGG - Intergenic
995855682 5:116589784-116589806 CGCCGCACTGTCTTCCACAATGG - Intergenic
996072067 5:119142607-119142629 CACAGTACTGCTTTCCACAACGG - Intronic
996081077 5:119258846-119258868 CGCCACACTGCTTTCCACAATGG - Intergenic
996318288 5:122185987-122186009 CACCACACTGCTTTCCACAATGG + Intergenic
996385979 5:122911038-122911060 CGCCACAGTGACTTCCACAATGG + Intronic
996530923 5:124526038-124526060 CGCCACAGTGACTTCCACAAGGG - Intergenic
996654333 5:125918982-125919004 CGCCGCACTGACTTCCACAATGG + Intergenic
996767978 5:127054305-127054327 CGCCACACTGTTTTCCACAATGG + Intronic
996850488 5:127946214-127946236 CGCCACACTGCTTTCCACAATGG + Intergenic
996896458 5:128489070-128489092 CGCCGCACTGACTTCCACAATGG + Intronic
996920247 5:128760016-128760038 TGCTGTACTGCTTTCCGCAATGG - Intronic
996990758 5:129627862-129627884 TGCCACACTGCTTTCCACAATGG - Intronic
997116750 5:131133497-131133519 CGCCGCACTGACTTCCACAATGG + Intergenic
997875463 5:137542836-137542858 CGCTACACTGTCTTCCACAATGG - Intronic
998303012 5:141044223-141044245 CACCACATTGCTTTCCACAATGG - Intergenic
998536896 5:142941180-142941202 CGCATTACTGCTTTCCACAATGG + Intronic
998592684 5:143494642-143494664 CTCTGCAGTGCTTTCAAGATTGG + Intergenic
998594883 5:143518257-143518279 TGCCACACTGCTTTCCACAATGG + Intergenic
998719166 5:144923915-144923937 TGCCACACTGCTTTCCACAACGG - Intergenic
998764344 5:145468486-145468508 CGCCACACTGTTTTCCACAATGG + Intergenic
998910247 5:146951930-146951952 CGCCACAGTGTCTTCCACAATGG + Intronic
998926803 5:147135601-147135623 CTCCACACTGCTTTCCACAATGG + Intergenic
999056003 5:148577388-148577410 CACTATACTGCTTTCCACAATGG - Intronic
999071020 5:148744163-148744185 GGCCACACTGCTTTCCACAATGG - Intergenic
999095431 5:148973844-148973866 CGTTGCAGTCTTTTCCACATTGG - Intronic
999533053 5:152483810-152483832 CGCCACAGTGTCTTCCACAATGG - Intergenic
999556313 5:152746381-152746403 CGCCACACTGATTTCCACAATGG - Intergenic
999579994 5:153027537-153027559 CGCCACACTGCCTTCCACAATGG + Intergenic
999803648 5:155061490-155061512 TGCCACACTGCTTTCCACAATGG + Intergenic
999853445 5:155567642-155567664 TGCCACATTGCTTTCCACAATGG - Intergenic
1000378642 5:160608499-160608521 CGCCGCACTGTCTTCCACAATGG + Intronic
1000537761 5:162500413-162500435 CGCCACACTGATTTCCACAATGG + Intergenic
1000658233 5:163907835-163907857 CACCACATTGCTTTCCACAATGG + Intergenic
1000678409 5:164152501-164152523 CACCACACTGCTTTCCACAATGG - Intergenic
1000737539 5:164923921-164923943 CGCCACACTGATTTCCACAATGG + Intergenic
1000843823 5:166254554-166254576 CGCTACACTGTCTTCCACAATGG - Intergenic
1001161957 5:169327165-169327187 CACCACACTGCTTTCCACAATGG - Intergenic
1001200059 5:169707919-169707941 CACTCCAGTGGTTTCCAGAATGG + Intronic
1001357911 5:171049050-171049072 CGCCACACTGCTTTCCACAATGG + Intronic
1001393767 5:171402425-171402447 CGCCACTCTGCTTTCCACAATGG - Intronic
1001429366 5:171647281-171647303 CACTGGAGGGCTTTCGACAAGGG + Intergenic
1001533675 5:172482927-172482949 GTCTGCAGTGCTTTCCACCCTGG + Intergenic
1001715644 5:173813500-173813522 CTCTAAATTGCTTTCCACAATGG - Intergenic
1001760142 5:174200838-174200860 CACCATAGTGCTTTCCACAACGG + Intronic
1002369016 5:178735130-178735152 CGCCATACTGCTTTCCACAATGG + Intergenic
1002525025 5:179810685-179810707 CGCTACACTGACTTCCACAATGG + Intronic
1002633921 5:180597902-180597924 GACTGAAGTGCTTTCCTCAATGG - Intergenic
1002821168 6:726245-726267 CCCCACACTGCTTTCCACAATGG - Intergenic
1003074017 6:2967865-2967887 CGCCACACTGCTTTCCCCAATGG - Intronic
1003200185 6:3952330-3952352 TGCTACACTGTTTTCCACAATGG + Intergenic
1003242436 6:4356499-4356521 CGCCACACTGCTTTTCACAATGG + Intergenic
1003436850 6:6098253-6098275 TGCCACACTGCTTTCCACAATGG + Intergenic
1003647987 6:7931239-7931261 CGCCACACTGCCTTCCACAATGG - Intronic
1003705408 6:8522819-8522841 CGCCACACTGCCTTCCACAATGG - Intergenic
1003750885 6:9054482-9054504 CACTGCACTGTCTTCCACAATGG + Intergenic
1003842313 6:10134670-10134692 CGTTGCATTGTCTTCCACAATGG - Intronic
1004465478 6:15881242-15881264 CACCACACTGCTTTCCACAATGG + Intergenic
1004929672 6:20450196-20450218 CGCCACACTGCTTTCCATAATGG + Intronic
1005439223 6:25847482-25847504 CACCACACTGCTTTCCACAACGG + Intronic
1005556583 6:26991518-26991540 TGCCACACTGCTTTCCACAATGG + Intergenic
1005558649 6:27013983-27014005 CGCCACACTGCCTTCCACAATGG - Intergenic
1005799616 6:29407974-29407996 CGCCACACTGTTTTCCACAATGG - Intronic
1005936480 6:30526390-30526412 CGCTGCATTGTCTTCCACAATGG - Intergenic
1006217522 6:32457877-32457899 CACCCCACTGCTTTCCACAATGG - Intergenic
1006218625 6:32468167-32468189 CGCCACACTGATTTCCACAATGG + Intergenic
1006222919 6:32509694-32509716 CGCCACACTGCCTTCCACAATGG - Intergenic
1006237723 6:32650268-32650290 CGCCACATTGTTTTCCACAATGG - Intergenic
1006497302 6:34433034-34433056 GGCTGCAGTGCTGGCCACAGAGG - Intergenic
1007205634 6:40148283-40148305 CACTATACTGCTTTCCACAATGG - Intergenic
1007314382 6:40973840-40973862 TGCCACACTGCTTTCCACAATGG + Intergenic
1007809764 6:44477448-44477470 CGCTGCAGTGACTTGCAGAAAGG - Intergenic
1007972968 6:46071654-46071676 CACCACACTGCTTTCCACAAAGG - Intronic
1008203114 6:48617117-48617139 CACTGTAATGCTTTCCACAATGG + Intergenic
1008239509 6:49091952-49091974 CTCTGCATTGTTTTCCATAAAGG + Intergenic
1008529298 6:52440705-52440727 CACTACACTGCTTTCTACAATGG + Intronic
1008550529 6:52625365-52625387 TGCCACACTGCTTTCCACAATGG - Intergenic
1008775876 6:55036958-55036980 CGCTACACTGTCTTCCACAATGG + Intergenic
1008778920 6:55077655-55077677 CACCACACTGCTTTCCACAATGG - Intergenic
1008795246 6:55294890-55294912 CGCCACACTGCTTTCCACAATGG - Intergenic
1008849498 6:56007610-56007632 TGCCTCACTGCTTTCCACAATGG - Intergenic
1009233736 6:61097244-61097266 CGCCACACTGCCTTCCACAATGG - Intergenic
1009273442 6:61644878-61644900 TGCTTCACTGCTTTCCACAGTGG - Intergenic
1009448198 6:63768647-63768669 CTCCACACTGCTTTCCACAATGG - Intronic
1009556864 6:65181629-65181651 CGCCACACTGATTTCCACAACGG - Intronic
1009679208 6:66870332-66870354 CGCTACAGTGTCTTCCACAATGG + Intergenic
1009701773 6:67193564-67193586 CGCCACACTGCCTTCCACAATGG + Intergenic
1009921390 6:70066020-70066042 CGCTGCATTGTCTTCCACAATGG - Intronic
1009999969 6:70939318-70939340 CGCCGCACTGACTTCCACAATGG - Intronic
1010195161 6:73232220-73232242 CACTATACTGCTTTCCACAATGG - Intronic
1010335814 6:74682405-74682427 CGCCACACTGATTTCCACAATGG - Intergenic
1010652610 6:78472752-78472774 CGCCACACTGATTTCCACAATGG - Intergenic
1010665747 6:78628291-78628313 CACCACACTGCTTTCCACAATGG + Intergenic
1010775756 6:79883403-79883425 CACCACACTGCTTTCCACAATGG - Intergenic
1010783211 6:79969742-79969764 TGCCACACTGCTTTCCACAATGG - Intergenic
1010856032 6:80841198-80841220 CGCCACACTGTTTTCCACAATGG + Intergenic
1010892858 6:81335760-81335782 CGCTACACTGTCTTCCACAATGG + Intergenic
1010957513 6:82106723-82106745 CGCCACAGTGACTTCCACAATGG - Intergenic
1011143572 6:84188803-84188825 CGCCAAATTGCTTTCCACAATGG + Intronic
1011153933 6:84307675-84307697 TGCCACACTGCTTTCCACAATGG + Intergenic
1011247791 6:85338196-85338218 CGCCACACTGATTTCCACAATGG - Intergenic
1011253535 6:85398341-85398363 TGCCACACTGCTTTCCACAATGG - Intergenic
1011308092 6:85951603-85951625 CGCCACAGTGTCTTCCACAATGG - Intergenic
1011362506 6:86542950-86542972 TGCTGAACTGCTTTCCACAGTGG - Intergenic
1011595918 6:89015934-89015956 CACCGAACTGCTTTCCACAATGG - Intergenic
1011900413 6:92287739-92287761 CACCACACTGCTTTCCACAATGG + Intergenic
1011976004 6:93299554-93299576 CACCACACTGCTTTCCACAATGG - Intronic
1011978110 6:93333457-93333479 CACCACACTGCTTTCCACAATGG + Intronic
1011985323 6:93436476-93436498 CGCCACACTGTTTTCCACAATGG - Intergenic
1012048487 6:94308894-94308916 CACCACAGTGTTTTCCACAATGG + Intergenic
1012284607 6:97373861-97373883 CGCCACACTGTTTTCCACAAAGG + Intergenic
1012294574 6:97505087-97505109 TGCCACACTGCTTTCCACAATGG + Intergenic
1012337560 6:98079711-98079733 CACCACACTGCTTTCCACAATGG + Intergenic
1012343011 6:98152023-98152045 CGCCACAGTGTCTTCCACAATGG + Intergenic
1012425272 6:99107307-99107329 TGCCACACTGCTTTCCACAATGG + Intergenic
1012560798 6:100578836-100578858 CGACACACTGCTTTCCACAATGG + Intronic
1012586335 6:100927280-100927302 CGCCATACTGCTTTCCACAATGG + Intergenic
1012693411 6:102347330-102347352 TGCTGTACTGCTTCCCACAATGG - Intergenic
1012728093 6:102842426-102842448 CGCCACACTGATTTCCACAATGG - Intergenic
1012810078 6:103945782-103945804 CACCACACTGCTTTCCACAATGG + Intergenic
1012991849 6:105934280-105934302 CGCCAAACTGCTTTCCACAATGG + Intergenic
1013397092 6:109752408-109752430 CGCCACAGTGACTTCCACAATGG + Intronic
1013457627 6:110345347-110345369 CGCCACACTGCTTTTCACAATGG - Intronic
1013750546 6:113400682-113400704 CGCCACACTGCCTTCCACAATGG - Intergenic
1013848483 6:114484347-114484369 TGCCACACTGCTTTCCACAATGG - Intergenic
1013933699 6:115568112-115568134 CACTACACTGCTTTCCACAGAGG - Intergenic
1013965037 6:115945282-115945304 GGCTGCACTGTCTTCCACAATGG + Intronic
1014124857 6:117765115-117765137 CACTGTACTGCTTTCCACAATGG - Intergenic
1014133492 6:117862186-117862208 TGCCACACTGCTTTCCACAATGG - Intergenic
1014157500 6:118128232-118128254 CGCCACACTGATTTCCACAATGG - Intronic
1014244207 6:119050248-119050270 TGCCACACTGCTTTCCACAATGG - Intronic
1014352914 6:120366298-120366320 CGCTGCACTGTCTTCCACAATGG - Intergenic
1014356136 6:120412421-120412443 CACCACACTGCTTTCCACAATGG - Intergenic
1014375322 6:120665042-120665064 CGCCACAGTGTCTTCCACAATGG + Intergenic
1014418814 6:121215922-121215944 TGCTACAATGCTTTCCACAATGG - Intronic
1014425561 6:121301111-121301133 CGCCACACTGCCTTCCACAATGG - Intronic
1014567180 6:122963923-122963945 CGCCAAACTGCTTTCCACAATGG - Intergenic
1014594341 6:123314417-123314439 CGCCACACTGTTTTCCACAATGG - Intronic
1014777056 6:125523217-125523239 CGCTACACTGTCTTCCACAATGG + Intergenic
1014854690 6:126385177-126385199 TGCCACACTGCTTTCCACAATGG - Intergenic
1014860206 6:126457114-126457136 CGCTACATTACTTTCCACAATGG - Intergenic
1014868724 6:126563999-126564021 CGCTGCACTGTCTTCCAGAATGG - Intergenic
1014898667 6:126935399-126935421 CGCTGTACTATTTTCCACAATGG + Intergenic
1015247569 6:131091889-131091911 CACTGCACTGTCTTCCACAATGG - Intergenic
1015291644 6:131544457-131544479 CGCCACAGTGTCTTCCACAATGG - Intergenic
1015292526 6:131553663-131553685 CGCCGCATTGTCTTCCACAATGG + Intergenic
1015386223 6:132627018-132627040 CGCCACAGTGTCTTCCACAATGG + Intergenic
1015463179 6:133517087-133517109 CGCCACACTGCCTTCCACAATGG + Intronic
1015470929 6:133605376-133605398 CACCACACTGCTTTCCACAATGG + Intergenic
1015488071 6:133794361-133794383 TGCCACAGTGCTTTCCACAATGG + Intergenic
1015493873 6:133859636-133859658 CGCCATACTGCTTTCCACAATGG + Intergenic
1015651786 6:135470386-135470408 CGCCACAGTGTCTTCCACAATGG - Intronic
1015697676 6:135999833-135999855 TGCCACAGTGCTTTCCATAAAGG + Intronic
1015906713 6:138124523-138124545 TGCCGTACTGCTTTCCACAATGG + Intergenic
1016084731 6:139899146-139899168 CGTTACACTGCTTTCCACAATGG + Intergenic
1016095146 6:140027707-140027729 TGCCACACTGCTTTCCACAATGG + Intergenic
1016123263 6:140369647-140369669 CGCCACACTGATTTCCACAAGGG - Intergenic
1016288551 6:142502218-142502240 TGCCGCACTGCTTTCCACAATGG + Intergenic
1016959481 6:149658410-149658432 CTGTGTAGTGCCTTCCACAAAGG + Exonic
1017426512 6:154327641-154327663 TGCTACACTGTTTTCCACAATGG - Intronic
1017994049 6:159515780-159515802 CGCCACACTGCTTTCTACAATGG + Intergenic
1018283164 6:162209525-162209547 CGCTGCACTGTCTTCCACAATGG - Intronic
1018375409 6:163206132-163206154 CACCACACTGCTTTCCACAATGG - Intronic
1018671667 6:166182960-166182982 CGCCACACAGCTTTCCACAATGG + Intergenic
1018806340 6:167264179-167264201 CGTTGCAATGTCTTCCACAATGG - Intergenic
1019051717 6:169188591-169188613 CCCTGCAGTGCTACCCACAAGGG + Intergenic
1019140344 6:169938600-169938622 CCCTGCAGTGCTTCCGAGAAGGG - Intergenic
1019655129 7:2189242-2189264 CACTACATTGCTTTCCACAGTGG - Intronic
1019879990 7:3850428-3850450 CGCCGCATTGTCTTCCACAATGG - Intronic
1020425616 7:8063035-8063057 CACCACAGTGCTTTCCACAGTGG + Intronic
1020524803 7:9245516-9245538 CGCCGCACTGACTTCCACAATGG - Intergenic
1020571080 7:9862584-9862606 CACTAAATTGCTTTCCACAATGG - Intergenic
1020735540 7:11944579-11944601 TGCCACACTGCTTTCCACAATGG + Intergenic
1020737974 7:11975797-11975819 CTCTAAACTGCTTTCCACAATGG - Intergenic
1020739508 7:11996219-11996241 CATTGCAGTGCTGTTCACAACGG - Intergenic
1020877136 7:13712139-13712161 CACCACACTGCTTTCCACAATGG - Intergenic
1021064783 7:16159778-16159800 CGCCACACTGTTTTCCACAATGG + Intronic
1021293927 7:18880228-18880250 TGCCACACTGCTTTCCACAATGG - Intronic
1021336564 7:19409883-19409905 CGCTATACTGCTTTCCGCAACGG + Intergenic
1021391712 7:20101513-20101535 CGCCACACTGCCTTCCACAATGG - Intergenic
1021455152 7:20821847-20821869 CGCCACACTGCCTTCCACAATGG + Intergenic
1021500300 7:21325244-21325266 TGCCACACTGCTTTCCACAATGG + Intergenic
1021525633 7:21583999-21584021 CGCCGCACTGTCTTCCACAATGG - Intronic
1021733530 7:23620151-23620173 CGCCACACTGCCTTCCACAATGG + Intronic
1021773954 7:24033235-24033257 TGCCACACTGCTTTCCACAATGG + Intergenic
1021979193 7:26038075-26038097 CGCTACACTGTCTTCCACAATGG + Intergenic
1022758380 7:33319465-33319487 CTCTGCACTGGTTTCCACAGTGG + Intronic
1022762930 7:33376612-33376634 TGCCACACTGCTTTCCACAAGGG + Intronic
1022851391 7:34266174-34266196 CGCCACACTGATTTCCACAAGGG + Intergenic
1023075402 7:36476944-36476966 CACCACAGTGCTTTCCATAACGG + Intergenic
1023116094 7:36864157-36864179 GGCTGCAGTGCTGTTCACACCGG - Intronic
1023555043 7:41412987-41413009 CACCACACTGCTTTCCACAATGG + Intergenic
1023885765 7:44354093-44354115 CACCACACTGCTTTCCACAATGG + Intergenic
1024344876 7:48302906-48302928 CGCCACACTGGTTTCCACAATGG + Intronic
1024373643 7:48614456-48614478 CGCTACACTGACTTCCACAATGG - Intronic
1024423358 7:49196619-49196641 CGCCACACTGCTTTCCACAGTGG + Intergenic
1024885177 7:54133246-54133268 CACTGTACTGCTTTCCACAATGG + Intergenic
1025067596 7:55871150-55871172 CGCTACACTGTATTCCACAATGG - Intergenic
1025879462 7:65520981-65521003 CGCTACACTGTCTTCCACAATGG - Intergenic
1025893976 7:65681607-65681629 CGCTACACTGTCTTCCACAATGG + Intergenic
1026099710 7:67374512-67374534 CGCCACACTGCTTTCCACAATGG + Intergenic
1026274963 7:68868663-68868685 TGCTACCCTGCTTTCCACAATGG + Intergenic
1026518263 7:71091991-71092013 CACCACACTGCTTTCCACAATGG - Intergenic
1026576517 7:71576424-71576446 CTCTGAACTGCTTTCCACAGTGG + Intronic
1027152697 7:75743852-75743874 CGCTTGAGTCCTTTCCACACAGG - Intergenic
1027286723 7:76652788-76652810 CGCCGCACTGACTTCCACAATGG - Intergenic
1027478744 7:78667960-78667982 CGCTACACTGACTTCCACAATGG + Intronic
1027498828 7:78922762-78922784 CGCTACACTGACTTCCACAATGG + Intronic
1027545877 7:79526931-79526953 TGCTACACTGCCTTCCACAATGG + Intergenic
1028047486 7:86141257-86141279 CGCCACAGTGTCTTCCACAATGG - Intergenic
1028143927 7:87300692-87300714 TGCCACACTGCTTTCCACAAAGG - Intergenic
1028218247 7:88161878-88161900 CGCCACACTGCCTTCCACAATGG - Intronic
1028389776 7:90301896-90301918 TGCCACACTGCTTTCCACAATGG + Intronic
1028390863 7:90315175-90315197 TGCCACACTGCTTTCCACAATGG - Intergenic
1028508401 7:91595211-91595233 CGCCGCACTGACTTCCACAATGG - Intergenic
1028528343 7:91810316-91810338 CACTGCACTGTTTTCCACCATGG - Intronic
1028615169 7:92757725-92757747 CGCCACACTGATTTCCACAATGG + Intronic
1028720113 7:94020461-94020483 CGCTACACTGTCTTCCACAATGG - Intergenic
1028784851 7:94780820-94780842 CGCCACACTGATTTCCACAATGG - Intergenic
1028805453 7:95021044-95021066 CGCCGCACTGTCTTCCACAATGG + Intronic
1028945114 7:96570771-96570793 CGCTACACTGTCTTCCACAATGG + Intronic
1029785510 7:102786252-102786274 CGCTACACTGACTTCCACAATGG - Intronic
1029792037 7:102853942-102853964 CGCTGCACTGGCTTCCACAATGG - Intronic
1029907684 7:104107953-104107975 CGCCACACTGTTTTCCACAATGG + Intergenic
1029938798 7:104457684-104457706 CGCCACAGTGACTTCCACAATGG + Intronic
1029953113 7:104608067-104608089 CGCCGCAGTGACTTCCACAATGG - Intronic
1030101428 7:105949268-105949290 CGCCACACTGCCTTCCACAATGG + Intronic
1030178068 7:106675430-106675452 CGCCACAGTGTCTTCCACAATGG - Intergenic
1030200467 7:106897952-106897974 CGCCACATTGCTTTCCACAATGG + Intronic
1030287526 7:107841736-107841758 TGCCACACTGCTTTCCACAATGG - Intergenic
1030451180 7:109714196-109714218 TGCCACACTGCTTTCCACAATGG - Intergenic
1030500244 7:110350979-110351001 CGCCACAGTGACTTCCACAAGGG - Intergenic
1030700013 7:112627847-112627869 CACCACACTGCTTTCCACAATGG + Intergenic
1030718217 7:112836057-112836079 TGCTACACTGCTTTCCACAATGG + Intronic
1030718887 7:112845655-112845677 CGCCACACTGCTTTCCATAACGG - Intronic
1030890235 7:114990918-114990940 CGCCACACTGTTTTCCACAATGG + Intronic
1030945445 7:115713716-115713738 CGCCACTGTACTTTCCACAATGG + Intergenic
1031023917 7:116659689-116659711 CACCACACTGCTTTCCACAATGG + Intergenic
1031059217 7:117030757-117030779 TGCCACACTGCTTTCCACAATGG - Intronic
1031247304 7:119331047-119331069 CACTAAACTGCTTTCCACAATGG + Intergenic
1031366481 7:120906270-120906292 CGCGACAGTGTCTTCCACAATGG - Intergenic
1031442986 7:121815924-121815946 CCCCACACTGCTTTCCACAATGG - Intergenic
1031465632 7:122107308-122107330 TGCCACACTGCTTTCCACAATGG - Intronic
1031510013 7:122638220-122638242 CTCTGAAGGGCTTTCCAGAAAGG - Intronic
1031516690 7:122709478-122709500 CGCTGCACTGGCTTCCACAATGG - Intronic
1031669076 7:124520229-124520251 TGCCACACTGCTTTCCACAATGG + Intergenic
1031772371 7:125860714-125860736 TGCCACACTGCTTTCCACAATGG + Intergenic
1031911599 7:127522633-127522655 CACAACACTGCTTTCCACAATGG - Intergenic
1032106778 7:129038401-129038423 CGCCACATTGCTTTCCACAATGG - Intronic
1032249837 7:130246475-130246497 CGCCACAGTGCTTTCTACAATGG - Intergenic
1032268128 7:130382430-130382452 CTCTACAGTACCTTCCACAATGG - Intronic
1032309014 7:130765024-130765046 CGCCACACTGTTTTCCACAATGG + Intergenic
1032313627 7:130813245-130813267 CGCCACACTGTTTTCCACAATGG + Intergenic
1032361639 7:131261564-131261586 CACCACACTGCTTTCCACAATGG - Intronic
1033139413 7:138811798-138811820 CGCTACAGTGACTTCCACAATGG + Intronic
1033153965 7:138940584-138940606 CGCTACAGTGACTTCCACAATGG + Intronic
1033281678 7:140010371-140010393 GGCTGCTGTGTTTCCCACAAGGG - Intronic
1033433472 7:141310721-141310743 TGCTACACTGCCTTCCACAATGG - Intronic
1033624910 7:143100016-143100038 CACCACACTGCTTTCCACAATGG + Intergenic
1033819006 7:145110680-145110702 CACTACACTGGTTTCCACAATGG + Intergenic
1033892911 7:146037529-146037551 CGCCACACTGCCTTCCACAATGG + Intergenic
1033903346 7:146170351-146170373 CTTTGCAGTGTTTTCCATAATGG + Intronic
1034160836 7:148993309-148993331 CTCTGCAGGGCTGACCACAAGGG - Intergenic
1034216703 7:149413089-149413111 CGCCATACTGCTTTCCACAATGG - Intergenic
1034381456 7:150698188-150698210 TGCCACACTGCTTTCCACAATGG - Intergenic
1035041337 7:155930046-155930068 CACTGCTGGGCTTTCTACAAAGG - Intergenic
1035420415 7:158724968-158724990 CGCTGTAGTCCTTACCTCAAAGG - Intergenic
1035711767 8:1722505-1722527 CGCTACAGTATCTTCCACAATGG - Intergenic
1035863043 8:3051018-3051040 CACCACACTGCTTTCCACAATGG - Intronic
1036109664 8:5883935-5883957 CGCCACACTGCCTTCCACAATGG - Intergenic
1036995432 8:13650008-13650030 CGCCACACTGTTTTCCACAATGG + Intergenic
1037169940 8:15878944-15878966 CGCCACACTGCCTTCCACAATGG - Intergenic
1037253302 8:16922293-16922315 CGCCACAGTGACTTCCACAATGG + Intergenic
1037261040 8:17008590-17008612 TGCCACACTGCTTTCCACAATGG - Intergenic
1038059362 8:23895411-23895433 TGCCACACTGCTTTCCACAATGG + Intergenic
1038158539 8:25014539-25014561 CGCCACACTGATTTCCACAATGG - Intergenic
1038317465 8:26499807-26499829 CACCACACTGCTTTCCACAATGG - Intronic
1038365961 8:26935505-26935527 CGCCACAGTGACTTCCACAATGG + Intergenic
1038401007 8:27284514-27284536 CGCTGCAGTGCATTTCTCCAGGG - Intergenic
1038518764 8:28210882-28210904 CGCCACACTGCCTTCCACAATGG - Intergenic
1038656226 8:29454760-29454782 CGCCACAGTGTCTTCCACAATGG - Intergenic
1038894024 8:31760873-31760895 CGCCACAGTGACTTCCACAATGG - Intronic
1038935927 8:32251627-32251649 CGCCGCACTGTCTTCCACAATGG + Intronic
1039086001 8:33780513-33780535 CACCACACTGCTTTCCACAATGG + Intergenic
1039774429 8:40721548-40721570 CGCCACACTGATTTCCACAATGG + Intronic
1040014192 8:42687952-42687974 CGCCACACTGTTTTCCACAATGG - Intergenic
1040442098 8:47454048-47454070 TGCTGCACTGTCTTCCACAATGG - Intronic
1040762888 8:50872823-50872845 CACCGCACTGTTTTCCACAATGG - Intergenic
1040989310 8:53332475-53332497 CCCTGCAGTGTTATTCACAATGG - Intergenic
1041102485 8:54410495-54410517 CGCCACACTGATTTCCACAATGG - Intergenic
1041129494 8:54682386-54682408 CGCCACACTGATTTCCACAATGG - Intergenic
1041220154 8:55642674-55642696 TGCCACACTGCTTTCCACAATGG + Intergenic
1041301105 8:56412251-56412273 CACTGCAGCACTATCCACAATGG - Intergenic
1041565916 8:59278945-59278967 TGCCGTAGTGCTTTGCACAATGG - Intergenic
1041767891 8:61438598-61438620 CGCCACACTGTTTTCCACAATGG + Intronic
1041772359 8:61485516-61485538 CGCCACACTGCCTTCCACAATGG - Intronic
1041815404 8:61964891-61964913 CGCTACACTGTCTTCCACAATGG + Intergenic
1041888075 8:62835893-62835915 CATTGCAGTGCTATTCACAATGG + Intronic
1042108137 8:65350368-65350390 TGCCACACTGCTTTCCACAATGG + Intergenic
1042200024 8:66272509-66272531 TGCCACACTGCTTTCCACAATGG - Intergenic
1042401059 8:68347534-68347556 CACCACACTGCTTTCCACAACGG + Intronic
1042462954 8:69092024-69092046 CGCTGCACTGTCTTCCACAATGG + Intergenic
1042586116 8:70340515-70340537 CGCTACACTGTCTTCCACAATGG - Intronic
1042621523 8:70711196-70711218 CTCTAAACTGCTTTCCACAATGG - Intronic
1042629206 8:70798124-70798146 TGCCACACTGCTTTCCACAATGG + Intergenic
1042720877 8:71825818-71825840 CGCCACACTGATTTCCACAATGG - Intergenic
1042727970 8:71899630-71899652 CGCCACACTGATTTCCACAATGG + Intronic
1042820567 8:72925663-72925685 CGCCACACTGCCTTCCACAATGG - Intronic
1042976193 8:74472507-74472529 TGCCACACTGCTTTCCACAATGG + Intronic
1043231660 8:77809875-77809897 CTCTGCACTGCTTTCCACAGTGG - Intergenic
1043248610 8:78038358-78038380 TGCCACACTGCTTTCCACAATGG + Intergenic
1043424546 8:80135553-80135575 CGCCACACTGATTTCCACAATGG - Intronic
1043481229 8:80654762-80654784 CGCTACACTGACTTCCACAATGG - Intronic
1043507024 8:80912230-80912252 TGCCACACTGCTTTCCACAATGG + Intergenic
1043681354 8:83029546-83029568 CACCACACTGCTTTCCACAATGG - Intergenic
1043742686 8:83833892-83833914 CGCCACACTGATTTCCACAATGG - Intergenic
1043755000 8:83992398-83992420 CGCCATACTGCTTTCCACAATGG - Intergenic
1043774074 8:84242413-84242435 TGCTACAGTGTCTTCCACAATGG + Intronic
1043790720 8:84464710-84464732 CGCTACACTGACTTCCACAATGG + Intronic
1043832503 8:85006727-85006749 CTCTGCACTGTTTTCCACAGTGG - Intergenic
1043938385 8:86169046-86169068 CGCCACACTGCCTTCCACAATGG + Intergenic
1043951509 8:86314460-86314482 CACCCCACTGCTTTCCACAATGG + Intronic
1044033679 8:87270534-87270556 CACCACACTGCTTTCCACAATGG - Intronic
1044162039 8:88931385-88931407 CGCTACACTGTCTTCCACAACGG - Intergenic
1044193567 8:89348230-89348252 TGCCACACTGCTTTCCACAATGG + Intergenic
1044314794 8:90737600-90737622 CACCTCACTGCTTTCCACAATGG - Intronic
1044603411 8:94027948-94027970 CGCTGAAAGACTTTCCACAAGGG - Intergenic
1044781450 8:95747632-95747654 CGCCACACTGATTTCCACAATGG - Intergenic
1044823480 8:96175193-96175215 CGCCACACTGTTTTCCACAATGG - Intergenic
1044911375 8:97063051-97063073 CGCCACACTGCTTTCCACAATGG + Intronic
1044954333 8:97463885-97463907 CGCCACACTGCTTTCCACAATGG - Intergenic
1045091110 8:98744152-98744174 CGCCACACTGCCTTCCACAATGG - Intronic
1045148984 8:99381475-99381497 CGCCACACTGTTTTCCACAATGG + Intronic
1045882562 8:107058517-107058539 CGCCACACTGATTTCCACAATGG + Intergenic
1046116056 8:109785133-109785155 CGCCACAGTGCCTTCCACAATGG - Intergenic
1046166362 8:110441723-110441745 CACTATATTGCTTTCCACAATGG - Intergenic
1046216715 8:111157716-111157738 CACCGCACTGCTTTCTACAATGG - Intergenic
1046596510 8:116267424-116267446 TGCCACACTGCTTTCCACAATGG + Intergenic
1046628433 8:116599755-116599777 CTCTGCACTGTCTTCCACAATGG + Intergenic
1046664277 8:116981987-116982009 TGTTACACTGCTTTCCACAATGG + Intronic
1046736433 8:117781041-117781063 CACCACACTGCTTTCCACAATGG - Intergenic
1046862668 8:119111761-119111783 CACTGCACTGTCTTCCACAATGG - Intergenic
1046971956 8:120232835-120232857 CGCTACACTGCCTTCCACAATGG + Intronic
1046973205 8:120245459-120245481 CTCTGCAGTGCTTTAACCAAGGG - Intronic
1046979652 8:120322972-120322994 CGCCGCACTGCCTTCCACAATGG + Intronic
1047264848 8:123296816-123296838 CGCCACACTGCTTTCCACAGTGG - Intergenic
1048424264 8:134308088-134308110 CGCTACACTGACTTCCACAATGG + Intergenic
1048683080 8:136868454-136868476 CCCCACACTGCTTTCCACAATGG - Intergenic
1048818334 8:138355140-138355162 CGCTACATTGTCTTCCACAATGG - Intronic
1049355927 8:142188008-142188030 CCCAGCTGTGCTTTCCACCAAGG + Intergenic
1050066441 9:1764753-1764775 CGCTACACTGTCTTCCACAATGG - Intergenic
1050323027 9:4473029-4473051 CACCACACTGCTTTCCACAATGG + Intergenic
1050370400 9:4915639-4915661 CGCCACACTGATTTCCACAATGG + Intergenic
1050477040 9:6050915-6050937 CACCACACTGCTTTCCACAATGG - Intergenic
1050866602 9:10508367-10508389 CGCCGCACTGTCTTCCACAATGG - Intronic
1050921922 9:11214418-11214440 CGCTACACTGTTTTCCACAATGG + Intergenic
1050956309 9:11665832-11665854 CGCTACACTGATTTCCACAATGG + Intergenic
1051110768 9:13632921-13632943 TGCTACACTGCTTTCCACAGTGG - Intergenic
1051298463 9:15621700-15621722 CGCCACATTGTTTTCCACAATGG - Intronic
1051494564 9:17705313-17705335 TGCCACACTGCTTTCCACAATGG - Intronic
1051549235 9:18310775-18310797 TGCCACAGTGCCTTCCACAATGG - Intergenic
1051570972 9:18558579-18558601 CGCCACACTGTTTTCCACAATGG + Intronic
1051619723 9:19038178-19038200 CGCCACACTGCCTTCCACAATGG - Intronic
1051688728 9:19686328-19686350 CACTTCACTGCTTTCCACAGTGG - Intronic
1051706487 9:19886168-19886190 CGCCACACTGCTTTTCACAATGG + Intergenic
1051962126 9:22779387-22779409 CGCCACACTGCTTTTCACAATGG + Intergenic
1052335752 9:27318258-27318280 CGCCACACTGTTTTCCACAATGG + Intergenic
1052487761 9:29124832-29124854 CGCTACACTGTCTTCCACAATGG - Intergenic
1052567996 9:30183170-30183192 CACCACACTGCTTTCCACAACGG + Intergenic
1052617328 9:30857443-30857465 CGCCGCACTGTCTTCCACAATGG + Intergenic
1052793111 9:32896066-32896088 CGCCAAACTGCTTTCCACAATGG + Intergenic
1052893693 9:33727626-33727648 CGCCACACTGCCTTCCACAATGG - Intergenic
1053100577 9:35368629-35368651 CACCACACTGCTTTCCACAACGG + Intronic
1053522436 9:38793578-38793600 CGCTACACTGTCTTCCACAATGG + Intergenic
1053710120 9:40798775-40798797 AGCTGCAGGGCTGTTCACAATGG - Intergenic
1054194665 9:62018000-62018022 CGCTACACTGTCTTCCACAATGG + Intergenic
1054420024 9:64919570-64919592 AGCTGCAGGGCTGTTCACAATGG - Intergenic
1054643743 9:67570690-67570712 CGCTACACTGTCTTCCACAATGG - Intergenic
1054960748 9:70966314-70966336 TGCCACACTGCTTTCCACAATGG - Intronic
1055133125 9:72798286-72798308 CGCCATACTGCTTTCCACAATGG - Intronic
1055235696 9:74120055-74120077 TGCTGTACTGCTTTCCACAATGG + Intergenic
1055301902 9:74891234-74891256 CACCACACTGCTTTCCACAATGG + Intergenic
1055540477 9:77299495-77299517 CGCCACACTGTTTTCCACAATGG - Intronic
1055572289 9:77629300-77629322 CGCTACACTGTCTTCCACAATGG - Intronic
1055782779 9:79837489-79837511 CACTGCAGGGCTATTCACAATGG - Intergenic
1055804665 9:80079155-80079177 CACCACATTGCTTTCCACAATGG - Intergenic
1055874928 9:80931053-80931075 AGCCACAATGCTTTCCACAATGG - Intergenic
1055899928 9:81222712-81222734 CGCCACACTGATTTCCACAAGGG - Intergenic
1055912711 9:81370813-81370835 CGCTGCAGGGTGTCCCACAAGGG + Intergenic
1056028772 9:82528836-82528858 CGCCACACTGTTTTCCACAATGG - Intergenic
1056150146 9:83778118-83778140 CGCCACACTGCTTTCCACAGTGG - Intronic
1056631790 9:88300080-88300102 CGCCACACTGTTTTCCACAATGG - Intergenic
1056727470 9:89133332-89133354 CGCCACAGTGTCTTCCACAATGG - Intronic
1057001265 9:91512182-91512204 CGCCACACTGCCTTCCACAATGG - Intergenic
1057162635 9:92900502-92900524 CGCCGCACTGACTTCCACAATGG + Intergenic
1057360352 9:94367728-94367750 CGTCACAGTGCTTTCCACAATGG + Intergenic
1057662990 9:97020349-97020371 CGTCACAGTGCTTTCCACAATGG - Intergenic
1057833226 9:98423181-98423203 CGCCGCACTGACTTCCACAATGG + Intronic
1057844626 9:98513828-98513850 CGCCGCACTGACTTCCACAATGG - Intronic
1058206894 9:102119404-102119426 TGCTACACTGCCTTCCACAATGG + Intergenic
1058207548 9:102127391-102127413 CGCCACACTGTTTTCCACAATGG + Intergenic
1058921696 9:109622299-109622321 CGCTACACTGTCTTCCACAATGG - Intergenic
1059003402 9:110374747-110374769 CGCCGTACTGCTTTCCTCAATGG - Intronic
1059966526 9:119619958-119619980 TGCTACACTGCTTTCCATAATGG + Intergenic
1059978706 9:119745606-119745628 CGCCGCACTGTCTTCCACAATGG - Intergenic
1060046783 9:120347884-120347906 CGCCACACTGCTATCCACAATGG + Intergenic
1060091267 9:120745992-120746014 TGCCACACTGCTTTCCACAATGG - Intergenic
1060092367 9:120754539-120754561 CACCACACTGCTTTCCACAATGG + Intronic
1060502219 9:124168029-124168051 TGCCACACTGCTTTCCACAATGG + Intergenic
1203532274 Un_GL000213v1:157224-157246 CGCTACACTGTCTTCCACAATGG + Intergenic
1203720378 Un_GL000216v2:9228-9250 CATTCCATTGCTTTCCACAAGGG + Intergenic
1185670508 X:1805887-1805909 TGTCACAGTGCTTTCCACAATGG - Intergenic
1185711280 X:2305411-2305433 CGCCACAGTGTCTTCCACAATGG - Intronic
1186082396 X:5947254-5947276 GGCCACACTGCTTTCCACAATGG + Intronic
1186415234 X:9377641-9377663 CGCCATACTGCTTTCCACAATGG + Intergenic
1186531718 X:10303422-10303444 TGCCACACTGCTTTCCACAATGG - Intergenic
1186564055 X:10643576-10643598 CGCTACACTGACTTCCACAATGG - Intronic
1186912571 X:14184756-14184778 CGCCACACTGCCTTCCACAATGG - Intergenic
1186914096 X:14201259-14201281 CGCCACACTGTTTTCCACAATGG + Intergenic
1187132354 X:16515130-16515152 CGCCACGCTGCTTTCCACAATGG - Intergenic
1187289227 X:17936407-17936429 TGCCACATTGCTTTCCACAATGG + Intergenic
1187664747 X:21593893-21593915 TGCCACACTGCTTTCCACAATGG - Intronic
1187756388 X:22531754-22531776 TCCTGTACTGCTTTCCACAATGG - Intergenic
1187760725 X:22581126-22581148 CGCCACAGTGTCTTCCACAATGG - Intergenic
1188148273 X:26641148-26641170 CACCACACTGCTTTCCACAATGG + Intergenic
1188288753 X:28362661-28362683 CGCCACAGTGTCTTCCACAACGG + Intergenic
1188336379 X:28939104-28939126 CGTCACACTGCTTTCCACAATGG - Intronic
1188345034 X:29053448-29053470 CACCACACTGCTTTCCACAATGG + Intronic
1188493724 X:30761743-30761765 CACCACACTGCTTTCCACAATGG - Intergenic
1188634175 X:32407544-32407566 CGCCACAGTGACTTCCACAATGG - Intronic
1188666540 X:32828295-32828317 CACCACACTGCTTTCCACAATGG + Intronic
1188733611 X:33683986-33684008 CGCTACACTGACTTCCACAATGG - Intergenic
1188770971 X:34153897-34153919 CGCCACACTACTTTCCACAATGG + Intergenic
1188796744 X:34476109-34476131 TGCCACACTGCTTTCCACAATGG + Intergenic
1188806477 X:34596710-34596732 CTCCACACTGCTTTCCACAATGG + Intergenic
1188810523 X:34649117-34649139 TACTGTACTGCTTTCCACAATGG - Intronic
1188835789 X:34952839-34952861 TGCCACACTGCTTTCCACAATGG - Intergenic
1188855246 X:35186550-35186572 CACCGCACTGCTTTCCACAATGG + Intergenic
1188859221 X:35237332-35237354 CGCCATACTGCTTTCCACAATGG - Intergenic
1188874625 X:35414740-35414762 CGCCGCACTGACTTCCACAATGG + Intergenic
1189570887 X:42295491-42295513 CACCACAGTGCTTTCCACAATGG + Intergenic
1189634247 X:42987990-42988012 CCCTGTAGTGCTTTTCACACAGG + Intergenic
1189842602 X:45096782-45096804 CACTGCACTGCTTTCCACAATGG - Intronic
1189867012 X:45341184-45341206 CACTACACTGTTTTCCACAATGG - Intergenic
1189921342 X:45905866-45905888 TGCCACACTGCTTTCCACAATGG + Intergenic
1190378012 X:49809016-49809038 CGCCAAACTGCTTTCCACAATGG + Intergenic
1190402091 X:50047393-50047415 CCCTGCAGAGCTTTCCATATGGG - Intronic
1190478083 X:50847928-50847950 CGCTACACTGTCTTCCACAATGG - Intergenic
1190592699 X:52021002-52021024 CGCTACACTGACTTCCACAATGG + Intergenic
1190802375 X:53803484-53803506 TGCCCCACTGCTTTCCACAATGG - Intergenic
1190924713 X:54892885-54892907 CACCACACTGCTTTCCACAATGG - Intergenic
1191124328 X:56938466-56938488 CGCCACACTGATTTCCACAATGG + Intergenic
1191147427 X:57182617-57182639 TGCCGCACTGCTTTCTACAATGG - Intergenic
1191152620 X:57236411-57236433 CTCCGCAGTGTTTTCCATAATGG + Intergenic
1191216974 X:57942708-57942730 CACCACACTGCTTTCCACAATGG + Intergenic
1191266610 X:58401197-58401219 CGCCACACTGATTTCCACAATGG - Intergenic
1191705578 X:64091171-64091193 CGCCACACTGTTTTCCACAATGG - Intergenic
1191878671 X:65822517-65822539 CACCACACTGCTTTCCACAATGG - Intergenic
1191881937 X:65851268-65851290 CGCCACACTGCCTTCCACAATGG + Intergenic
1191910160 X:66141578-66141600 TGCCACACTGCTTTCCACAATGG + Intergenic
1191961664 X:66709882-66709904 CTCCGAACTGCTTTCCACAATGG + Intergenic
1192025027 X:67440875-67440897 CGCTGCACAGCTTTCCACAATGG + Intergenic
1192058653 X:67800207-67800229 CGCCACACTGTTTTCCACAATGG - Intergenic
1192076986 X:68009009-68009031 CGCCACATTGATTTCCACAATGG + Intergenic
1192311501 X:70019264-70019286 CACCGCACTGCTTTCCACAATGG - Intronic
1192574379 X:72230994-72231016 CTCTGCACTGTTTTCCAGAATGG - Intronic
1192721816 X:73706958-73706980 CGCTACACTGTCTTCCACAATGG - Intergenic
1192892395 X:75404798-75404820 TGCTATAGTGCTTTCCACAATGG - Intronic
1192934118 X:75840297-75840319 CACCACACTGCTTTCCACAATGG + Intergenic
1193047925 X:77071799-77071821 CGCCGCACTGTCTTCCACAATGG + Intergenic
1193051770 X:77109201-77109223 CTCTGTACTGCTTTCCATAATGG - Intergenic
1193131133 X:77920877-77920899 CTCTGTACTGCTTTCCACCACGG + Intronic
1193152947 X:78143428-78143450 CGCCACACTGCTTTCCAGAATGG + Intergenic
1193171071 X:78336344-78336366 CTCTACATTGCTTTCCACAATGG + Intergenic
1193187025 X:78525555-78525577 TGCCACACTGCTTTCCACAATGG - Intergenic
1193230465 X:79038839-79038861 CGCCACACTGCTTTCCACAATGG + Intergenic
1193351399 X:80469008-80469030 CTCTAAACTGCTTTCCACAATGG + Intergenic
1193385671 X:80868976-80868998 CGCCATACTGCTTTCCACAACGG + Intergenic
1193483130 X:82052325-82052347 CACTGTACTGCTTTCCACAATGG - Intergenic
1193552799 X:82919079-82919101 CACCACATTGCTTTCCACAATGG + Intergenic
1193559335 X:82998233-82998255 CACCACACTGCTTTCCACAATGG + Intergenic
1193631270 X:83891034-83891056 CACAGCAATACTTTCCACAAAGG + Intergenic
1193634970 X:83938464-83938486 CACCACACTGCTTTCCACAATGG + Intergenic
1193674383 X:84431421-84431443 CGCCAAAGTGCTTTCCACAATGG + Intronic
1193694557 X:84692227-84692249 CGCTACACTGTCTTCCACAATGG + Intergenic
1193714248 X:84919025-84919047 CACTGAACTGCTTTCCACAGTGG - Intergenic
1193777426 X:85660473-85660495 TGCTACACTGCTTTCCACAATGG - Intergenic
1193846840 X:86482606-86482628 CGCCACACTGATTTCCACAATGG + Intronic
1194313441 X:92342409-92342431 CATTGCAGTGCTGTTCACAATGG + Intronic
1194336531 X:92654070-92654092 TGCTGCACTGTCTTCCACAATGG + Intergenic
1194406262 X:93499708-93499730 CACTGCACTGTCTTCCACAATGG - Intergenic
1194632388 X:96301275-96301297 CACCACACTGCTTTCCACAATGG - Intergenic
1194786551 X:98091880-98091902 CACTAGACTGCTTTCCACAATGG + Intergenic
1194836031 X:98683989-98684011 TGCCACACTGCTTTCCACAATGG + Intergenic
1194959917 X:100223401-100223423 CGCCATACTGCTTTCCACAATGG + Intergenic
1194982926 X:100458998-100459020 CACCACACTGCTTTCCACAATGG - Intergenic
1195043874 X:101038625-101038647 CCCAGCAGAGCTTTCCACAATGG + Intronic
1195136772 X:101915813-101915835 CACTGCACTGTCTTCCACAATGG - Intronic
1195207689 X:102619515-102619537 CACCACACTGCTTTCCACAATGG + Intergenic
1195414099 X:104601809-104601831 TGCCACACTGCTTTCCACAATGG - Intronic
1195438882 X:104878512-104878534 CTTTGCTGTGATTTCCACAAAGG + Intronic
1195472984 X:105254122-105254144 CGCCATACTGCTTTCCACAATGG + Intronic
1195809380 X:108813222-108813244 CGCCACACTGTTTTCCACAATGG + Intergenic
1195921252 X:109985963-109985985 CTCCACAGTGCCTTCCACAATGG + Intergenic
1196000445 X:110778671-110778693 CACCACACTGCTTTCCACAATGG - Intronic
1196238568 X:113312189-113312211 CGCCACACTGCTTTCCACACTGG - Intergenic
1196472292 X:116042168-116042190 CACTGTACTGCTTTCCACAATGG - Intergenic
1196475710 X:116082740-116082762 TGCCACACTGCTTTCCACAATGG - Intergenic
1196896647 X:120343515-120343537 CTCAACACTGCTTTCCACAATGG + Intergenic
1196914781 X:120521532-120521554 CGCCACACTGCCTTCCACAATGG - Intergenic
1197006780 X:121511730-121511752 CGCCACACTGTTTTCCACAATGG + Intergenic
1197053075 X:122084280-122084302 CGCTGCACTGACTTCCACAATGG - Intergenic
1197122758 X:122911695-122911717 CGCTATACTGCTTTCCACAATGG - Intergenic
1197136720 X:123069300-123069322 CGCCATACTGCTTTCCACAATGG - Intergenic
1197171558 X:123440366-123440388 TGCTACACTGCTTTCCACAATGG + Intronic
1197366932 X:125574685-125574707 TGCCACACTGCTTTCCACAATGG - Intergenic
1197374781 X:125669115-125669137 CACCACACTGCTTTCCACAATGG - Intergenic
1197445443 X:126547932-126547954 CGCCACAGTGCCTTCCACAAGGG - Intergenic
1197511942 X:127380616-127380638 CGCCACACTGCTTTCCACAATGG + Intergenic
1197518157 X:127462583-127462605 CGCCATACTGCTTTCCACAATGG - Intergenic
1197528057 X:127586865-127586887 CGCCACACTGCCTTCCACAATGG - Intergenic
1197629977 X:128847301-128847323 CGCCACACTGCCTTCCACAATGG - Intergenic
1197649537 X:129049807-129049829 CGCCACACTGCCTTCCACAATGG - Intergenic
1197984403 X:132252510-132252532 CACCACATTGCTTTCCACAATGG - Intergenic
1198076624 X:133199469-133199491 CACCATAGTGCTTTCCACAATGG + Intergenic
1198445631 X:136711089-136711111 CTCTGTAGTGCTTTCCAAAGAGG - Intronic
1198785715 X:140285293-140285315 TGCTGCACTGTCTTCCACAATGG + Intergenic
1198794103 X:140377520-140377542 CGCCATATTGCTTTCCACAATGG - Intergenic
1198823593 X:140675248-140675270 CGCCAAACTGCTTTCCACAATGG - Intergenic
1198953992 X:142106761-142106783 CTCTACACTGCTTTCCACAGTGG - Intergenic
1198986840 X:142464319-142464341 CGCCACACTGTTTTCCACAACGG + Intergenic
1199105444 X:143860954-143860976 CGCCATACTGCTTTCCACAATGG + Intergenic
1199120973 X:144053586-144053608 CGCCACACTGTTTTCCACAATGG - Intergenic
1199156752 X:144558143-144558165 CACCACACTGCTTTCCACAATGG + Intergenic
1199216987 X:145271222-145271244 CACTGAACTGCTTTTCACAATGG - Intergenic
1199224556 X:145357277-145357299 CACCGCACTGTTTTCCACAATGG + Intergenic
1199225091 X:145363773-145363795 CGCTACACTGCCTTCCACAAAGG + Intergenic
1199349083 X:146778604-146778626 TGTCACAGTGCTTTCCACAATGG - Intergenic
1199417724 X:147605326-147605348 CACGGCAGTGCTTATCACAAGGG - Intergenic
1199469184 X:148174953-148174975 CACTGTACTGCTTTCCACAATGG + Intergenic
1199479197 X:148279280-148279302 CGCCATACTGCTTTCCACAATGG - Intergenic
1199739811 X:150724151-150724173 CACCACACTGCTTTCCACAACGG + Intronic
1199791424 X:151158866-151158888 TGCTGCACTGTCTTCCACAATGG + Intergenic
1199889198 X:152058186-152058208 CGCCACACTGCCTTCCACAATGG + Intergenic
1199891535 X:152087698-152087720 CGCCACACTGCCTTCCACAATGG + Intergenic
1199933607 X:152549958-152549980 CGCCACACTGCCTTCCACAATGG - Intergenic
1200341010 X:155395575-155395597 CGCCACACTGTTTTCCACAATGG - Intergenic
1200632431 Y:5606739-5606761 CGCCACACTGATTTCCACAATGG + Intronic
1200644961 Y:5770818-5770840 TGCTGCACTGTCTTCCACAATGG + Intergenic
1200889329 Y:8306268-8306290 CGCCACACTGATTTCCACAATGG + Intergenic
1200974683 Y:9196184-9196206 CGCCACACTGATTTCCACAATGG - Intergenic
1201593883 Y:15645281-15645303 CGCCACACTGATTTCCACAATGG + Intergenic
1201626363 Y:16019000-16019022 CGCCACACTGATTTCCACAATGG + Intergenic
1201644773 Y:16218431-16218453 CGCCACACTGATTTCCACAATGG + Intergenic
1201658041 Y:16366891-16366913 CGCCACACTGATTTCCACAATGG - Intergenic
1201740848 Y:17323511-17323533 CGCCGCACTGACTTCCACAATGG - Intergenic
1201970446 Y:19787639-19787661 CGCCACATTGCCTTCCACAATGG - Intergenic
1202059779 Y:20874267-20874289 CGCCACACTGCCTTCCACAATGG - Intergenic
1202064183 Y:20920479-20920501 CGCTACACTGACTTCCACAATGG + Intergenic
1202625626 Y:56854645-56854667 CGCCACAGTGACTTCCACAATGG - Intergenic