ID: 1167868970

View in Genome Browser
Species Human (GRCh38)
Location 19:52351658-52351680
Sequence CCTGCTCTGCAGCCTGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 585
Summary {0: 1, 1: 2, 2: 2, 3: 47, 4: 533}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167868963_1167868970 27 Left 1167868963 19:52351608-52351630 CCTCACTGAAGAGGGTGGCCAGG 0: 1
1: 0
2: 1
3: 34
4: 227
Right 1167868970 19:52351658-52351680 CCTGCTCTGCAGCCTGTGTGAGG 0: 1
1: 2
2: 2
3: 47
4: 533
1167868962_1167868970 30 Left 1167868962 19:52351605-52351627 CCTCCTCACTGAAGAGGGTGGCC 0: 1
1: 0
2: 2
3: 16
4: 157
Right 1167868970 19:52351658-52351680 CCTGCTCTGCAGCCTGTGTGAGG 0: 1
1: 2
2: 2
3: 47
4: 533
1167868966_1167868970 9 Left 1167868966 19:52351626-52351648 CCAGGTTCTGCTCAGGAGCTTCC 0: 1
1: 0
2: 0
3: 20
4: 239
Right 1167868970 19:52351658-52351680 CCTGCTCTGCAGCCTGTGTGAGG 0: 1
1: 2
2: 2
3: 47
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167868970 Original CRISPR CCTGCTCTGCAGCCTGTGTG AGG Intronic
900021388 1:188469-188491 CTTGCTCTGGATCCTGTGCGGGG + Intergenic
900176772 1:1294614-1294636 CCGACTCTGCACCCTCTGTGGGG + Exonic
900277663 1:1842390-1842412 CCTGCACTCCAGCCTGGGCGGGG + Intronic
901037268 1:6343853-6343875 CCTGCTCTGCAGCTGGTTTCTGG + Intronic
901233859 1:7656985-7657007 CCTGCAGCGCGGCCTGTGTGAGG - Intronic
901460804 1:9390392-9390414 ACTGCCCTCCAGCCTGAGTGGGG + Intergenic
901693822 1:10991668-10991690 GCTGCTCTTCTGCCTGAGTGAGG - Intergenic
901791565 1:11655928-11655950 CCTGGTCTGCAGCCTCTGGCGGG + Exonic
901793798 1:11668772-11668794 CCTGGTCTGCAGCCTCTGGCGGG + Exonic
902040050 1:13485974-13485996 ACTGCACTCCAGCCTGGGTGAGG - Intronic
902167442 1:14583988-14584010 CCTGACCTGCAGCCTGGGCGGGG - Intergenic
902446018 1:16464968-16464990 CCTTGACTGCAGCCTGTGAGAGG - Intergenic
902728317 1:18351903-18351925 CCTGCCCCGCAGCCTGTGGGTGG - Intronic
902983571 1:20142129-20142151 CCTGCTCCCCAGCCTGAATGAGG - Intronic
903021718 1:20399768-20399790 CCTGCTCTGCACAATGTATGAGG + Intergenic
903341995 1:22660535-22660557 CCTCCTCCCCAGCTTGTGTGGGG - Intronic
903444497 1:23413172-23413194 ACTGCACTCCAGCCTGGGTGAGG - Intronic
903500084 1:23795887-23795909 CCTGCTCTCCAGCCTCTGGCAGG - Exonic
903596967 1:24502675-24502697 CCTGGTCCCCAGCCTGTGGGGGG - Intronic
905515974 1:38562288-38562310 ACTGCACTCCAGCCTGGGTGAGG + Intergenic
905650135 1:39650798-39650820 CCTGCTCTGCAGACACTTTGAGG + Intergenic
905947544 1:41916763-41916785 CCTGCTGAGCAGCCAGTGTAGGG - Intronic
906674592 1:47684061-47684083 CCTGCCCTGCAGCCTCTCAGAGG - Intergenic
907279919 1:53340616-53340638 CCGGCTCTGCAGTGTGTGTATGG - Intergenic
907818617 1:57944875-57944897 CTTGCTCTGCTTCCTGTGTGAGG - Intronic
908240781 1:62187443-62187465 ACTGCACTCCAGCCTGGGTGAGG - Intergenic
908823845 1:68115025-68115047 GCTGGTCTGCAGCCACTGTGTGG + Intronic
911219351 1:95230961-95230983 CGGGCTCTGCAGGCTGAGTGTGG - Exonic
911688911 1:100808968-100808990 ACTGCACTCCAGCCTGGGTGAGG + Intergenic
912616887 1:111110753-111110775 CCTGCTATGCTGCCTGAGTCTGG + Intergenic
912904534 1:113690013-113690035 CCTGCTGTTCAGCGTGGGTGTGG + Intergenic
913110582 1:115654056-115654078 CCTGCTCTCATGCCTGTGGGGGG - Intronic
914200832 1:145483811-145483833 ACTGCACTCCAGCCTGGGTGAGG + Intergenic
914479945 1:148056939-148056961 ACTGCACTCCAGCCTGGGTGAGG + Intergenic
915164460 1:153940915-153940937 CCTGCTCACCAGCGTCTGTGAGG - Exonic
916782431 1:168049691-168049713 ACTGCACTCCAGCCTGGGTGAGG - Intronic
916782990 1:168056368-168056390 CCTGCTCTGCACCCTGCGCGCGG - Intronic
917032908 1:170714619-170714641 TCTGCTCTGCATCCTGTGGGAGG - Intronic
917114246 1:171586098-171586120 ACTGCACTCCAGCCTGGGTGAGG - Intronic
918419589 1:184350908-184350930 CTTGCTCTGCTCCCTGTGTTTGG + Intergenic
918901993 1:190434154-190434176 ACTGCACTTCAGCCTGGGTGAGG - Intronic
919248929 1:195028243-195028265 ACTGCGCTCCAGCCTGGGTGAGG - Intergenic
919738788 1:200970307-200970329 CCAGCCCTGCTGCCTGTCTGGGG - Intronic
920494503 1:206445170-206445192 ACAGCTCTGCAGGCTGTGTTGGG + Intronic
920733296 1:208508869-208508891 CTTGCACTCCAGCCTGGGTGAGG - Intergenic
920951575 1:210576013-210576035 GCTTCTCTGCAGCCAGTGTTAGG + Intronic
922996092 1:229962726-229962748 CCTTCCCTCCAGCCTGTGGGTGG - Intergenic
923103565 1:230836977-230836999 CCTGCTTTGCAGTCTTGGTGCGG - Intergenic
923109767 1:230881485-230881507 CCTGCTCTGCCACCTGTGAGTGG - Intergenic
923258199 1:232240496-232240518 CTTCCTCTCCAGCCTGTGGGGGG - Intergenic
923332291 1:232936284-232936306 CCTACTCTGCAGATTTTGTGTGG + Intergenic
923353809 1:233133820-233133842 ACTGCACTCCAGCCTGTGAGTGG + Intronic
924793342 1:247273017-247273039 CAAACTCTGCAGCCTGGGTGTGG + Intergenic
1063039355 10:2321105-2321127 GCTGCACTCCAGCCTGGGTGAGG - Intergenic
1063086718 10:2825964-2825986 CCTGCTCTGCTGCCTGGTTCTGG + Intergenic
1063488381 10:6440948-6440970 ACTGCACTGCAGCCTGGGTGAGG + Intronic
1064280155 10:13944145-13944167 CCTGCTGTGCAGCCAGTCTGTGG - Intronic
1064632987 10:17336629-17336651 ACTGCACTTCAGCCTGGGTGAGG - Intronic
1066989215 10:42496505-42496527 GCTGCTCTGCAACCTGTCAGAGG + Intergenic
1067190378 10:44063409-44063431 CTTGCCCTGCACCCTGTCTGGGG - Intergenic
1067222723 10:44355683-44355705 CCAGCCCTGCAGCCTGGGTGGGG - Intergenic
1067699000 10:48555423-48555445 CCAGCTCTGCAGCCCTGGTGGGG - Intronic
1067737544 10:48870008-48870030 CGTGCTCTGCTTCCTCTGTGTGG + Intronic
1067764395 10:49074404-49074426 CCAGCTCTGCTGCTGGTGTGAGG - Intronic
1067837673 10:49651618-49651640 CCTGCTCTGGAGAGTGGGTGGGG - Intronic
1069199547 10:65595557-65595579 ACTGCACTCCAGCCTGGGTGAGG + Intergenic
1070823736 10:79379217-79379239 CCTCCTGTGCAGCCTGTGCCCGG - Intergenic
1070852746 10:79580995-79581017 ACTGCACTCCAGCCTGGGTGTGG + Intergenic
1071030896 10:81179937-81179959 GCTGCTCTGCAGCCTTTGAAAGG - Intergenic
1075715155 10:124551444-124551466 CCTGCTCTGCAGGGTGGGGGCGG + Intronic
1075931179 10:126297510-126297532 ACTGCACTCCAGCCTGGGTGAGG + Intronic
1075944587 10:126421431-126421453 CCTGCTCTCCTGCCTGAGTGGGG + Intergenic
1076119209 10:127922403-127922425 CCTGCTCTGGAGACTCCGTGGGG + Intronic
1076259693 10:129055475-129055497 CCTGCTCTGCAATCCCTGTGAGG + Intergenic
1076267366 10:129119203-129119225 ACTGCACTGCAGCCTGTGTGAGG + Intergenic
1076482417 10:130793187-130793209 CCTGCACTGCAGACTGTGCAGGG - Intergenic
1076525238 10:131108555-131108577 ACTGGTCAGCCGCCTGTGTGAGG - Intronic
1076759508 10:132594821-132594843 CCAGCCCTGCAGGCTGTATGAGG + Intronic
1077242924 11:1520503-1520525 CCTGGGCTGCAGCCTGAGAGGGG - Intergenic
1077468123 11:2743365-2743387 CCTGCTCTGAGGCCTGTGCCAGG - Intronic
1077525471 11:3061702-3061724 ACTGCACTCCAGCCTGGGTGAGG - Intergenic
1077910906 11:6570688-6570710 CCGGCTCTGCGGACTGAGTGAGG + Exonic
1078107796 11:8369602-8369624 CCGCCTCTGCAGCCAGTGGGAGG + Intergenic
1078337049 11:10472964-10472986 ACTGCTCTCCAGCCTGGCTGAGG + Intronic
1080403665 11:31959496-31959518 CCAGCTCTGCAGTCTCTGAGCGG + Intronic
1080568168 11:33531434-33531456 ACTGCACTCCAGCCTGTGCGAGG + Intergenic
1081980022 11:47260461-47260483 CGAGCTATGCAGCGTGTGTGGGG + Exonic
1082798196 11:57393907-57393929 CCTGTTCTGCAGCCTGACTTTGG + Intronic
1083199920 11:61114601-61114623 ACTGCACTCCAGCCTGGGTGAGG + Intronic
1083204131 11:61137819-61137841 CCTGCTCTACTGCCTAAGTGAGG - Intronic
1083377902 11:62241244-62241266 CCTGCTGTGATGCCTTTGTGTGG - Intergenic
1083437794 11:62654653-62654675 ACTGCACTCCAGCCTGGGTGAGG - Intronic
1083769050 11:64856226-64856248 CCTGCTCTGCTGCGTGGGAGGGG - Intronic
1084274692 11:68045252-68045274 TGGGCTCTGCAGCCAGTGTGAGG + Intronic
1084293551 11:68194226-68194248 ACTGCACTCCAGCCTGGGTGAGG - Intronic
1084674593 11:70626790-70626812 CCAGCTCTGCCTCCTGTGGGTGG - Intronic
1084683467 11:70680380-70680402 CCTCCTCTGGAGCCTGGGTGGGG - Intronic
1085025905 11:73236523-73236545 CCTGGGATGCATCCTGTGTGTGG - Intergenic
1085278052 11:75312503-75312525 ACTGCTCTGCAAGGTGTGTGTGG + Intronic
1085628632 11:78093650-78093672 ACTGCACTCCAGCCTGGGTGAGG + Intergenic
1085702550 11:78757793-78757815 CCTGCTCTGCTTTCTGTGAGAGG + Intronic
1086558146 11:88136181-88136203 GCTCCTCTGTAGCCTGTCTGTGG - Intronic
1086739725 11:90352378-90352400 CTTGGTGTGCAGCCTGTGTATGG + Intergenic
1086950569 11:92886450-92886472 CATGTTCTGCACCCTGTGTCAGG - Intronic
1087269073 11:96092769-96092791 CTTGCTCCGGAGCCTGTCTGAGG + Exonic
1088492035 11:110397816-110397838 GCTGCTCTGCAACCTGTCAGAGG + Intergenic
1090862566 11:130666885-130666907 CCTCTCTTGCAGCCTGTGTGTGG + Intergenic
1090973017 11:131659085-131659107 CCTGCTCTGGACCCTGAGGGAGG - Intronic
1091791322 12:3273773-3273795 CCTGCCCTCCTGCCTGTGCGGGG + Intronic
1091935989 12:4434908-4434930 TCTTTTCTGCAGACTGTGTGTGG + Intronic
1092154757 12:6274850-6274872 CCTGCTCTGCAGCCCCTCTCAGG + Intergenic
1092763496 12:11830610-11830632 CCAGCTCTGCAGTCTGTGATTGG - Intronic
1095253083 12:40000952-40000974 AATGCATTGCAGCCTGTGTGTGG - Intronic
1095591225 12:43906423-43906445 ACTGCTCTTCAGCCTGGGTGAGG + Intronic
1095626368 12:44319242-44319264 CCTGCTCTCCATCCTGAGTCTGG + Intronic
1096125692 12:49117937-49117959 ACTGCACTCCAGCCTATGTGTGG - Intergenic
1098573432 12:72014426-72014448 ACTGCACTCCAGCCTGGGTGAGG - Intronic
1098577806 12:72063602-72063624 CTGGCTCTGCAGACTGGGTGCGG - Intronic
1099550948 12:84043076-84043098 CCTGTTCTGCAGCCTCTGCTGGG - Intergenic
1099663801 12:85599711-85599733 ACTGCACTCCAGCCTGGGTGAGG + Intergenic
1100315251 12:93439439-93439461 ACTGCACTGCAGCCTGGGAGCGG + Intronic
1101031430 12:100664542-100664564 ACTGCACTCCAGCCTGGGTGAGG - Intergenic
1101469900 12:104986495-104986517 CCTCCTCTGCCGCACGTGTGCGG - Intronic
1101598322 12:106187365-106187387 GCTGCTGTCCTGCCTGTGTGAGG - Intergenic
1101909034 12:108849040-108849062 CCTACTCTGCCGCCTTTCTGGGG - Intronic
1102227069 12:111236254-111236276 CTTGGTCTGCAGCGTGTTTGAGG - Intronic
1102727648 12:115079653-115079675 CCTGCTCTCCAGCCTCTCTTAGG - Intergenic
1102747626 12:115263485-115263507 CCTGTTCTCCTGTCTGTGTGAGG + Intergenic
1103628192 12:122236854-122236876 CTTGCTCTGAAGTCTGTGTATGG + Intronic
1103865095 12:124045279-124045301 TTTGCTCTGGAGCCTGGGTGGGG + Intronic
1104032885 12:125078139-125078161 CCTGCTCTGTAGCCTGGGCAGGG - Intronic
1104238808 12:126966645-126966667 CCTGCCCTGATGCCTGGGTGTGG + Intergenic
1104387907 12:128366618-128366640 TCTTCCCTGCTGCCTGTGTGAGG - Intronic
1104391188 12:128391792-128391814 CCTGGTCTAAAGTCTGTGTGGGG - Intronic
1104410569 12:128554292-128554314 CATGCCCTGCAGGCTGTGAGAGG + Intronic
1104734530 12:131128839-131128861 CCTGCCCTGCTGTCTGGGTGTGG + Intronic
1104944470 12:132409502-132409524 CCTTTGCTGCAGCCTGTGGGGGG + Intergenic
1104999264 12:132678683-132678705 CCTGCTCTTCAGCCTGCATGAGG - Intronic
1105356149 13:19661817-19661839 CCTTCTCTGCAGCATGAATGAGG - Exonic
1107589643 13:41889414-41889436 ACTGCACTCCAGCCTGGGTGAGG - Intronic
1107654685 13:42579369-42579391 ACTGCACTCCAGCCTGGGTGGGG + Intronic
1107950622 13:45458334-45458356 TCTACTCTGCAGTCTGGGTGAGG - Intergenic
1108673112 13:52711581-52711603 GCTCCTCTCCAGCCTGGGTGAGG - Intronic
1109309883 13:60680107-60680129 CCTGAACAGCAGCCTCTGTGAGG + Intergenic
1110639143 13:77801974-77801996 CCTGCACTGCATGCTGTATGAGG - Intergenic
1111261712 13:85749169-85749191 CCTACTCTTCATCATGTGTGTGG - Intergenic
1111397993 13:87692761-87692783 ACTGCACTCCAGCCTGGGTGAGG + Exonic
1112340684 13:98550489-98550511 ACTGCACTCCAGCCTGGGTGAGG + Intronic
1113413312 13:110109053-110109075 CCTGCTCTGCCTGCTTTGTGTGG + Intergenic
1113595330 13:111527750-111527772 CCAGCCCTGGAGCCTGTGTTTGG + Intergenic
1113718548 13:112533451-112533473 CCTGCTGTGCTGTCTGTCTGTGG - Intronic
1113764741 13:112874281-112874303 CCTGCTCTGCAGCCTGGTCCGGG - Intronic
1115212541 14:30982058-30982080 ACTGCACTCCAGCCTGGGTGAGG + Intronic
1115712361 14:36064949-36064971 ACTGCTTTGCTGCCTCTGTGGGG - Intergenic
1116085399 14:40231014-40231036 CCTGCTCTCCAAGCTGTGGGTGG - Intergenic
1117132197 14:52697123-52697145 ACTGCACTCCAGCCTGGGTGAGG - Intergenic
1117250608 14:53933666-53933688 ACTGCACTCCAGCCTGGGTGTGG + Intergenic
1118730294 14:68661255-68661277 CCTGTTCTGCAGTGTGTTTGTGG - Intronic
1120094822 14:80376503-80376525 CAGGCTCTGAAGCATGTGTGAGG - Intronic
1120170977 14:81247175-81247197 ACTGCTCTGCTGCCTGGGTTGGG + Intergenic
1120401009 14:84031489-84031511 ACTGCACTCCAGCCTGAGTGAGG + Intergenic
1122771114 14:104098418-104098440 CCTGCTCAGGAGCCCGTGTGGGG - Intronic
1122790173 14:104181037-104181059 CCTGCCTTGCAGCCCCTGTGGGG + Intergenic
1122996186 14:105266031-105266053 ACTGCACTCCAGCCTGGGTGAGG + Intronic
1123040532 14:105488459-105488481 CCTTCTCTGCAGGCTTTGGGCGG + Exonic
1124624714 15:31301255-31301277 GCTCCCCTGCAGCCTGTGTGGGG + Intergenic
1124906028 15:33869270-33869292 ACTGCTCTACAGCATGGGTGGGG + Intronic
1125469894 15:39992632-39992654 CATGCTCTGCTTCCTGTGAGTGG + Intronic
1125479327 15:40069605-40069627 CCCGCTCTGCACCCAGTCTGTGG - Intergenic
1125662428 15:41404745-41404767 ACTGCACTCCAGCCTGGGTGAGG - Intergenic
1125721976 15:41849562-41849584 CCTGCTCGGCTGCTTGTGGGAGG - Intronic
1126323633 15:47451064-47451086 CCTGCTTTGCAGCGAATGTGAGG + Intronic
1126462341 15:48927312-48927334 CCTGCTCTCCAGCCTGTGTGGGG - Intronic
1126724627 15:51619836-51619858 CCTGCTCTGGAGAGGGTGTGTGG - Intronic
1127492161 15:59475180-59475202 ACTGCACTCCAGCCTGGGTGAGG - Intronic
1128542399 15:68545127-68545149 CCTGCCCTGCAGCCTTCATGTGG - Intergenic
1128681323 15:69654077-69654099 CCTGCTCTGCAGTCCTTGAGTGG + Intergenic
1128927904 15:71675534-71675556 CATGGTGTGCAGCCCGTGTGGGG + Intronic
1128928352 15:71679772-71679794 TCTGCTCTGCAGACAGTTTGGGG + Intronic
1129443952 15:75603084-75603106 ACTGCACTCCAGCCTGGGTGAGG - Intronic
1131042394 15:89282874-89282896 CCTGCTCTCAAGTCTATGTGAGG - Intronic
1131121486 15:89825754-89825776 CCTGCTCTGAAAACTCTGTGGGG + Intergenic
1131834009 15:96372342-96372364 CCTGTTTTGCTGCCTGTTTGGGG + Intergenic
1131861911 15:96662764-96662786 CCAGCTCAGCTGCCTGTCTGTGG + Intergenic
1132067610 15:98744950-98744972 CCTGTTCTGCTGCCTCTGAGAGG + Intronic
1132679860 16:1135246-1135268 CCTGCCCAGCCGTCTGTGTGTGG - Intergenic
1132934243 16:2472940-2472962 CCTGGTCAGAAGCCTGTCTGGGG - Intronic
1133353295 16:5117292-5117314 CCTTCCAGGCAGCCTGTGTGGGG - Intergenic
1133521756 16:6565091-6565113 ACTGCACTCCAGCCTGGGTGGGG + Intronic
1133737444 16:8626800-8626822 ACTGCACTCCAGCCTGGGTGAGG - Intronic
1134452774 16:14373611-14373633 CTTGCTCTGCTGCCCGTGTTGGG - Intergenic
1135047127 16:19165178-19165200 TCTGCCCTGCAGGGTGTGTGTGG - Intronic
1135192617 16:20367313-20367335 CTTGCTGTGCAGCCTCTGTCTGG + Intronic
1135200368 16:20431905-20431927 ACTGCCCTCCAGCCTGGGTGAGG + Intronic
1138221177 16:55251590-55251612 CCTTCACTGCAGCCTTTGAGAGG + Intergenic
1138501519 16:57447746-57447768 CCTGCTCCGCTGTCTGTGAGGGG + Intronic
1140064604 16:71600316-71600338 ACTGCACTCCAGCCTGAGTGAGG + Intergenic
1140861477 16:79022281-79022303 CTCGCTCTGATGCCTGTGTGGGG + Intronic
1141086032 16:81096224-81096246 CCTGCTCTGCACCCTGCGCGCGG - Exonic
1141788316 16:86216437-86216459 CCTGCTCAGCTTCCTGTGAGTGG - Intergenic
1141916370 16:87099962-87099984 CATGCTCTGGAGCCTGTGTGTGG - Intronic
1142336733 16:89494173-89494195 CCTGATCTGGAGCCCCTGTGGGG + Intronic
1142363486 16:89638060-89638082 CCTCCTCGGGAGCCTGTGTGAGG - Exonic
1142998592 17:3776429-3776451 CCTTCTCTGCAGTCAGCGTGGGG - Intronic
1144004352 17:11086757-11086779 CCTCCTGTTCAGCCTCTGTGGGG + Intergenic
1144546101 17:16197281-16197303 ACTGCACTCCAGCCTGGGTGAGG + Intronic
1144729353 17:17517771-17517793 CCTGCTGCCCAGCCTGTGAGTGG + Intronic
1145300293 17:21630008-21630030 ACTGCACTCCAGCCTGGGTGAGG - Intergenic
1145349989 17:22073231-22073253 ACTGCACTCCAGCCTGGGTGAGG + Intergenic
1145901768 17:28494528-28494550 CCCCCTCCTCAGCCTGTGTGAGG + Intronic
1146774097 17:35596841-35596863 CCTGCTGGGCGGCCTGTGTGCGG - Intronic
1147156597 17:38547286-38547308 GCTGCTCTGCTGCCTGTGCCGGG - Intronic
1147583429 17:41639183-41639205 TCTGCCCTGCAGCCTGGCTGAGG + Intergenic
1147855509 17:43476644-43476666 CCTACTCTGAAGCCTTTGTAGGG - Intergenic
1147989616 17:44324766-44324788 CCGGCTCCGCCGCCTGTGCGCGG + Exonic
1148027563 17:44599300-44599322 CCTGTTCTGCAGCCTGTTCTGGG - Intergenic
1148218410 17:45846430-45846452 CCTGCTCACCAGCCTGGCTGTGG + Exonic
1148499898 17:48082166-48082188 ACTGCACTCCAGCCTGGGTGAGG + Intronic
1148683154 17:49486176-49486198 CCTGCTCTGCACTCCGAGTGGGG - Intergenic
1148686981 17:49506582-49506604 CCTGCCCTGCACCGTGTGCGAGG + Exonic
1149076531 17:52602066-52602088 CCTGCTATGCAGCCTGTCCATGG + Intergenic
1149481175 17:57004276-57004298 GCTGCTCTGGAGGCTGAGTGAGG + Intronic
1149730416 17:58940746-58940768 ACTGCACTCCAGCCTGGGTGGGG - Intronic
1149991262 17:61384848-61384870 CCAGCTCTGAAGCCTGAGGGAGG + Intronic
1150697688 17:67419866-67419888 GCTGCACTCCAGCCTGAGTGAGG + Intronic
1150929479 17:69569472-69569494 ACTGCACTCCAGCCTGGGTGAGG - Intergenic
1151192698 17:72410213-72410235 ACTGCACTCCAGCCTGGGTGAGG - Intergenic
1152163419 17:78684068-78684090 CATGCTCTTCAGCCTGGGAGTGG + Intronic
1152616058 17:81338437-81338459 CTTGCTCTGAGGTCTGTGTGTGG + Intergenic
1152762487 17:82116341-82116363 CCTGCCATGCACCCTGTGGGTGG - Intronic
1152826059 17:82465603-82465625 ACTGCACTCCAGCCTGGGTGAGG - Intronic
1152973142 18:185195-185217 ACTGCACTGCAGCCTGGGTGAGG - Intronic
1153198395 18:2625358-2625380 TCTCCTCTGCAGGCTGTGGGAGG + Intergenic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1155024787 18:21931217-21931239 GCTGTTCTGCAGCCTGCCTGGGG + Intergenic
1156459679 18:37314713-37314735 CCTCCCCTGCAGCTTGTGGGGGG + Intronic
1157285489 18:46374568-46374590 CCTGTGCTGCACCCTGTGTCAGG + Intronic
1157406463 18:47426025-47426047 CCATCTTTGCAGTCTGTGTGAGG + Intergenic
1157700200 18:49757470-49757492 AATGCACTGCAGTCTGTGTGAGG + Intergenic
1157959947 18:52142378-52142400 GCTCCTCTCCAGCCTGGGTGAGG - Intergenic
1158429926 18:57376003-57376025 CCTCCTCTGCTGCCAGTTTGGGG + Intergenic
1158619479 18:59019806-59019828 CCTGCTCCGCATCTTGAGTGTGG + Intergenic
1159047946 18:63387399-63387421 ACTGCACTCCAGCCTGGGTGAGG - Intergenic
1159295049 18:66474271-66474293 CCTTCTCTTCACCCTGTCTGAGG - Intergenic
1159393940 18:67831499-67831521 TCTGCTCTGCATCCTGTGTTTGG - Intergenic
1160194568 18:76741843-76741865 ACTGCACTCCAGCCTGGGTGAGG + Intergenic
1160456570 18:79006266-79006288 CGGGCTCTGCAGCCAGAGTGAGG - Intergenic
1160461860 18:79045310-79045332 CCTTCTCTGCAACCTGTGGTCGG - Intergenic
1160462290 18:79048328-79048350 CCTTCTCTGCAGCCTATGGTGGG - Intergenic
1160834205 19:1116960-1116982 CCTGCTGTGGGGCCTCTGTGGGG + Intronic
1161034341 19:2076083-2076105 ACTGCACTCCAGCCTGGGTGAGG + Intronic
1161092578 19:2369460-2369482 ACTACACTGCAGCCTGGGTGAGG - Intergenic
1161192881 19:2969017-2969039 ACTGCACTCCAGCCTGGGTGAGG - Intergenic
1161237419 19:3204853-3204875 CCTTCCTCGCAGCCTGTGTGTGG - Intronic
1161455364 19:4367156-4367178 CCTGCTCTGCAGGCAGCGTGTGG - Intronic
1161560969 19:4972224-4972246 CCAACTCTGAAGCCTGTGTGGGG - Intronic
1162035779 19:7937978-7938000 ACTACTCTCCAGCCTGGGTGAGG + Intronic
1162385649 19:10359156-10359178 CCTGGTGTGTGGCCTGTGTGTGG - Exonic
1162676048 19:12299114-12299136 CATGCTCTGGGGCCTGAGTGTGG - Intergenic
1163103019 19:15108999-15109021 GCTGCTCTGCAGGCAGTGAGGGG + Intronic
1163263075 19:16203079-16203101 CTTGCTCTCCCGCCTGTGTCAGG - Intronic
1163467265 19:17475495-17475517 ACTGCACTCCAGCCTGGGTGAGG + Intronic
1163481608 19:17559823-17559845 ACTGCACTCCAGCCTGGGTGAGG - Intronic
1163641745 19:18466053-18466075 CCTGCTCTTCAGCCAGTGACGGG + Intronic
1164051413 19:21587763-21587785 CCTTCCCTGAAGCCTGTCTGCGG - Intergenic
1165320256 19:35080588-35080610 CACCCTCTGCAGCCTGTGTGGGG + Intergenic
1166087954 19:40489421-40489443 ACTGCACTCCAGCCTGGGTGAGG - Intronic
1166838429 19:45681767-45681789 CCTGCGCCGCAGCCTGGGCGAGG + Exonic
1167045391 19:47046223-47046245 CCTGCTGGGCGGCCTGTGCGTGG - Exonic
1167279808 19:48560288-48560310 CCTGTGCTGAAGGCTGTGTGGGG + Intronic
1167864012 19:52309373-52309395 CCTGCTCTTCAGCCTGTGTGGGG + Intronic
1167868970 19:52351658-52351680 CCTGCTCTGCAGCCTGTGTGAGG + Intronic
1167969970 19:53183191-53183213 CCACTGCTGCAGCCTGTGTGGGG - Intronic
1168027065 19:53650084-53650106 AATGCTCAGCAGCCTGTGAGTGG - Intergenic
1168469455 19:56628842-56628864 CCTGGCTTGCAGCCTGTGTAGGG + Intergenic
925108317 2:1311977-1311999 CCTCCTTCGAAGCCTGTGTGTGG + Intronic
925123525 2:1437821-1437843 CCTGCCCTGAAGCCTGGGGGGGG + Intronic
925185998 2:1846782-1846804 ACAGCTTTGCACCCTGTGTGAGG + Intronic
925783195 2:7402891-7402913 CCAGCTCTTCAGTCTGTCTGGGG + Intergenic
926579461 2:14618813-14618835 CGTGCTCTGCAGACAGTGGGAGG - Intergenic
927108287 2:19846071-19846093 GCTGATTTGCAGCCTGTGAGTGG - Intergenic
928948336 2:36792013-36792035 CCTGCTCTGAAGTCTGAGGGTGG - Intronic
929030755 2:37648271-37648293 CAGGCTCTGCAGCCAGTGGGAGG - Intronic
932397056 2:71455576-71455598 CCTGTTCAGCAGCCTGGCTGAGG + Intronic
932497505 2:72153635-72153657 CCTGCTGTCCAGGCTGGGTGGGG + Intergenic
932621984 2:73269903-73269925 CCTGCTCTGGCACCTGTGCGAGG + Intronic
933606999 2:84393688-84393710 GCTGCTCTCCAGCCTCTGGGAGG + Intergenic
934076451 2:88432503-88432525 ACTGCACTTCAGCCTGGGTGAGG + Intergenic
934512475 2:94956893-94956915 CCTGCTCTGCACCTTCTCTGGGG - Intergenic
934776761 2:96943833-96943855 ACTGATCTGCAGCCTTTGGGCGG - Intronic
935014185 2:99164358-99164380 ACTGCACTCCAGCCTGGGTGAGG - Intronic
935310505 2:101778452-101778474 CATGCTGTCCACCCTGTGTGTGG - Intronic
935341791 2:102065399-102065421 CCTGTTCTCCAGCTTGTTTGAGG + Intronic
937255403 2:120551973-120551995 CCTACTCTGCACCCTTTGCGGGG + Intergenic
938458587 2:131483019-131483041 CCTGCCCTGCTGCTGGTGTGGGG + Intronic
940146680 2:150552628-150552650 CCTGGCCTCCAGCTTGTGTGTGG - Intergenic
940345270 2:152622138-152622160 CCTGCTCAGCAGCCTGTCTCAGG - Intronic
941082721 2:161080521-161080543 ACTGCACTCCAGCCTGGGTGAGG - Intergenic
941164890 2:162074158-162074180 CCTGCCCTGCAGCCTGCCCGCGG - Exonic
941231678 2:162917843-162917865 CCTGCTCTGGAGCCTGTTGTGGG - Intergenic
941561710 2:167054570-167054592 GCTGCTCTGCAGCCTGAGGCAGG + Intronic
942171134 2:173290743-173290765 CCTGCTCTGCAGCTGCTGAGTGG - Intergenic
942509760 2:176685370-176685392 CGTGCTCTGCAGGCTGTCAGGGG + Intergenic
944693811 2:202183043-202183065 GGTGCTCTGCAGACTGTGTTGGG - Intronic
945084351 2:206116446-206116468 CGTGCTCTGCAGCCTGCACGTGG - Intronic
945310344 2:208305039-208305061 CCAGCTGTCCAGCCTGTGTTTGG - Intronic
945437386 2:209834990-209835012 ACTGCTCTGGAGTCTGTGAGGGG - Exonic
945656302 2:212628118-212628140 GCAGCTGTGCAGCCTATGTGGGG - Intergenic
947161375 2:227218426-227218448 ACTGCACTCCAGCCTGGGTGAGG + Intronic
947458798 2:230283809-230283831 GCTGCTCTGCAGCCTGAAGGAGG + Intronic
947469041 2:230382977-230382999 GCTGCTCTGCAGCCTGAAGGAGG + Intronic
947999665 2:234557459-234557481 CCTGCACTGCAGCCAGTGCTGGG - Intergenic
948152668 2:235756648-235756670 CCTCCTGTGCAGCCTGACTGGGG - Intronic
948406942 2:237728958-237728980 ACTGCACTCCAGCCTGGGTGAGG - Intronic
948461599 2:238132416-238132438 CCTGCTCTCCAGCCTTGCTGGGG - Exonic
948644411 2:239394847-239394869 CCTGCTCTGTACCCTGTGCTTGG - Intronic
948775258 2:240284691-240284713 CCAGCTGAGCAGCCTGGGTGGGG - Intergenic
949028558 2:241777555-241777577 CCTGCTCGCCATCCTGTTTGGGG + Intronic
1169041445 20:2498875-2498897 ACTGCGCTTCAGCCTGGGTGTGG - Intronic
1169083021 20:2809037-2809059 CCTGCTCTGTTGCCTATGTTGGG + Intergenic
1170593289 20:17787279-17787301 CCTGCCCTGCAGCCTTTGGAGGG - Intergenic
1171413244 20:24960394-24960416 CTTGCCCTGCTGCCTGAGTGGGG + Intergenic
1171560140 20:26116692-26116714 ACTGCACTCCAGCCTGGGTGAGG + Intergenic
1173476609 20:43364255-43364277 GCTGCACTGCTGCCTGTCTGAGG - Intergenic
1174044979 20:47727040-47727062 TCGGCTCTGCAGCCTTTATGGGG + Intronic
1174560722 20:51428872-51428894 CGTGCTGTGCTGCCTGTGCGTGG - Intronic
1174713683 20:52733736-52733758 ACTGCTCTCCAGCCTGGGTGCGG + Intergenic
1175063037 20:56260980-56261002 CCTGCCCTGTAGACTTTGTGAGG - Intergenic
1175082428 20:56432403-56432425 ACTGCACTACAGCCTGGGTGAGG - Intronic
1175930106 20:62489863-62489885 CCTTCTCTGCAGCCTGCGCTGGG + Intergenic
1176074628 20:63242858-63242880 CCGGATCTTCAGCCTGTGCGGGG + Intronic
1176084088 20:63288068-63288090 CTTGCTGTCCAGCCTGTGTGGGG + Exonic
1176650910 21:9546161-9546183 ACTGCACTCCAGCCTGGGTGAGG - Intergenic
1177571325 21:22890678-22890700 CCTGGTCTTCAGCCCATGTGCGG - Intergenic
1178116983 21:29427625-29427647 CCTGCTCAGCAGCCTGAATGAGG + Intronic
1178504016 21:33148606-33148628 ACTGCACTCCAGCCTGGGTGAGG + Intergenic
1178951376 21:36989072-36989094 TCTGCACTCCAGCCTGGGTGAGG - Intronic
1179067448 21:38039126-38039148 ACTGCACTCCAGCCTGGGTGAGG + Intronic
1179474449 21:41634303-41634325 CCTGCTCCGCAGCCTGGGACCGG + Intergenic
1179913534 21:44462343-44462365 CCGGCTCTGCACCCTCTGCGGGG - Intergenic
1179989826 21:44941877-44941899 CCTTGTCTGCAGCTCGTGTGAGG - Intronic
1179997493 21:44980730-44980752 CCTGCCCTGCAGCCTGAGGGAGG - Intergenic
1180163815 21:46010060-46010082 CATGGTCTGCAACCTGTGTGGGG - Intergenic
1180164219 21:46012672-46012694 CTTAGTCTGCAGCTTGTGTGAGG - Intergenic
1180178013 21:46099418-46099440 ACTGCACTCCAGCCTGGGTGAGG + Intronic
1181079415 22:20404029-20404051 CCTGCTCTTCTGCATGTGTTGGG + Intronic
1182226732 22:28804616-28804638 ACTGCTCTCCAACCTGGGTGAGG + Intergenic
1182392120 22:30007104-30007126 ATTGCTCTGGTGCCTGTGTGAGG - Exonic
1182639103 22:31752651-31752673 ACTGCACTCCAGCCTGGGTGAGG + Intergenic
1182729983 22:32480705-32480727 ACTGCACTCCAGCCTGGGTGAGG - Intronic
1183351752 22:37338415-37338437 TCTGCTCTGCAGCCTCTTAGCGG + Intergenic
1183619525 22:38964535-38964557 CCGGCTCTGCCGCCACTGTGGGG - Intronic
1183667905 22:39255792-39255814 CCTGCTCAGCACCCTGGGGGAGG - Intergenic
1183870958 22:40741836-40741858 ACTGCACTCCAGCCTGGGTGTGG + Intergenic
1184063149 22:42097655-42097677 ACTGCACTCCAGCCTGGGTGAGG - Intergenic
1184122706 22:42463068-42463090 ACTGCACTCCAGCCTGGGTGAGG - Intergenic
1184188197 22:42878308-42878330 CCTGCTGGGGAGCCTGGGTGGGG + Intronic
1184193167 22:42908574-42908596 CCTGCCGTGAAGCCTGTGGGCGG + Intronic
1184275024 22:43405181-43405203 CCTGCCCAGCATCCTGTTTGGGG - Intergenic
1184355546 22:43977149-43977171 CCTGCCCTGCAGCCATTGAGGGG - Intronic
1184423364 22:44394888-44394910 CCTGGGCAGCAGCCTGAGTGGGG + Intergenic
1184426075 22:44410064-44410086 CCTGCTCCGGAGTCTGGGTGGGG - Intergenic
1184659101 22:45957643-45957665 ACTGCACTCCAGCCTGCGTGAGG + Intronic
1184775140 22:46619372-46619394 ACTGCACTCCAGCCTGGGTGAGG - Intronic
1184863912 22:47192183-47192205 CCTGCTCTGCTGTCTCTCTGAGG + Intergenic
1185058747 22:48594548-48594570 GCTGCTCTGAGGACTGTGTGAGG - Intronic
1185275265 22:49947924-49947946 CCTGCTTCACAGGCTGTGTGGGG - Intergenic
1185324436 22:50218807-50218829 CCTGCAGTGCAGCCTGCATGGGG - Exonic
949325313 3:2856981-2857003 CCTGCTCTTTTGCCTGTGTCAGG - Intronic
949539241 3:5019517-5019539 CCAGCCCCGCTGCCTGTGTGAGG + Intergenic
950290185 3:11777754-11777776 ACTGCACTCCAGCCTGGGTGAGG + Intergenic
950416072 3:12869585-12869607 CCTTCACTGCAGCCCGTGGGAGG - Intronic
950518667 3:13483378-13483400 CCAAGTCTGCAGCCTGTGGGAGG + Intronic
951334266 3:21402383-21402405 ACTGCACTCCAGCCTGGGTGAGG + Intergenic
951915041 3:27791605-27791627 ACTGCCCTCCAGCCTGGGTGAGG + Intergenic
952315797 3:32231204-32231226 TCTGCTCTGCAACCTGATTGGGG + Intergenic
952400353 3:32957568-32957590 ACTGCACTTCAGCCTGGGTGCGG + Intergenic
952668972 3:35942807-35942829 ACTGCACTCCAGCCTGGGTGAGG + Intergenic
952800324 3:37284699-37284721 ACTGCACTCCAGCCTGGGTGAGG - Intronic
953000027 3:38924006-38924028 CCTGCCCTGCACAGTGTGTGTGG - Intronic
953530052 3:43732390-43732412 ACTGCACTCCAGCCTGAGTGAGG + Intronic
953945200 3:47141033-47141055 ACTGCACTCCAGCCTGGGTGAGG - Intronic
954272462 3:49520466-49520488 CCAGCTCTGCAGCCTGACTAGGG + Intronic
954385451 3:50241623-50241645 CCTGCTCTGCCCTCTGTCTGGGG - Intronic
954433703 3:50484865-50484887 CCTCCTGTCCAGCTTGTGTGTGG + Intronic
954635866 3:52070496-52070518 CTTGGTCTCCAGCCTGTCTGAGG - Intergenic
955348896 3:58179938-58179960 ACAGCTCTGCGGCCTGTGTTTGG - Intergenic
958581955 3:96038634-96038656 ACTGCACTCCAGCCTGGGTGAGG - Intergenic
959060173 3:101609287-101609309 ACTGCACTCCAGCCTGGGTGAGG + Intergenic
959406470 3:105967231-105967253 CCTGCCCTGTTGCCTGTCTGTGG - Intergenic
959524791 3:107364429-107364451 ACTGCACTCCAGCCTGGGTGAGG + Intergenic
959720121 3:109477523-109477545 ACTGCACTTCAGCCTGGGTGAGG - Intergenic
960879987 3:122334437-122334459 ACTGCACTCCAGCCTGGGTGAGG + Intronic
961595097 3:128009594-128009616 ACTGCACTCCAGCCTGGGTGAGG - Intergenic
961780846 3:129319274-129319296 CCGGCTCCTCAGCCTGTGAGGGG + Intergenic
965061868 3:163794055-163794077 ACTGCACTCCAGCCTGGGTGAGG - Intergenic
965514503 3:169606371-169606393 CCTGCACTTCAGCCTGTGACAGG + Intronic
966812104 3:183856033-183856055 CCTGCTCTGCAGCCCGGTTCTGG + Intronic
967386322 3:188914878-188914900 GCTGCTCTGCTGCATGTGAGTGG - Intergenic
967814465 3:193787435-193787457 CCTGCTCTGCAGACAGAGGGAGG + Intergenic
968146773 3:196305761-196305783 ACTGCACTCCAGCCTGGGTGAGG + Intronic
968505350 4:968719-968741 CCTGCTGTGCAGCTTGTCAGGGG - Intronic
968562916 4:1294534-1294556 CCTGCTCTGCAGCCCGGCGGCGG - Intronic
968669067 4:1838638-1838660 ACTGCACTCCAGCCTGGGTGGGG + Intronic
968726145 4:2248674-2248696 CCTGCCCTGCAGGCTGTAGGGGG - Exonic
968871448 4:3244797-3244819 CCTGCTCTGCTGTCTGTGCCAGG + Intronic
969066384 4:4485014-4485036 TCTGGTCTGGAGGCTGTGTGTGG + Intronic
969175281 4:5394090-5394112 CCTGCTTTGCAGTCTGTGCATGG + Intronic
969300551 4:6294656-6294678 CCTCCTCTTCAGCCAGCGTGGGG - Intronic
969393188 4:6904416-6904438 CCTGATCTGCGGCCTATGAGTGG + Intergenic
969412411 4:7037699-7037721 CCTCCACAGAAGCCTGTGTGCGG - Intergenic
969595959 4:8149421-8149443 CCTGCTCTGCAGCCTGGAGCTGG - Intronic
969633311 4:8351078-8351100 CCTGACCAGCAGCCTCTGTGTGG - Intergenic
969813817 4:9671145-9671167 CCTTCTAGGCAGCCTGTGTGGGG + Intergenic
971648400 4:29238252-29238274 ACTGCCCTCCAGCCTGGGTGTGG + Intergenic
974635934 4:64564203-64564225 GCTGCTCTGCAGCCTATTAGAGG + Intergenic
975069824 4:70120162-70120184 CATGCTCTGCTGCCTGGGGGTGG - Intergenic
975110979 4:70626284-70626306 GCTGCCCTCCAGCCTGGGTGAGG - Intergenic
976149643 4:82079087-82079109 CTTGCTCTGCTGCCTGTGGCTGG - Intergenic
977257517 4:94757730-94757752 CCAGCGCCGCCGCCTGTGTGCGG - Intergenic
977535844 4:98256355-98256377 ACTGCACTCCAGCCTGGGTGAGG - Intergenic
978212725 4:106157289-106157311 CATGCTGTGCAGCCTGGGTTTGG + Intronic
978381245 4:108131343-108131365 ACTGCACTCCAGCCTGGGTGAGG + Intronic
979537690 4:121842213-121842235 ACTGCACTCCAGCCTGGGTGAGG + Intronic
980959507 4:139461030-139461052 CTTGCTTTGGAGACTGTGTGAGG + Intronic
983881199 4:172935165-172935187 GCTGCCCTGCAGACTGTGAGTGG + Intronic
985399449 4:189579981-189580003 CCTGCTCTCCAACCTGGGTCTGG + Intergenic
985515669 5:343608-343630 CCTGCTCTGGAGCCTGGCTCAGG - Intronic
985758383 5:1732606-1732628 CCTGCCCTGCTGCCTGGGTGAGG + Intergenic
985878782 5:2621170-2621192 ATTGCTGTGCAGCCTTTGTGGGG + Intergenic
986050012 5:4081276-4081298 CCAGCTCTGTTGCCTGTTTGGGG + Intergenic
986264471 5:6180713-6180735 CCTCCTCTGCATCCTGAGGGAGG + Intergenic
989997550 5:50853775-50853797 CCTCCTCTGTTGCCTGTGTGAGG - Intergenic
990305288 5:54488696-54488718 GCTGCACTCCAGCCTGTGTGAGG - Intergenic
991322537 5:65390990-65391012 ACTGCACTCCAGCCTGGGTGAGG - Intronic
991604007 5:68382099-68382121 ACTGCTCGGCTGACTGTGTGTGG - Intergenic
991686096 5:69183779-69183801 ACTGCACTCCAGCCTGGGTGTGG + Intergenic
993126746 5:83844667-83844689 CCTGGTAGGCAGCCCGTGTGTGG + Intergenic
994085640 5:95755454-95755476 GCTGTTCTGCTGCCAGTGTGTGG + Exonic
998137022 5:139679201-139679223 CCTACTCTGCAGGCCTTGTGAGG + Intronic
998179463 5:139926330-139926352 CCTCCTCTGCTGCCTCTGTGGGG - Intronic
998886643 5:146701512-146701534 CCAGAACTGAAGCCTGTGTGGGG - Intronic
999370340 5:151051433-151051455 CTTGCTCTCCATCCTGTGAGTGG - Intronic
1000022257 5:157328227-157328249 GCTGGACTGCAGGCTGTGTGAGG - Intronic
1000845488 5:166274869-166274891 ACTGCACTCCAGCCTGTTTGGGG - Intergenic
1001266089 5:170275610-170275632 CCTGCTCTGCATCCTGTCCCTGG - Intronic
1001482558 5:172098556-172098578 GCTGCACTGCAGCCTGTTGGTGG - Intronic
1001990202 5:176110351-176110373 CCTCCTCTGCAACTAGTGTGGGG - Intronic
1002226669 5:177727788-177727810 CCTCCTCTGCAACTAGTGTGGGG + Intronic
1002378351 5:178805337-178805359 GCTGCTCTGGAGGCTGTGTTGGG - Intergenic
1002486233 5:179539069-179539091 ACTGCACTCCAGCCTGGGTGAGG + Intergenic
1002487955 5:179552219-179552241 AATGCTCAGTAGCCTGTGTGTGG + Intronic
1002575531 5:180171843-180171865 CCTGCTCGGCAGCCAGGGTGTGG + Intronic
1002664424 5:180811775-180811797 CCGGCTCTGCAGCCATTGTAAGG - Intronic
1004260396 6:14102760-14102782 CCTGGGCTGCTGCCTGTGTCTGG - Intergenic
1004673293 6:17817293-17817315 CAGGCACTGCAGCCTGTGGGAGG + Intronic
1005852412 6:29831458-29831480 ACTGCACTCCAGCCTGAGTGAGG - Intergenic
1005972523 6:30772486-30772508 CCTGATCTGCATCCTGTGTTAGG + Intergenic
1006190431 6:32204255-32204277 CCTGCCCTCCAGGCTTTGTGGGG - Exonic
1008620858 6:53270386-53270408 CCTGTTCTAGAGCCTGGGTGAGG - Intronic
1009318504 6:62255486-62255508 CCTGCTCTGCAGCTAGTGCATGG - Intronic
1011130342 6:84045723-84045745 ACTGCACTCCAGCCTGTGTGAGG + Intronic
1011769014 6:90654974-90654996 CCAGCTCTGGAGACTGTGAGTGG + Intergenic
1011786269 6:90848646-90848668 GCTGCTCTGGAGGCTGTGTTGGG + Intergenic
1011798392 6:90982698-90982720 CCTGCACTCCAGCCAGTGTTGGG - Intergenic
1012282376 6:97344097-97344119 ACTGCACTGCAGCCTGGGTGAGG + Intergenic
1015121662 6:129707504-129707526 ACTGCACTCCAGCCTGGGTGAGG - Intronic
1015597089 6:134876015-134876037 CCTGCTCTGCACCCTGGTAGGGG - Intergenic
1015741822 6:136464044-136464066 CCTTGTCTGAAGCCTGGGTGAGG - Intronic
1016029413 6:139322363-139322385 TCTGCTCTTCTGCCAGTGTGAGG - Intergenic
1016076489 6:139802743-139802765 CTTGATCTGCAGTCTGTATGTGG - Intergenic
1016802783 6:148183441-148183463 CTTGCTTTGCAGTCAGTGTGAGG - Intergenic
1017116948 6:150986670-150986692 CCTGGTCTGCAGCCCCTGTAAGG - Intronic
1017628240 6:156369968-156369990 CCTGCTCTGCAGCATAGCTGGGG - Intergenic
1018718518 6:166554507-166554529 CCGGATGTGCATCCTGTGTGGGG + Intronic
1019309005 7:349893-349915 CCTCCTCTGCAGGCCGTGTTTGG + Intergenic
1019319423 7:408886-408908 CCTGCTCTGCACCACGCGTGGGG + Intergenic
1019411890 7:910285-910307 CCTGCACTCCAGCCTGGGTGGGG - Intronic
1019768334 7:2867370-2867392 CCTCCCCTGCAGCCTGGGGGTGG + Intergenic
1020071322 7:5228764-5228786 ACTGCTCTCCAGCCTGGGCGAGG - Intronic
1020719607 7:11724841-11724863 CCTGCTGTGGAGGCTGAGTGTGG + Intronic
1020737594 7:11970585-11970607 CCTGCTTTTCATCCTGTGTATGG - Intergenic
1022098089 7:27153077-27153099 CCTGGTCTGCAGGCGGGGTGGGG + Intergenic
1023338003 7:39189929-39189951 ACTGCACTCCAGCCTGGGTGAGG - Intronic
1023577021 7:41639663-41639685 ACTGCACTCCAGCCTGGGTGAGG - Intergenic
1024997802 7:55287219-55287241 CCTTCTCTTCAGGCTGGGTGTGG + Intergenic
1025016040 7:55439898-55439920 CCTGCCCAGCAGTCTGTGTTTGG - Intronic
1026509144 7:71013468-71013490 ACTGCACTCCAGCCTGTGGGGGG + Intergenic
1026825909 7:73581238-73581260 ACTGCACTGCAGCCTGGGTGAGG + Intergenic
1027435519 7:78160113-78160135 ACTGGTCTGCAGGCTGTGGGAGG + Exonic
1027841552 7:83318753-83318775 TCTACCCTGCAGCCTGAGTGGGG - Intergenic
1028563488 7:92201875-92201897 TCTGTGCTGCAGGCTGTGTGAGG - Intronic
1028933823 7:96443402-96443424 CATGCTCTGCTGCCTCTGTTTGG + Intergenic
1029209843 7:98898002-98898024 CCTTCTCTGCAGCCTGGGAGGGG + Intronic
1029539383 7:101173759-101173781 ACTGCGCTCCAGCCTGGGTGAGG - Intronic
1030153293 7:106427060-106427082 GCTGACCTGCAGCCTGTGCGAGG - Intergenic
1031786791 7:126043250-126043272 AGTGCTCTGGAGTCTGTGTGTGG - Intergenic
1032133203 7:129249033-129249055 ACTGCACTCCAGCCTGGGTGAGG - Intronic
1032469096 7:132165071-132165093 CATTCTCTGCAGCCTGACTGGGG - Intronic
1034068484 7:148159619-148159641 CATTCTCTGCCACCTGTGTGAGG + Intronic
1034096564 7:148414112-148414134 ACTGCACTCCAGCTTGTGTGAGG - Intronic
1035219795 7:157399548-157399570 CGGGCCCTGCAGCCTGGGTGTGG + Intronic
1035467339 7:159088243-159088265 GCTGTGCTGCAGCATGTGTGTGG - Intronic
1035467352 7:159088383-159088405 GCTGTGCTGCAGCTTGTGTGTGG - Intronic
1035467364 7:159088494-159088516 GCTGTGCTGCAGCTTGTGTGTGG - Intronic
1036596055 8:10213472-10213494 ACTGCACTCCAGCCTGGGTGAGG - Intronic
1036631487 8:10518969-10518991 CCAGCTCTGCCTCCTCTGTGTGG - Intergenic
1036983230 8:13494911-13494933 CCTGCACTCCAGCCTGGGTAAGG + Intronic
1037986324 8:23292832-23292854 CCTACCCTGCAGCTTGTGAGAGG - Intronic
1038908466 8:31934987-31935009 ACTGCACTCCAGCCTGGGTGGGG - Intronic
1039547030 8:38417742-38417764 CCTGCTCCGCTGCCTGCTTGGGG - Intronic
1039840987 8:41292980-41293002 CCAGCCCTGCATCCTGTGAGTGG + Intronic
1040276046 8:46014136-46014158 CCTGATATGCAGCCCTTGTGTGG - Intergenic
1040328450 8:46374114-46374136 CCTTCTCAGAAGCCTCTGTGGGG - Intergenic
1040544295 8:48385040-48385062 CCTACTCTGAAGCCTTTGTAGGG - Intergenic
1041275651 8:56155230-56155252 ACTGCACTCCAGCCTGCGTGAGG + Intergenic
1041311218 8:56518884-56518906 TCTGCTCTGGAGCCTGTGGAGGG + Intergenic
1041473819 8:58240626-58240648 GCTGCACTCCAGCCTGGGTGAGG - Intergenic
1042594011 8:70425874-70425896 CCTGCTCCCCAGCCTGAGTCTGG + Intergenic
1043505605 8:80898887-80898909 GCTGCTCTGCACCCTGTGCAGGG + Intergenic
1043526250 8:81099503-81099525 CCTGCACTGTAGCATGTGTATGG + Intronic
1045094519 8:98784166-98784188 CCTGCTCTCCATCCTGGGTCTGG - Intronic
1045485150 8:102625427-102625449 CATGCACTGCAGACTGTCTGTGG - Intergenic
1045906106 8:107346971-107346993 TCTGCTCTGCAGTCTGAGAGAGG + Exonic
1047075876 8:121401923-121401945 ACTGCACTGCAGCCTGGGTGAGG + Intergenic
1047624489 8:126642257-126642279 GCTACTCTGCAGCCTGGGTTAGG + Intergenic
1048348852 8:133599614-133599636 CCAGCCCTGCAGCCTCTGAGGGG - Intergenic
1048367892 8:133754180-133754202 ACTGTTGTGCAGCCTGAGTGTGG - Intergenic
1048445279 8:134488681-134488703 CCTGAACTGCAGCCTGTTGGTGG - Intronic
1048457711 8:134593003-134593025 CCTGTGGTGTAGCCTGTGTGGGG - Intronic
1048486008 8:134848095-134848117 CCTGCACTCCAGCCTGTGGATGG - Intergenic
1048971151 8:139645578-139645600 CCTGCTCTGGGCCCTGTGTCAGG - Intronic
1048987533 8:139742734-139742756 TCTGATCTGCAGGCTGGGTGGGG + Intronic
1048991374 8:139762097-139762119 CCAGCCCTGCAGCCCGAGTGAGG + Intronic
1049077415 8:140410101-140410123 ACTGCACTCCAGCCTGGGTGAGG + Intronic
1049244200 8:141552919-141552941 CCTGCTTTGCAGCGCCTGTGTGG - Intergenic
1049261210 8:141640283-141640305 CCTCCTCTGCAGGCTCTCTGGGG - Intergenic
1049351531 8:142167263-142167285 CCTGTGCTGCAGTCGGTGTGGGG + Intergenic
1049526539 8:143129738-143129760 CCAGCCCTGAAGCCTGTGAGCGG - Intergenic
1049695676 8:143983338-143983360 GCAGCTCTGCAGGCAGTGTGCGG + Exonic
1050104138 9:2147865-2147887 ACTGCACTACAGCCTGGGTGAGG - Intronic
1051152613 9:14100033-14100055 ACTGCACTCCAGCCTGGGTGAGG + Intronic
1052909345 9:33866274-33866296 ACTGCACTCCAGCCTGGGTGAGG - Intronic
1053106040 9:35409375-35409397 CCTCCTTTGCAGCCTTTTTGTGG + Intergenic
1053625133 9:39862528-39862550 ACTGCACTCCAGCCTGGGTGAGG - Intergenic
1054218762 9:62388166-62388188 ACTGCACTCCAGCCTGGGTGAGG + Intergenic
1054231955 9:62521001-62521023 ACTGCACTCCAGCCTGGGTGAGG - Intergenic
1055613143 9:78043777-78043799 ACTGCACTCCAGCCTGTGTGAGG - Intergenic
1056757258 9:89389488-89389510 CCGGCCCTGCAGCCTGTCTTGGG + Intronic
1056766714 9:89448589-89448611 CCTTCTCTGCTGCCGTTGTGTGG - Intronic
1057054764 9:91951610-91951632 CCTTCTCTGCAGCCCCTGTTGGG - Intergenic
1057547339 9:96027903-96027925 CCAGCTCTGCTGCCTCGGTGCGG - Intergenic
1057647288 9:96888776-96888798 ACTGCTCAGCAGCCTCAGTGGGG + Intergenic
1057814599 9:98285255-98285277 CCTGTTCAGCAGCGTGTGTGAGG + Intergenic
1058420290 9:104826989-104827011 CCTGCCCTACGTCCTGTGTGTGG - Exonic
1058445319 9:105049916-105049938 ACTGCACTCCAGCCTGGGTGAGG + Intergenic
1059221711 9:112627714-112627736 ACTGCACTCCAGCCTGGGTGAGG + Intronic
1060126605 9:121053682-121053704 CCTGCTGTGCAGCCTGTGGTTGG - Intergenic
1060466964 9:123915027-123915049 TCTACTTTGCAGCCTTTGTGGGG - Intronic
1060638963 9:125222674-125222696 ACTGCACTCCAGCCTGGGTGAGG + Intronic
1060860014 9:126946494-126946516 ACTGCACTCCAGCCTGGGTGAGG + Intronic
1062301916 9:135878346-135878368 CGTCCTCTGCAGCATCTGTGGGG - Intronic
1062309884 9:135929937-135929959 CCTTCTCTCCAGCCTGTGCTGGG + Intergenic
1062312155 9:135944668-135944690 CCTGTTCGGCAGCCTCTCTGCGG - Intronic
1062410135 9:136419460-136419482 CCTTCTCAGCCGCCTCTGTGAGG + Intronic
1062546886 9:137067874-137067896 CCTGCTCTGAAGTTTGTTTGAGG + Intronic
1062564826 9:137159508-137159530 CCTGCTCTGCAGACAGGGTGGGG + Intronic
1203777429 EBV:81590-81612 CCTGCCCCGCAGCCTGTGTCAGG - Intergenic
1203628643 Un_KI270750v1:49712-49734 ACTGCACTCCAGCCTGGGTGAGG - Intergenic
1185974022 X:4698017-4698039 ACTGCACTCCAGCCTGGGTGAGG + Intergenic
1186582162 X:10831646-10831668 GCTCCTCAGCAGCCTGTTTGGGG - Intronic
1187697825 X:21939248-21939270 TATGCTCTGCAGCTTGTGTCTGG - Intergenic
1188260388 X:28016391-28016413 TCTGGTCAGCAGCCTGTCTGTGG - Intergenic
1189718278 X:43886751-43886773 CATGCTCTACAGCATGTTTGGGG - Intergenic
1191175305 X:57493696-57493718 ACTGCACTTCAGCCTGGGTGAGG + Intergenic
1192745614 X:73935433-73935455 ACTGCACTCCAGCCTGGGTGAGG - Intergenic
1195538268 X:106033691-106033713 CCTTATGGGCAGCCTGTGTGGGG + Exonic
1196857390 X:119996940-119996962 CTCGCTCTGCAGTTTGTGTGAGG - Intergenic
1197785956 X:130197242-130197264 CCTGCACTCCAGCCTGGGCGAGG - Intergenic
1197955321 X:131940185-131940207 ACTGCACTCCAGCCTGGGTGAGG + Intergenic
1198444386 X:136696995-136697017 CCTACTCTCCAGCCTGTGTCGGG - Intronic
1198530655 X:137547647-137547669 TCTGCTCTTCCGCCTGTGTTCGG + Intergenic
1199858610 X:151780066-151780088 GCTGCTCTGCAAACTCTGTGAGG - Intergenic
1200102809 X:153696476-153696498 CCAGCCCTGCAGCCTCTGTCTGG - Exonic
1200267819 X:154655257-154655279 CCAGCCCTGCAGCCTCTGTCTGG - Intergenic