ID: 1167867105

View in Genome Browser
Species Human (GRCh38)
Location 19:52337256-52337278
Sequence CTGATGACAAGGAGAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 2, 2: 5, 3: 45, 4: 422}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167867095_1167867105 24 Left 1167867095 19:52337209-52337231 CCAGGGCAGACAGAGCAGCATGG 0: 2
1: 1
2: 23
3: 65
4: 405
Right 1167867105 19:52337256-52337278 CTGATGACAAGGAGAGCAGAGGG 0: 1
1: 2
2: 5
3: 45
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167867105 Original CRISPR CTGATGACAAGGAGAGCAGA GGG Intronic
900267901 1:1768824-1768846 ATGATGGCAAGGTGGGCAGAAGG + Intronic
900270349 1:1783803-1783825 CGGATGACAAGGTCAGGAGATGG + Intergenic
900377522 1:2362973-2362995 CAGAGGAAAATGAGAGCAGATGG + Intronic
900423140 1:2564367-2564389 CAGGTGACAAGGAAAGGAGAGGG - Intronic
900767773 1:4516784-4516806 CTGGGGACAAGGTGGGCAGAGGG + Intergenic
900975376 1:6013068-6013090 CTGAAGCCAAGCAGAGCAGTGGG - Intronic
902958444 1:19943574-19943596 CTGATCACAAGGTCAGGAGATGG - Intergenic
905513584 1:38543887-38543909 CTGAGAACCAGGAGAGCTGACGG - Intergenic
906460801 1:46034148-46034170 CTGATGACAAGGAGCGGTTAAGG - Exonic
907528563 1:55070067-55070089 CTGATGACAGGTGGAGGAGAGGG + Intronic
909292325 1:73899470-73899492 CTGATGATAAGAAGAGAAAAGGG - Intergenic
909721040 1:78769784-78769806 CGGAAGCCAAGGAGGGCAGATGG - Intergenic
910105453 1:83626997-83627019 CTGAAGACAAGGAGGGCACAGGG + Intergenic
911736671 1:101343861-101343883 GTGAAGACACGGAGAGAAGATGG + Intergenic
912185916 1:107275533-107275555 CTGAGAACCAGGAGAGCTGATGG + Intronic
913539209 1:119802922-119802944 CTGGTGAAATGGAGAGAAGAGGG - Intronic
914816124 1:151063929-151063951 CTGATGATAATGAGAGCAAATGG - Intronic
915289456 1:154873383-154873405 CTGGTGAGAAGGAAGGCAGAGGG - Intergenic
915452206 1:156013887-156013909 CAGATGAAAAGGAAGGCAGAAGG + Intronic
915464012 1:156085411-156085433 ATTATGGCAATGAGAGCAGAAGG + Intronic
915488939 1:156241006-156241028 ATGGTGACAAGGTGGGCAGAGGG - Intronic
915755348 1:158254434-158254456 TTGGTGACAAGGAGAGAAGCTGG + Exonic
915923953 1:160002000-160002022 CTGAGAACCAGGAGAGCCGATGG - Intergenic
916827453 1:168456170-168456192 CTGAAGACATGGAGGGCAGGGGG + Intergenic
916935993 1:169628732-169628754 AGGATGCCAAGGAGAGTAGAAGG + Intronic
918105423 1:181412161-181412183 ATGATGCCAAGGGGAGCAGCAGG + Intergenic
918222910 1:182452313-182452335 CTTATAAAAAGAAGAGCAGAGGG + Intronic
919019032 1:192079831-192079853 CACAGGACAAGAAGAGCAGATGG - Intergenic
920910071 1:210208207-210208229 GAGAAGACAAGGATAGCAGAAGG + Intergenic
921123787 1:212159241-212159263 CTGATAACAAGGTGACCAGTAGG + Intergenic
921488391 1:215743603-215743625 CTGATCACAAGGTCAGGAGATGG + Intronic
921705915 1:218323172-218323194 CAGGTGACAAGGAAAGAAGAAGG - Intronic
922133252 1:222799762-222799784 CTGAGTAAAAGGAGAGTAGATGG - Intergenic
923073995 1:230592825-230592847 CTGAGAACCAGGAGAGCTGAGGG + Intergenic
923348072 1:233076854-233076876 CTAATGACAAGGTGAGGGGAAGG + Intronic
923512866 1:234667729-234667751 CTGATGGAAAGAAGAGAAGAGGG - Intergenic
923612574 1:235507878-235507900 ATGATGAGAAGGTGAACAGAAGG + Intergenic
924255543 1:242179274-242179296 ATGAGGGCAAGGGGAGCAGACGG + Intronic
924303599 1:242664738-242664760 TAGCTGACAAGGAGATCAGAAGG + Intergenic
924732545 1:246724726-246724748 GTGAGGACAAGAAGAGGAGAGGG + Intronic
924811022 1:247402160-247402182 CTGATGAGATGGAGAGGTGAAGG + Intergenic
1062819709 10:525640-525662 CTGAGGACAGGGAGAGAACAGGG + Intronic
1064241940 10:13638601-13638623 CTGAGAACCAGGAGAGCTGATGG + Intronic
1065398789 10:25272038-25272060 CTGATGGCAAGGATATGAGATGG - Intronic
1065446192 10:25803697-25803719 CTGAGAAACAGGAGAGCAGAAGG + Intergenic
1067820082 10:49520764-49520786 CTGAGGACAGGGAGGGCAGGTGG - Intronic
1067984593 10:51128427-51128449 CTTATGACAAAGAGGGCAAATGG - Intronic
1068874992 10:61986419-61986441 GTGCTGAGAAGGAGAGCTGAAGG + Intronic
1069065094 10:63934071-63934093 CTAATTAAAAGGAGACCAGAGGG - Intergenic
1070385879 10:75924028-75924050 CTAACGACAATGAGAGCAAAAGG - Intronic
1070432933 10:76359419-76359441 CTGATGACATTCACAGCAGAGGG + Intronic
1070472131 10:76791504-76791526 ATGATGACATAGGGAGCAGATGG + Intergenic
1071772058 10:88740226-88740248 CTGAGGACAAGGAGAAGAAATGG - Intronic
1071833105 10:89391749-89391771 CGGATGACAAGGTCAGGAGATGG - Intronic
1072433866 10:95397932-95397954 CTGATGAGAAGGTGAGTGGAAGG + Intronic
1072611377 10:97019511-97019533 CTGCTGACTAGGAGGACAGAAGG + Intronic
1072638346 10:97192252-97192274 CTGAAGACTAGGGGAGGAGAGGG + Intronic
1072739050 10:97898703-97898725 CTAGAGACAAGGAGAGCAGCTGG + Intronic
1072871594 10:99126023-99126045 GTGATGACAGTGTGAGCAGATGG + Intronic
1073583316 10:104686687-104686709 TTGATGACAAGGAGGGAAGAGGG - Intronic
1073586480 10:104715402-104715424 CTGATAACCAGGGGAGCTGATGG - Intronic
1076842100 10:133050685-133050707 CTGATGAGGAGGAGGGCAGGGGG + Intergenic
1077839131 11:5954810-5954832 CTAATTGCAAGGAAAGCAGAAGG + Intergenic
1078062882 11:8059855-8059877 CTGCAGTCAAGGAGACCAGAAGG + Intronic
1078462996 11:11529486-11529508 CCGAGAATAAGGAGAGCAGATGG - Intronic
1081235646 11:40644013-40644035 CTAATATCAAGGAGAGCAAATGG + Intronic
1081619201 11:44609041-44609063 CTGCTGACAACGAGGGCAGCAGG - Intronic
1081662941 11:44899538-44899560 CTGGTGTCTAGGAGAGCAGCTGG + Intronic
1082007977 11:47430855-47430877 CTGAGAACCAGGAGAGCCGATGG - Intergenic
1084168715 11:67389933-67389955 CTGGTGACGAGGGGAGCAGAAGG + Intronic
1084939785 11:72606430-72606452 CTGATGACAAGAAGAGTGGCTGG - Intronic
1084970744 11:72770767-72770789 AAGATGACCAGGAGAGGAGACGG + Intronic
1085600510 11:77852031-77852053 ATTATGAGAAGGAGAGAAGAGGG - Intronic
1086918466 11:92558136-92558158 GTGATCCCCAGGAGAGCAGAGGG + Intronic
1087668450 11:101077746-101077768 CTGATGAGAAGGACATCAGTTGG + Intronic
1088042990 11:105411229-105411251 CTTATCACAAGGAGAGAAGGAGG + Intergenic
1089004299 11:115078105-115078127 CTCCTGACAAGAAGAGAAGATGG + Intergenic
1089723830 11:120455177-120455199 CTGAGGACATGGAGAAGAGATGG + Intronic
1090177578 11:124664784-124664806 CTGATGCCAAGAAGAGAAAAAGG + Intronic
1090444977 11:126756600-126756622 CTGAAGCCAAGATGAGCAGATGG - Intronic
1091195424 11:133726803-133726825 CTTGTACCAAGGAGAGCAGATGG - Intergenic
1092283900 12:7117667-7117689 CTGTTGAAAAGGAGAGCAGATGG + Intergenic
1092562750 12:9633476-9633498 GTGATGACAAGAAAAGAAGATGG + Intergenic
1093734337 12:22603214-22603236 CTGAGTCCAAGGTGAGCAGAAGG + Intergenic
1094240360 12:28215218-28215240 CTGACAACAAGGAAAGCTGATGG - Intronic
1094573135 12:31659472-31659494 TTAATGAGAAGGAGAGCTGATGG - Intronic
1094628765 12:32151686-32151708 GTGATAACAGGGACAGCAGAAGG + Intronic
1096233340 12:49909703-49909725 GTGAGGCCAAGGAGAGAAGAAGG + Intergenic
1096245992 12:49986852-49986874 AAAATGACAAGGAGAGCTGAGGG - Intronic
1098225922 12:68323777-68323799 CTGATTACAAGGAAAGCAAATGG + Intronic
1098503589 12:71223265-71223287 CTGAGAACCAGAAGAGCAGATGG - Intronic
1098813543 12:75127311-75127333 CTGCTGACAAGAAGAGAAAAAGG + Intronic
1100523860 12:95402112-95402134 CTCAAGAGAAGGAGAACAGATGG + Intergenic
1104090501 12:125512928-125512950 CTGATGTCCTGGAGAGGAGAGGG - Intronic
1104605987 12:130188133-130188155 GAGATTACAAGGACAGCAGAAGG - Intergenic
1105692097 13:22851511-22851533 CAGATCACGAGGACAGCAGATGG + Intergenic
1107853885 13:44595942-44595964 CTGAGGACAAGGAGAGTGGCAGG + Intergenic
1108498766 13:51049793-51049815 GTGATGACAATGAGAACAAAGGG + Intergenic
1108543538 13:51467573-51467595 CTGAGAACCAGGAGAGCAGATGG - Intergenic
1108805181 13:54145842-54145864 CTGATGGCAAGGATAAGAGATGG - Intergenic
1108884339 13:55161082-55161104 TGGATGACAAGGTGAGGAGAAGG - Intergenic
1109585335 13:64394568-64394590 CTGATCACATGGAGAACACATGG - Intergenic
1109830811 13:67785186-67785208 TTGATGAAAAGGAGACAAGAAGG + Intergenic
1111226918 13:85286619-85286641 CAGATAACTAGGAGGGCAGAGGG - Intergenic
1111434447 13:88188382-88188404 ATAATTACAAGGATAGCAGAAGG + Intergenic
1111612522 13:90622179-90622201 CTTAAGACCAGGAGAGCAGCTGG + Intergenic
1112044887 13:95586822-95586844 CTGACGAGAAGTAGAGCTGATGG - Intronic
1112841957 13:103590885-103590907 CTGATCACAAGGTCAGGAGATGG + Intergenic
1115066183 14:29263670-29263692 CTGATGATAAGGATGGCATAAGG - Intergenic
1116707432 14:48319915-48319937 CTGAGAACAAGGAGAACTGATGG + Intergenic
1117433874 14:55698031-55698053 CTGAGAACCAGGAGAGCTGATGG + Intronic
1118715415 14:68556367-68556389 CTTCAGACAAGGAGAGCAGCTGG - Intronic
1118838850 14:69496184-69496206 CACATGGCAAGGAGAGCACAGGG - Intronic
1120068354 14:80072766-80072788 CTGAGGACAAGGAGAGCTTGTGG - Intergenic
1120629312 14:86870578-86870600 CTGGAGACCAGGAGAGCAGATGG + Intergenic
1120706588 14:87752233-87752255 CTGAGAACAGGGAGAGCTGATGG + Intergenic
1121961808 14:98266869-98266891 CTGATGCCAAGGAGAGAATAAGG - Intergenic
1121995947 14:98603013-98603035 AAGATGGCAGGGAGAGCAGAAGG + Intergenic
1122159579 14:99773658-99773680 GTGATGGCAAGTAGGGCAGACGG - Intronic
1122757048 14:103989937-103989959 CTGATAATAAGGAGATCTGATGG - Intronic
1123918962 15:25057267-25057289 TTTATGCCAAGGAGAGCACAAGG + Intergenic
1124024181 15:25949320-25949342 CTGAGAACCAGGAGAGCTGATGG - Intergenic
1124322403 15:28725070-28725092 CTGAGAACCAGGAGAGCTGATGG + Intronic
1124606333 15:31172615-31172637 CTTCTGAAAAGGAGAGCAAAAGG + Intergenic
1125788580 15:42344583-42344605 ATAATGACAAGCATAGCAGATGG - Intronic
1126079948 15:44950026-44950048 CTGATCACAAGGTCAGGAGATGG + Intergenic
1126416222 15:48420403-48420425 CTGATGACTAGCAGTGCAGCGGG + Intronic
1126540516 15:49817293-49817315 CTGAGGTCAAGGAGGGGAGAGGG + Intergenic
1126708869 15:51434338-51434360 CTCATGACATAGAGAGTAGAAGG - Intergenic
1127932992 15:63609722-63609744 ATGAGGACAGGGAGAGGAGAGGG - Intronic
1128683912 15:69669913-69669935 CTGATCTCAAGCAGAGCTGAAGG - Intergenic
1128919058 15:71593980-71594002 CTGATGAGAAAGAGGGAAGAGGG + Intronic
1130297998 15:82660615-82660637 CTGGTGTGCAGGAGAGCAGACGG - Intronic
1130829973 15:87589459-87589481 CTGGAGACAAGGACACCAGAGGG + Intergenic
1130846901 15:87756032-87756054 GTGAAGAAAAGCAGAGCAGATGG + Intergenic
1130892004 15:88141357-88141379 CTCATGACAAGAAGAGCAGAAGG + Intronic
1132563619 16:610396-610418 CAGATGAGGAGGAGAGCAGGGGG + Intronic
1133320190 16:4909015-4909037 CAAATGACAAGGGGAGCTGATGG + Intronic
1133447496 16:5874646-5874668 CTGAGAATAAGGAGAGCAGCTGG + Intergenic
1133853366 16:9526632-9526654 CAGATGACAAGGTCAGGAGATGG - Intergenic
1134634813 16:15784242-15784264 ATGATGGCAGGGAGAGAAGAGGG + Intronic
1134679333 16:16113179-16113201 CTAATGGCAAGGAGAGGGGAGGG - Intronic
1134875608 16:17695745-17695767 CTGATGGCAAGGTGGTCAGAGGG + Intergenic
1135039104 16:19104237-19104259 CTGAGGCCCAGGAGTGCAGATGG - Intergenic
1135425554 16:22332489-22332511 CTAGTGACAAGCAGAGAAGAGGG - Intronic
1135503672 16:23018209-23018231 CTGCTGACAAGGAGATGAGAGGG + Intergenic
1139682086 16:68572976-68572998 CTGATGTCAAGGAAAACAGATGG - Intronic
1140070705 16:71647535-71647557 CTGAGGCCAATGAGAACAGATGG - Exonic
1140969973 16:80003380-80003402 CTGATGACAACTGGAGCATAGGG - Intergenic
1142344121 16:89543168-89543190 CGGATCACAAGGTCAGCAGATGG - Intronic
1142761300 17:2043273-2043295 CTGAAGAAAAGGGGAGCACAAGG + Exonic
1143352481 17:6298865-6298887 CTGATAAAAAGGAATGCAGAGGG - Intergenic
1146151328 17:30475258-30475280 TTGATGGCAAGGAGTGAAGATGG - Intergenic
1146574453 17:33979104-33979126 CTCATGACCAGGAGAGAGGAGGG + Intronic
1147054093 17:37820906-37820928 ATGCTGAGAAGGAGAGCAAAGGG - Intergenic
1147610346 17:41798342-41798364 CTGGGGACAGGGAGAGGAGAGGG - Intergenic
1148745396 17:49915272-49915294 TTGGTGACAGGGTGAGCAGAGGG - Intergenic
1149220861 17:54414150-54414172 CTGATGACAAGGAGAAAAACTGG - Intergenic
1149535267 17:57428873-57428895 ATTATTACTAGGAGAGCAGAAGG - Intronic
1149622682 17:58057912-58057934 CTGATGACAAGGAGAAATGGAGG - Intergenic
1153016060 18:583603-583625 CAGATGAAAAGCAGAGCATAGGG + Intergenic
1153305885 18:3630360-3630382 CTGAGAACCAGGAGAGCTGATGG - Intronic
1154094889 18:11404089-11404111 CTGAAGAAAATGATAGCAGATGG + Intergenic
1155009784 18:21765551-21765573 CTAATGAAAAAGGGAGCAGAGGG + Intronic
1157866129 18:51186390-51186412 CAGATGGGAAGGAGAGCAGAGGG + Intronic
1158712446 18:59849248-59849270 CGGATCACAAGGTGAGGAGATGG + Intergenic
1158796829 18:60856357-60856379 GCCAAGACAAGGAGAGCAGATGG + Intergenic
1159120951 18:64169955-64169977 CTGAGAACCAGGAGAGCTGATGG + Intergenic
1159410984 18:68073935-68073957 TTAATGACCAGGAGAACAGAAGG - Intergenic
1159579427 18:70218612-70218634 CTGAGGACACAGAGAGAAGATGG - Intergenic
1159979840 18:74764959-74764981 CTGAGGAGAAGGAAAGCAGGAGG + Intronic
1160490422 18:79333101-79333123 CTGATGCCCAGGAGAGATGATGG + Intronic
1161340279 19:3738061-3738083 GTCATGACCCGGAGAGCAGATGG + Intronic
1161614572 19:5262887-5262909 GTGAGGAGAAGGGGAGCAGAAGG + Intronic
1162994357 19:14324599-14324621 CTGCACACCAGGAGAGCAGATGG + Intergenic
1163741826 19:19019021-19019043 CTGATGGTATTGAGAGCAGAGGG - Intronic
1164530558 19:29045138-29045160 CTGAGAACTAGGAGAGCAGATGG - Intergenic
1164632403 19:29770149-29770171 GTGAGGACAAGGTGAGCAGGTGG + Intergenic
1164844893 19:31423580-31423602 CTGATCACAAGGTCAGGAGATGG + Intergenic
1165745695 19:38228734-38228756 GGGATGGCAAGGAGAGGAGAGGG + Intronic
1167148475 19:47695937-47695959 CAGAAGACAAGGAGAGGAGCAGG + Intronic
1167527345 19:49993213-49993235 CTGATGACAAACTCAGCAGAGGG + Intronic
1167859392 19:52270576-52270598 CCGGTGACAAGGAGGGCAAAGGG + Intronic
1167862742 19:52298204-52298226 CTGGTGACAACGAGAGCAGAGGG + Intronic
1167867105 19:52337256-52337278 CTGATGACAAGGAGAGCAGAGGG + Intronic
1167884148 19:52486641-52486663 CTTGTGTCAAGGAGAACAGAGGG + Intronic
1167885090 19:52493503-52493525 CTGGTGGCAAGGAGAACCGAGGG + Intronic
1167889593 19:52528684-52528706 CTGGTGTCAAGGAGAACCGAGGG + Intronic
1167890663 19:52536698-52536720 CTGGTGGCAATGAGAACAGAGGG + Intronic
1167894676 19:52571293-52571315 CTGGTGGCAAGGAGAACAGAGGG + Intronic
1167903152 19:52637342-52637364 CTGGTGGCAAGGAGAACAGAGGG - Intronic
1167909326 19:52689446-52689468 CTGGTGGCAAGGAGAACAGAGGG - Intronic
1167913837 19:52724739-52724761 CTGGTGGCACGGAGACCAGAGGG - Intronic
1167915042 19:52733993-52734015 CTTGTGTCAAGGAGAACAGAGGG - Intronic
1167925848 19:52820593-52820615 CTGGTGGCAAGGAGAACAGAGGG - Intronic
1167930034 19:52856582-52856604 CTGGTGGCAAGGAGAACAGAGGG - Intronic
1167934169 19:52892814-52892836 CTGGTGGCAAGGAGAACAGAGGG - Intronic
1167937845 19:52922371-52922393 CTGGTGGCAAGGAGAACAGAGGG - Intergenic
1167958857 19:53090136-53090158 CTGGTGACAAGGAGAGCAGAGGG - Intronic
1167960651 19:53102350-53102372 CTGGTGACAAGGCGAGCAGAGGG - Intronic
1167967205 19:53157714-53157736 CCGGTGACGAGGAGAGCAGAAGG - Intronic
1167971758 19:53192313-53192335 CTGGTGACAAGGAGAGCAGAGGG - Intronic
1167991828 19:53366722-53366744 CTGGTGGCAAAGAGAACAGAGGG + Intronic
1167995221 19:53396172-53396194 CTGGTGGCAAGGAGAACAGAGGG + Intronic
1167999479 19:53432968-53432990 CTGGTGGCAAGGAGAACAGAGGG + Intronic
925811701 2:7707787-7707809 TTGAGGAGAAGGAGAGTAGAGGG - Intergenic
926799462 2:16646915-16646937 CTGAGAACCAGGAGAGCTGATGG - Intronic
927721699 2:25387379-25387401 CTGAGGAGAGGCAGAGCAGATGG + Intronic
928268394 2:29832209-29832231 CTAATGAGAAGAAAAGCAGAGGG + Intronic
931086614 2:58838277-58838299 TTAATGACTAGGAGAGAAGAGGG + Intergenic
931462148 2:62458356-62458378 CTGGAGCCAAGGGGAGCAGAAGG - Intergenic
932052496 2:68412693-68412715 CTGTAGTGAAGGAGAGCAGAGGG - Intergenic
932285268 2:70526177-70526199 CTGATGACCTGGAGAATAGAGGG - Intronic
932921741 2:75923733-75923755 CTGAATAGAAGGAGAGGAGAGGG + Intergenic
932974653 2:76584511-76584533 CTGATCCCAAGGTTAGCAGAAGG - Intergenic
933448298 2:82411379-82411401 CTGAAGAGAAGGAGAGAAAAGGG - Intergenic
934612999 2:95754603-95754625 TTGATGACCAGGAAAGCACATGG + Intergenic
935874936 2:107496210-107496232 GTGATGACATGGAGAGGACAGGG - Intergenic
937328706 2:121008216-121008238 CTGAGAACCAGGAGAGCTGATGG - Intergenic
937790653 2:125957681-125957703 CTGAAGAAAAGGAGACCAGGAGG - Intergenic
938572374 2:132572243-132572265 CTGATAACAAGAACACCAGACGG - Intronic
938801777 2:134770529-134770551 CTTATGAGAGGGAGGGCAGAAGG - Intergenic
939614839 2:144350574-144350596 CTGACAAAAAGGAGAGCAGCTGG - Intergenic
939985445 2:148825524-148825546 CTGAGAACGAGGAGAGCTGATGG - Intergenic
940092425 2:149935528-149935550 TTAATGACAGGGAAAGCAGAAGG - Intergenic
941501554 2:166284672-166284694 TTGGAGACAATGAGAGCAGAAGG - Exonic
942403508 2:175628648-175628670 CTGAGGACCAGGAGTGCTGAAGG - Intergenic
942415557 2:175755377-175755399 TGGATGAGAAGGAAAGCAGAAGG - Intergenic
943388415 2:187230935-187230957 GTGATGGAAAGGAGAGAAGATGG - Intergenic
944080482 2:195782798-195782820 CAGAAGACATGGAGGGCAGATGG - Intronic
945100260 2:206256794-206256816 CTCAAGCCAAGGAGAGCTGAAGG - Intergenic
945448586 2:209967270-209967292 CTGATGTGTGGGAGAGCAGAGGG + Intronic
947313605 2:228830706-228830728 CTCATCAAAAGCAGAGCAGATGG - Intergenic
947386332 2:229594286-229594308 CTGAGAAAAAGAAGAGCAGAGGG + Intronic
948307731 2:236962070-236962092 CTGATGTCAAGTAGAAAAGAAGG - Intergenic
948446072 2:238033980-238034002 CTGATGACAATGACGGCATATGG - Intronic
948759578 2:240182469-240182491 GCGATGACAGGGAGAGGAGAAGG - Intergenic
1170106913 20:12761547-12761569 CTAATGCCAAGGCTAGCAGAAGG - Intergenic
1171043228 20:21786235-21786257 CTGAGGACAAGGAGAGGCAAAGG + Intergenic
1171212925 20:23330555-23330577 CTGAGGACTAGAAGCGCAGAGGG - Intergenic
1171385314 20:24765862-24765884 CTGTTGACAAGCAGAGAAGTAGG + Intergenic
1172076300 20:32300500-32300522 CAGATCACAAGGACAGGAGATGG - Intronic
1174230266 20:49040558-49040580 CTGATGTGCTGGAGAGCAGATGG + Intergenic
1175428173 20:58883672-58883694 CTGCTGAGTGGGAGAGCAGAGGG + Intronic
1175804294 20:61818893-61818915 CTGATGGCACAGAGAGCAGGGGG + Intronic
1177037325 21:16060352-16060374 GTGATGAGAAGGAGAGGAAAGGG - Intergenic
1177928481 21:27249597-27249619 CTGATCACAAGGTCAGGAGATGG + Intergenic
1178634732 21:34292223-34292245 CTGAGAACCAGGAGAGCTGATGG - Intergenic
1178759285 21:35385263-35385285 TCAAAGACAAGGAGAGCAGAAGG + Intronic
1178928071 21:36792435-36792457 ATGATGACAAGAAAAGGAGAAGG + Intronic
1180181419 21:46120221-46120243 CTGATGTCAAGGGGAGCTGGTGG - Intronic
1181436285 22:22913101-22913123 CAGATGAGAAGGAAGGCAGATGG + Intergenic
1181810209 22:25399536-25399558 CAGATGACAAGGTCAGGAGATGG + Intronic
1182599265 22:31447566-31447588 CTGCTGAAAAGGAGAGGGGAGGG + Intronic
1183256938 22:36768545-36768567 CTGTTGACCAGCAGAGGAGAGGG - Intronic
1183348971 22:37324211-37324233 CTAATGTCGAGGAGAGCTGAGGG - Intergenic
1183438631 22:37810004-37810026 CTGAGGTGAAGGAGAGGAGATGG - Exonic
1183915414 22:41114414-41114436 GTGAGGCCAAGGAGGGCAGACGG - Intronic
1183929104 22:41225960-41225982 CTGATGGCAAGGACAGCAGGTGG - Intronic
1183984261 22:41560966-41560988 CTGACGTCAGGGAGAGCAGGAGG - Exonic
1184120500 22:42446654-42446676 CTTATAAGAAGGAGAGGAGACGG + Intergenic
1184347622 22:43923452-43923474 CAGATGTCAAGGAAAACAGAAGG + Intergenic
1184982754 22:48105832-48105854 CTGAAAGCAGGGAGAGCAGAGGG - Intergenic
949820139 3:8107089-8107111 CTGAGAACCAAGAGAGCAGATGG - Intergenic
950008076 3:9704189-9704211 CTGATGACAGGGCGAGTAGCTGG + Intronic
950703421 3:14765963-14765985 CTTCTGACAAACAGAGCAGAAGG + Intronic
951583241 3:24187744-24187766 GAGCTGACAAGCAGAGCAGATGG + Intronic
951615584 3:24539996-24540018 CTGAAGAAAAGGAGGGAAGAGGG - Intergenic
952739312 3:36720280-36720302 CTTATCAGAAGCAGAGCAGATGG + Intronic
953156654 3:40381289-40381311 CTGAAAACCAGGAGAGCTGATGG - Intergenic
953395907 3:42569603-42569625 CTGGTGACAAGGAAAGCAGAAGG + Intronic
953397363 3:42583780-42583802 CTGATGCCAAGGGCAGAAGAGGG - Intronic
953428927 3:42820781-42820803 CTGATGAGAAGGAAATCACAAGG + Intronic
953571714 3:44076525-44076547 CTGGTGACAAAGGGAGGAGAGGG + Intergenic
953875277 3:46663109-46663131 CGGATGACAGTGTGAGCAGAGGG - Intergenic
954264870 3:49464189-49464211 CTGATCACAAGGTCAGGAGATGG + Intergenic
954776263 3:53021293-53021315 CTGATGTCAAGGAGTGGAAAAGG + Intronic
954874103 3:53789861-53789883 CTGAACACAGGGAGATCAGATGG - Intronic
955414703 3:58681284-58681306 GTGAAGTCAAGGAGAGCACAGGG - Intergenic
956117698 3:65935029-65935051 ATTATGACAAGGAAAGCATAGGG + Intronic
956932742 3:74063991-74064013 GTAATGACATGGAGAGAAGATGG - Intergenic
957451248 3:80385377-80385399 CTGATGACCAGGGGAGATGATGG + Intergenic
957502487 3:81075175-81075197 CTGATAACAAGGAGGGATGATGG - Intergenic
958832094 3:99101571-99101593 CTGAGAACAAGGAGAGTTGAAGG + Intergenic
960567616 3:119151204-119151226 CTGCTGAGAAAGAGAGCATAAGG - Exonic
961061630 3:123833491-123833513 CTGAGGATAGGGAGAGCAGCAGG - Intronic
961581603 3:127887857-127887879 CTGAGAACCAGGAGGGCAGATGG + Intergenic
962215126 3:133514474-133514496 CTGAGAACAAGGAGACCCGATGG - Intergenic
962389785 3:134961540-134961562 CTGATGACAACCAGAGTGGAGGG - Intronic
962754053 3:138455024-138455046 CAGATGAACAGGTGAGCAGATGG + Intronic
962908803 3:139829129-139829151 CTCAGGAGAAGGAGAGCAGCAGG + Intergenic
963233293 3:142931408-142931430 CTGGTGACAAGGAGGGCCCAGGG - Intergenic
964388450 3:156173977-156173999 CTGAGGACCAGGAGAGCCAATGG - Intronic
965377487 3:167943402-167943424 CTGAGAACCAGGAGAGCTGATGG + Intergenic
965530706 3:169767759-169767781 CATATGACACGGAGAGAAGAGGG + Exonic
965664451 3:171077626-171077648 CTGAGAACCAGGAGAGCTGATGG - Intronic
966432486 3:179846785-179846807 CTGAGGACCAGGAGAGCTGATGG - Intronic
967536165 3:190605695-190605717 GTAAAGACAAGGAGAGAAGATGG - Intronic
968075119 3:195812053-195812075 CTGATGAGAAGCAGAGCAACGGG - Exonic
968454570 4:690419-690441 GTGAGGAGAAGGAGAACAGAAGG - Intergenic
968943640 4:3652400-3652422 CGGAGGGGAAGGAGAGCAGAAGG - Intergenic
969396779 4:6926932-6926954 CTGAGGACAAGGAAACCAGAAGG - Intronic
969872164 4:10111405-10111427 CTGATGGCAGGGGAAGCAGAGGG - Intronic
972662968 4:41134354-41134376 CTGATCACAAGGTCAGGAGATGG + Intronic
973270796 4:48260999-48261021 CTGATGGCAAGGAGAGTCCAAGG + Intronic
973696177 4:53493300-53493322 CTCATGCCAAGTAGAGCAGGTGG - Intronic
974037456 4:56829295-56829317 ATGATGACAAGGGGAGCAGCAGG - Intergenic
974099594 4:57402234-57402256 CTGAGAACCAGGAGAGCTGATGG + Intergenic
974837396 4:67267322-67267344 CAGAGGCCAATGAGAGCAGAAGG + Intergenic
975877699 4:78863613-78863635 GTGATGGCAAGGAGAAAAGAAGG + Intronic
975912955 4:79290451-79290473 CTGATGAGAGAGAGAGCAGAGGG - Intronic
975954195 4:79816882-79816904 CTGACTCCAAGGACAGCAGAAGG + Intergenic
977080376 4:92519766-92519788 CTGAGAATAAGGAGAGCTGATGG + Intronic
977419135 4:96775276-96775298 CGGATGCCAAGGAGAACACAAGG - Intergenic
978754579 4:112287958-112287980 CTGATGAACATGAGAGCAGGTGG + Intronic
978835596 4:113145882-113145904 CGCATGGCAAGAAGAGCAGAGGG - Intronic
980320768 4:131271502-131271524 CTGAAGACAAGCAGAGAAAATGG - Intergenic
981697766 4:147575804-147575826 CTGAGAACCAGGAGAGCTGATGG - Intergenic
982880560 4:160709419-160709441 CTGATGGCCAGGAGAGGACATGG + Intergenic
985051359 4:185995518-185995540 CTGAGAACCAGGAGAGCGGATGG + Intergenic
985124799 4:186682777-186682799 CTGATGACATGGAGAAAAGAAGG - Intronic
986198546 5:5560230-5560252 CGGATGTGAAGCAGAGCAGAGGG - Intergenic
986223012 5:5787411-5787433 AAAATGAAAAGGAGAGCAGAGGG - Intergenic
986830520 5:11572231-11572253 ATGCTTAGAAGGAGAGCAGAGGG - Intronic
986830797 5:11575476-11575498 ATGATGACACAGAGAGTAGAGGG - Intronic
986917264 5:12636645-12636667 AGAATGACAAGGAAAGCAGAGGG + Intergenic
987218406 5:15763936-15763958 CTGAGAACCAGGGGAGCAGATGG + Intronic
988346416 5:30042655-30042677 GTGAAGAGAAGGAGAGAAGAGGG + Intergenic
988398870 5:30734692-30734714 CTGAGAATGAGGAGAGCAGAGGG + Intergenic
989176163 5:38528524-38528546 GTGATGGCAAGGTGAGAAGAGGG - Intronic
989614834 5:43329227-43329249 CTGATGAGAAGGAGAAAAGCTGG + Intergenic
989651445 5:43695563-43695585 CAGATGACTAGGACAGCAGTAGG + Intronic
990332690 5:54743174-54743196 CTAATGACAATGACAGCACAGGG + Intergenic
990568318 5:57052480-57052502 CTGCTTAGAAGGAGAGCTGATGG - Intergenic
990771752 5:59254466-59254488 ATGATGTCAAGCAGAGCAGATGG + Intronic
991197484 5:63953396-63953418 CTGGAGACAAGGAGACCAGATGG - Intergenic
992030240 5:72713718-72713740 CTGAGAACTAGGGGAGCAGATGG - Intergenic
992175008 5:74141360-74141382 CAGATCACAAGGTGAGGAGATGG + Intergenic
992391888 5:76337239-76337261 CTGAAGACACAGAGAGAAGATGG - Intronic
992770402 5:80042135-80042157 CTGAGGACATGGCCAGCAGATGG + Intronic
993140820 5:84031027-84031049 GTGAAGACATGGAGAGAAGATGG - Intronic
994419086 5:99509923-99509945 CTGTTGAGAAATAGAGCAGACGG + Intergenic
994506560 5:100649962-100649984 CAGATCACAAGGACAGGAGATGG + Intergenic
994926305 5:106121127-106121149 CTGGTGACGAGGAGAGCAAAGGG - Intergenic
995635852 5:114189294-114189316 CTGAGAACAAGGAGAGCTGATGG + Intergenic
996313790 5:122138153-122138175 AAGATGAGAAGGGGAGCAGAAGG + Intronic
997425947 5:133802738-133802760 AGGACCACAAGGAGAGCAGAAGG - Intergenic
998484204 5:142487401-142487423 GTGATGAGAAGGAGAGCGGTAGG + Intergenic
998521901 5:142808607-142808629 GTGATAACAAGGAAAGCAGCTGG - Intronic
998545391 5:143023258-143023280 TTGAGGACCAGGAGAGGAGATGG + Intronic
999303813 5:150507324-150507346 AGGATGCCAAGGAGAGCACAAGG - Intronic
999958443 5:156727306-156727328 CTGATAACAAGGGTAGCAGGGGG + Intronic
1000351647 5:160357167-160357189 GAGCTGACAAGGGGAGCAGATGG + Intronic
1002824791 6:763118-763140 CTGAGAACCAGGAGAGCCGATGG - Intergenic
1003058576 6:2844053-2844075 CAGAAGACAAGGAGAGCTGTAGG - Intergenic
1003089251 6:3087760-3087782 CTGATCACAAGGTCAGGAGATGG - Intronic
1003194681 6:3904128-3904150 CTGCCGGCAAGGAGAGCAGAGGG + Intergenic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003670266 6:8150870-8150892 CTGGAGACCAGGAGAGCTGATGG + Intergenic
1003762296 6:9193191-9193213 CTGATGTCAATTAGATCAGATGG - Intergenic
1004256743 6:14071413-14071435 CTTATCACAAGGGAAGCAGATGG + Intergenic
1004329672 6:14710084-14710106 CACATGTCAGGGAGAGCAGATGG - Intergenic
1004860153 6:19795922-19795944 TTGAAGACAAGGTGAACAGAGGG + Intergenic
1005173010 6:23009821-23009843 CTGGAGACCAGGAGAGCTGATGG - Intergenic
1005252150 6:23959542-23959564 CTGTTGACAAGTAGAGAAGATGG - Intergenic
1005687559 6:28269552-28269574 CTGAGAACCAGGAGAGCTGATGG + Intronic
1006786244 6:36669279-36669301 CTGATGGGAGGGGGAGCAGAAGG + Intergenic
1006917494 6:37603923-37603945 CTGATGCCACAGAGAGCACAGGG - Intergenic
1007986400 6:46211428-46211450 CAGATGACATGGAGAGATGAAGG - Intergenic
1008638921 6:53441342-53441364 CTGATGCCAAAGGAAGCAGAGGG + Intergenic
1009749944 6:67869947-67869969 CTGATGAGAAGGAGAGAAATTGG + Intergenic
1009884030 6:69603157-69603179 CTGATTTCTGGGAGAGCAGAGGG + Intergenic
1011457408 6:87566873-87566895 ATGTGGACAAGGAAAGCAGACGG + Intronic
1012842016 6:104341455-104341477 CTGAGAACCAGGAGAGCTGATGG + Intergenic
1012846461 6:104395612-104395634 CTGATAACTAGGAGAGCCAATGG - Intergenic
1014690312 6:124555231-124555253 CTGATGCCAAGCAGAGAACATGG + Intronic
1016117389 6:140303776-140303798 CTGCAGAGAAGGAGAGCAGAGGG - Intergenic
1016811355 6:148264101-148264123 CTGATGAAAGGGAGACCTGAAGG + Intergenic
1017257041 6:152345373-152345395 ATGATGACAAGGGGAGAAAAGGG - Intronic
1018888535 6:167963028-167963050 TTGATGGTAAAGAGAGCAGATGG + Exonic
1019139225 6:169933247-169933269 CAGAGGACAAGGAGAGCTCAGGG - Intergenic
1019635641 7:2074287-2074309 CTGAGGTCACCGAGAGCAGAAGG + Intronic
1021424134 7:20480402-20480424 CTGATAACCAGGAGAGCCAATGG - Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1021874579 7:25036636-25036658 GAGAGGGCAAGGAGAGCAGAGGG + Intergenic
1022383271 7:29880650-29880672 CTGGTGACAAGCAGACCAGTAGG - Intronic
1023380763 7:39605597-39605619 CTGAGAACCAGGAGAGCTGATGG - Intronic
1024386435 7:48757191-48757213 CTGAGGACCAAGAGAGCTGATGG - Intergenic
1024741595 7:52360854-52360876 CAGATGAGAAGGAGAGAAGGTGG - Intergenic
1024875136 7:54013570-54013592 CAGGTGAGCAGGAGAGCAGATGG + Intergenic
1026203996 7:68239617-68239639 CTGATAACAGGGGGAGAAGATGG + Intergenic
1026571865 7:71538388-71538410 CTGAAGACAAGAAGTGCAGGGGG - Intronic
1026600257 7:71771735-71771757 CTGAGAACCAGGAGAGCTGATGG - Intergenic
1026634304 7:72067815-72067837 CAGATGAAGAGGACAGCAGAAGG - Intronic
1027000336 7:74648587-74648609 CAGATCACAAGGTCAGCAGATGG - Intergenic
1028127582 7:87131384-87131406 CTGAGAACCAGGAGAGCAGATGG - Intergenic
1028246189 7:88480487-88480509 CCGAGAACCAGGAGAGCAGATGG - Intergenic
1029144767 7:98438017-98438039 CTGATGACAAGCTGAGAGGAAGG + Intergenic
1029853069 7:103484762-103484784 CTGAGGACATGGAGAGGACATGG + Intronic
1030004312 7:105100646-105100668 GTGAAGACAGGAAGAGCAGAAGG + Intronic
1030470538 7:109957663-109957685 CTGGTGGCCAGAAGAGCAGACGG - Intergenic
1030924223 7:115431275-115431297 GTGAAGACAAGAAGAGAAGATGG + Intergenic
1031105559 7:117537921-117537943 GTGATGACAAGGATATCAGAGGG + Intronic
1031869240 7:127074380-127074402 CAAAGGACAAGGACAGCAGAGGG + Intronic
1032851313 7:135797957-135797979 CTGACTGCAAGGAGAGCACATGG - Intergenic
1032862899 7:135898448-135898470 CTGAGAACAAGGGGAGCAGATGG + Intergenic
1033172441 7:139095956-139095978 CTGAGAAAAAGGAGAGTAGATGG + Intronic
1033335605 7:140449635-140449657 ACGATGACAAGGAGGGCACACGG + Intergenic
1033845932 7:145432151-145432173 CTGAGGAGAAGGAGAGATGAGGG + Intergenic
1035340874 7:158160381-158160403 CTGATGTCCAGGGCAGCAGAAGG - Intronic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1035786939 8:2269092-2269114 CTGAAAACAATAAGAGCAGAGGG - Intergenic
1035805868 8:2452624-2452646 CTGAAAACAATAAGAGCAGAGGG + Intergenic
1036295472 8:7531804-7531826 CTGATGACAAAGATAGAACAAGG - Intergenic
1036327097 8:7789215-7789237 CTGATGACAAAGATAGAACAAGG + Intergenic
1036561605 8:9903998-9904020 CGAAGGACAAGGAGAGCAGCGGG + Intergenic
1036960659 8:13241422-13241444 CTGAGGAAAAGGAAACCAGAGGG - Intronic
1038524494 8:28261424-28261446 GTGAAGACATGGAGAGAAGACGG + Intergenic
1039382777 8:37101342-37101364 CTGATGAAAAGGAGAGAACGTGG + Intergenic
1039777623 8:40752324-40752346 CTGATGACAAGAGGAGTAGGGGG - Intronic
1042285830 8:67109291-67109313 CACATGACAAGAACAGCAGATGG - Intronic
1042336414 8:67634439-67634461 CTGATCACAAGGTCAGGAGATGG - Intronic
1042756445 8:72218740-72218762 CTGATGAGAATTATAGCAGAAGG - Intergenic
1043376600 8:79656636-79656658 CTCATAACATGGACAGCAGAGGG + Intronic
1043823476 8:84896694-84896716 GTGGGGACAAGGAGAACAGAGGG + Intronic
1046013688 8:108580539-108580561 CTGAGAACTAGGAGAGCAAATGG + Intergenic
1046277655 8:111984717-111984739 CATATCACAAGAAGAGCAGAGGG + Intergenic
1046358990 8:113125810-113125832 CTGATGAGAAGGAGAGGAAAAGG + Intronic
1046366534 8:113239163-113239185 CTGATAACCATGAGAGCTGATGG - Intronic
1046795147 8:118363566-118363588 TTGAGGACCAGGAGAGCAGATGG - Intronic
1047084963 8:121506121-121506143 CAGATCACAAGGACAGGAGATGG - Intergenic
1048533245 8:135269924-135269946 CCAATGACACCGAGAGCAGAGGG + Intergenic
1049538317 8:143193403-143193425 CTAATTACAAGGAGAACAAATGG + Intergenic
1049700954 8:144012314-144012336 CTGGTGGCATGGAGAGCTGAGGG + Intronic
1050052459 9:1617364-1617386 CTAATGATAAAGAGAGGAGAGGG - Intergenic
1050354237 9:4768315-4768337 CTGAGAACCAGGAGAGCTGATGG - Intergenic
1050860649 9:10425450-10425472 CTGATGATAAATAGAGCACAGGG - Intronic
1051019548 9:12525729-12525751 CTGGTGACCAGGAGGGCAGGTGG - Intergenic
1051439214 9:17066199-17066221 CATTTGACAAGGAGAGAAGAAGG + Intergenic
1051652468 9:19342352-19342374 GTGATGAGAAGGAGAACTGAAGG + Intronic
1051860649 9:21621992-21622014 CTGAAAACCAGGAGAGCTGATGG - Intergenic
1052251899 9:26408457-26408479 CTTGAGACAAGGAGAACAGATGG - Intergenic
1054878447 9:70120913-70120935 CTGCTGCCATGGTGAGCAGACGG - Intronic
1055486263 9:76759456-76759478 CAGATGAGCAGAAGAGCAGAGGG + Intronic
1056507592 9:87271614-87271636 CTGAAGACACGGAGTGAAGAAGG - Intergenic
1056672533 9:88642743-88642765 AGGAGGACAAGGAGAGGAGAAGG - Intergenic
1057908543 9:99000941-99000963 CTGAAGAAAAGGTGAGTAGATGG + Exonic
1058351306 9:104027972-104027994 CTGATGACATTGAGAGCATCAGG - Intergenic
1058545191 9:106053686-106053708 CTGCCGACAAGAAGAGCACAAGG - Intergenic
1059850924 9:118338448-118338470 CAGAAGACAAGGAGAGAAAATGG - Intergenic
1060146263 9:121255169-121255191 CAGATCACAAGGTGAGGAGATGG - Intronic
1185521284 X:741717-741739 CTGAGGCCCAGGAGAGCCGAGGG - Intergenic
1185635047 X:1546149-1546171 CTGAGACCCAGGAGAGCAGAGGG + Intergenic
1186346013 X:8693943-8693965 CAGATGACAAGGGCAGGAGATGG - Intronic
1186495386 X:10008854-10008876 CTGAAAACCAGGAGAGCTGATGG - Intergenic
1186519633 X:10193986-10194008 CTGATGGCAAGGAGAGGAAGAGG + Intronic
1186878132 X:13837567-13837589 ATGATGATAAAGAGAGGAGAAGG - Intronic
1187985272 X:24803279-24803301 CTGGAGAGAAGGAGAGCACACGG + Intronic
1188253500 X:27929477-27929499 CTGATTACAAGGACAGCAGTAGG + Intergenic
1189579640 X:42392480-42392502 CTGAGAACAAGGAGCGCTGAGGG + Intergenic
1190260341 X:48793323-48793345 ATGAAGACAGGGAAAGCAGAGGG - Intronic
1192261309 X:69507119-69507141 CAGATGACAAGGAGACCAGGAGG + Intronic
1192573114 X:72222333-72222355 CTGATGAAAAGGAGAGCATCTGG + Intronic
1193479952 X:82015232-82015254 CTGAGAACCAGGAGAGCAAATGG - Intergenic
1194161681 X:90460886-90460908 CACATGACAAGGAGTACAGACGG - Intergenic
1194634896 X:96333326-96333348 CTGAGAACCAGGAGAGCTGATGG + Intergenic
1195593243 X:106656666-106656688 CTGATGACCAGGAGCTCTGACGG - Intronic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198557727 X:137813545-137813567 CTGATTACAGGGAGAACAGAGGG - Intergenic
1198639544 X:138741590-138741612 CTGATGACGAGGAGAATAGGGGG - Intronic
1198887364 X:141354239-141354261 ATGATGACAATGAGAACACATGG + Intergenic
1199461511 X:148090595-148090617 CTGAGAACAAGGAGAGCCAATGG - Intergenic
1200218069 X:154377417-154377439 CTGGTGACAAGGGAAGAAGAGGG - Intergenic
1200507964 Y:4038619-4038641 CACATGACAAGGAGTACAGACGG - Intergenic
1201677581 Y:16604373-16604395 CTGAGGCCAATGAGAGCTGATGG - Intergenic