ID: 1167869570

View in Genome Browser
Species Human (GRCh38)
Location 19:52356536-52356558
Sequence CTCAAAAATATATAAATCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1628
Summary {0: 2, 1: 0, 2: 40, 3: 143, 4: 1443}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167869570_1167869574 15 Left 1167869570 19:52356536-52356558 CCATTGATTTATATATTTTTGAG 0: 2
1: 0
2: 40
3: 143
4: 1443
Right 1167869574 19:52356574-52356596 TGCACAGGGTATGCCTCAGCAGG 0: 1
1: 0
2: 1
3: 11
4: 100
1167869570_1167869573 1 Left 1167869570 19:52356536-52356558 CCATTGATTTATATATTTTTGAG 0: 2
1: 0
2: 40
3: 143
4: 1443
Right 1167869573 19:52356560-52356582 GTGGTTTTTTTAAATGCACAGGG 0: 1
1: 0
2: 1
3: 25
4: 378
1167869570_1167869572 0 Left 1167869570 19:52356536-52356558 CCATTGATTTATATATTTTTGAG 0: 2
1: 0
2: 40
3: 143
4: 1443
Right 1167869572 19:52356559-52356581 TGTGGTTTTTTTAAATGCACAGG 0: 1
1: 0
2: 3
3: 54
4: 449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167869570 Original CRISPR CTCAAAAATATATAAATCAA TGG (reversed) Intronic
901100822 1:6717227-6717249 TTAAAAAATAAATAAATAAAAGG - Intergenic
901359954 1:8688979-8689001 TTAAAAAGTATACAAATCAATGG - Intronic
901614501 1:10527656-10527678 CAAAAAAATAAATAAATAAAAGG - Intronic
902568963 1:17334301-17334323 CTCAAAAAAAAAAAAATTAATGG - Intronic
902888063 1:19420839-19420861 ATAAAAAATAAATAAATAAAGGG + Intronic
903115147 1:21173195-21173217 CTCAAAAAAAACAAAATCAAAGG - Intronic
903200558 1:21734398-21734420 CAAAAAAATATATAAATAAAAGG + Intronic
903399280 1:23028150-23028172 CTCAAAAAAATAGAAAATAAAGG - Intronic
903492507 1:23740219-23740241 CTCAAAAAAAAATAAAGTAAGGG + Intergenic
903530600 1:24027450-24027472 CTAATAAATAAATAAATAAATGG - Intergenic
903633739 1:24798586-24798608 CCCCAAAAGATTTAAATCAAGGG + Intronic
903972278 1:27126797-27126819 CCCAAAAATATATACACAAAAGG - Intronic
903987226 1:27237139-27237161 CTCAAAAAAATAAAAATAAAAGG - Intronic
904226793 1:29027822-29027844 CTCACAAATAAATAAATAAGGGG - Intronic
904694954 1:32324418-32324440 CTCATAAATATGTAAACTAAAGG + Intronic
906765851 1:48432193-48432215 CCTAAAAATATATAGAACAAAGG + Intronic
906997162 1:50808814-50808836 CTCAAAAACATACAATTTAATGG - Intronic
907004494 1:50897155-50897177 TTAAAGAATATATAAATAAATGG + Intronic
907025863 1:51117912-51117934 CTCAAAAATAAATAAATAAGAGG - Intronic
907410842 1:54282247-54282269 CACAGAAATTTATAAATCACTGG - Intronic
907479353 1:54734070-54734092 CTCAAAAATTTAAAAAAAAAAGG - Intronic
907561466 1:55393428-55393450 CTCAAAACTATACAAATACATGG - Intergenic
907809036 1:57850229-57850251 CTCAACAATTTACAAATCATAGG + Intronic
907887158 1:58603542-58603564 CTCAAAACTATACAAATACATGG - Intergenic
908205862 1:61848569-61848591 ATTAAAAATAAATAAATAAAAGG - Intronic
908450996 1:64254602-64254624 CTCAAAATTATACAACTAAATGG + Intronic
908548231 1:65183249-65183271 CTCAAAACAAAATAAAACAAAGG - Intronic
908610430 1:65853529-65853551 CTCAAAAATAAAAAAAAAAAAGG - Intronic
908873501 1:68642949-68642971 GGCAAAAATATATAAATAACAGG + Intergenic
908971886 1:69845246-69845268 CTCTCAAATAAATAAATAAAAGG + Intronic
909071364 1:70997333-70997355 CTTAAAAATATATACATAACAGG + Intronic
909173140 1:72319940-72319962 CTCAAAAATAGATAATTGACAGG - Intergenic
909184342 1:72466850-72466872 CTCAATAACATAAAAGTCAAAGG + Intergenic
909227865 1:73048113-73048135 CTCAAAACTATATTAATGCATGG + Intergenic
909444755 1:75736255-75736277 CTCAAACATATTTCAATCTAAGG + Intronic
909647362 1:77932785-77932807 TTCAAAAATAAATAAATAAAAGG - Intronic
909712728 1:78671166-78671188 CTCAAAACTATACAAATACATGG - Intergenic
909986192 1:82163461-82163483 CGCAAAAATATTAAAATGAATGG + Intergenic
910063839 1:83127527-83127549 CAAAAAAATAAATAAATAAAAGG + Intergenic
910152365 1:84165852-84165874 CTTAAAAATATCTGAATCAAAGG - Intronic
910298447 1:85677195-85677217 CTAAAAAATATTTAAAGAAATGG + Intronic
910664123 1:89705776-89705798 CTCAAAAATAAATAAATAAATGG + Intronic
910865511 1:91784744-91784766 CTCAGGAATCTATACATCAAGGG + Intronic
910906861 1:92190488-92190510 CTGAAGAATTTAAAAATCAAAGG + Intergenic
911073355 1:93849433-93849455 CTCAAGAACAGATAAATCACAGG - Intergenic
911238114 1:95433853-95433875 GTCAAAAATATATACATTAGCGG - Intergenic
911362153 1:96890943-96890965 CTCAAGAAGATAAAAATAAATGG - Intergenic
911398735 1:97346989-97347011 CATATAAATATATAAATCAGTGG + Intronic
911603784 1:99877092-99877114 TTAAAAAATAAATATATCAATGG - Intronic
911655853 1:100443333-100443355 CTCAAAAATAAATAAATAAAAGG - Intronic
911679059 1:100692878-100692900 CTCAAAACTATACAAATACATGG - Intergenic
912005298 1:104891574-104891596 CTTAAAAATATTTACATAAAGGG + Intergenic
912081201 1:105938839-105938861 ATTAAAAATAAATAAATAAATGG - Intergenic
912108328 1:106308494-106308516 CACAAAAATATAAAATTCACTGG + Intergenic
912121485 1:106477171-106477193 CTCAAAACTATACAAATAAATGG + Intergenic
912126101 1:106540135-106540157 CCCAAAAATATAGACAGCAAGGG - Intergenic
912238361 1:107877695-107877717 CTGAAAAATACATAAATAAAGGG - Intronic
912344226 1:108949314-108949336 CACAAAAATAAATAAGTCAAGGG - Intronic
912915168 1:113807457-113807479 ATAAAAAATATACAATTCAAGGG + Intronic
912918174 1:113839099-113839121 AGCAAAAATATATTAATCAGGGG - Intronic
913029621 1:114887111-114887133 ATCAAAAATATATAAATTAGGGG - Intronic
913429243 1:118771635-118771657 CTCAAAACTATACAAATACATGG + Intergenic
913589628 1:120311026-120311048 CTCAAAAAAATAAAAAATAAGGG - Intergenic
913618557 1:120587340-120587362 CTCAAAAAAATAAAAAATAAGGG + Intergenic
913694294 1:121309268-121309290 ATAAAAAATAAATAAATAAATGG - Intronic
914212782 1:145596111-145596133 CCCAAAAATAAATAGATAAATGG - Intergenic
914384016 1:147150089-147150111 CACAAAGACATATAGATCAATGG + Intergenic
914571656 1:148922884-148922906 CTCAAAAAAATAAAAAATAAGGG - Intronic
914601178 1:149207378-149207400 CTCAAAAAAATAAAAAATAAGGG + Intergenic
915078479 1:153332731-153332753 CTCAAAACTATACAAATACATGG + Intronic
915379365 1:155426500-155426522 ATTAAAAATATAAAAATTAATGG - Intronic
915389490 1:155528686-155528708 TTAAAAAATCAATAAATCAATGG - Intronic
915800826 1:158791379-158791401 CTCAAAACTATAAAAATACATGG - Intergenic
916043844 1:160983213-160983235 CTCAAAAAAATAAAAAAGAACGG + Intergenic
916204646 1:162303760-162303782 CTTAAAAATATATATACAAATGG - Intronic
916231495 1:162545294-162545316 CTCAAAAAAATAAAAATAACTGG + Intergenic
916557595 1:165906668-165906690 CAAAAAAATAAATAAAACAATGG - Intronic
916734217 1:167592815-167592837 CTCAAAAAAATAAAAAGAAAAGG + Intergenic
918031795 1:180820851-180820873 GTCCAAAATATATATATAAATGG - Intronic
918558918 1:185840713-185840735 CTAAGAAATATATAAATCAGAGG - Intronic
918706602 1:187670496-187670518 CTCAAAAACATACAAATTAAGGG + Intergenic
918718430 1:187821709-187821731 CTCAAAACTATACAAATGCATGG - Intergenic
918856912 1:189767733-189767755 CACAAAAATATTTAATTTAAAGG + Intergenic
918913578 1:190605848-190605870 CACACAAATATATCCATCAATGG - Intergenic
919059481 1:192613636-192613658 CAAAAAAACATATAAATCAGAGG - Intergenic
919123053 1:193364705-193364727 CTTAAAAATGAATAAATGAATGG - Intergenic
919176592 1:194027075-194027097 CTCAAAAATATCTGACTCAGTGG + Intergenic
919181878 1:194096170-194096192 ATAAAAAATGTATAAATCATAGG - Intergenic
919201449 1:194359213-194359235 ATCAAAGATAAATAATTCAAAGG - Intergenic
919349007 1:196424721-196424743 CTTTATTATATATAAATCAAAGG + Intronic
919508750 1:198433574-198433596 CTCAAAAGTATACAAATACATGG - Intergenic
919543004 1:198874393-198874415 CTGAAAATTATATAAGTCTATGG + Intergenic
919888015 1:201949240-201949262 CTTAAACATGTATAATTCAATGG + Intergenic
920083831 1:203399475-203399497 CTAAAAAAGATATAAACAAATGG - Intergenic
920481622 1:206327653-206327675 ATAAAAAATAAATAAATAAATGG - Intronic
920809998 1:209275454-209275476 CTCAAAAAAATAGTCATCAAAGG - Intergenic
920834406 1:209495643-209495665 CTCAAAAATAAAAAAAAAAAAGG - Intergenic
920894884 1:210037726-210037748 CTCAAAACTATACAAATATATGG - Intronic
921196666 1:212764129-212764151 CTCAAAATTATACAAATACATGG + Intronic
921239971 1:213169546-213169568 CTTAAAAAGATAAAATTCAATGG - Intronic
921566298 1:216724671-216724693 TTCAAAAAAATAAAAATAAAAGG + Intronic
922052855 1:222010838-222010860 GTCAAAACTAAATAAAGCAAGGG - Intergenic
922305068 1:224337365-224337387 TTTAAAAATAAATAAATAAATGG - Intergenic
922307305 1:224355534-224355556 CTGAAAAATATAAAAATCACTGG + Intergenic
922432999 1:225574599-225574621 CTCCAAAATATATAAAAAAAAGG + Intronic
922667341 1:227482128-227482150 CTGAAGAATATAAAAATAAAAGG + Intergenic
923070440 1:230559375-230559397 CTAAAAAATAGAAAAATAAATGG - Intergenic
923074182 1:230594656-230594678 CTCAAATATATGTAAATCTTAGG + Intergenic
923239627 1:232069976-232069998 AACAAAAATAAATAAATAAATGG - Intergenic
923334124 1:232952208-232952230 CTCTAAAATAAATAAATAAATGG - Intronic
923550043 1:234956537-234956559 CTCAAAAATAAAAAAAAGAAAGG + Intergenic
923691701 1:236200138-236200160 CTCAAAACTATATAAATGCATGG - Intronic
923804809 1:237246094-237246116 CTCAAAAAAATAAAAAGAAAAGG - Intronic
923809494 1:237297283-237297305 CTTATAAATATATAAATTCATGG - Intronic
923953166 1:238983781-238983803 ATTGAAAATATATAAATGAATGG - Intergenic
923959669 1:239063658-239063680 CAAAAAAATATATAATGCAAAGG + Intergenic
924268457 1:242306534-242306556 GTTAAAAATATATATATCACTGG - Intronic
1062973674 10:1667324-1667346 CTTAAAAATAGCTAAATCAGAGG - Intronic
1063328403 10:5129130-5129152 CTCAAAACTATACAAATACATGG + Intronic
1063574568 10:7250109-7250131 CCTAAAAATAAATAAATTAAAGG - Intronic
1063734456 10:8736755-8736777 TTCAAAATTATAAAAACCAAAGG - Intergenic
1063766901 10:9152397-9152419 TTAAAAAATATATGAATAAAAGG - Intergenic
1063801283 10:9581806-9581828 CTCAAAAGAAAAAAAATCAAAGG - Intergenic
1063834682 10:9999216-9999238 GACAAAAATATATAATTTAAGGG - Intergenic
1064050439 10:12055070-12055092 CTTAAAAATATAGAACTGAATGG - Intergenic
1064163430 10:12965518-12965540 CTCAAAAATCTAACAATCATCGG - Intronic
1064262694 10:13798714-13798736 CTCATAAATAAATAAATAAATGG + Intronic
1064293533 10:14056860-14056882 TTGAAAAATAAATAAATAAAAGG + Intronic
1064539346 10:16389767-16389789 CTCAAAAAAAAATAAAAAAATGG - Intergenic
1064620081 10:17206361-17206383 CTCTAAAATGTATAAATAATAGG + Intergenic
1064662405 10:17618740-17618762 CTCAAAAAAATAAAAAAAAAAGG + Intergenic
1064867417 10:19896610-19896632 CTCAAATATAAAAAAATCAAAGG - Intronic
1065162309 10:22935361-22935383 TTAAAAAATAAATAAATAAATGG + Intronic
1065243703 10:23735460-23735482 CTCAAATTTTTATAAATCTATGG + Intronic
1065252563 10:23831236-23831258 CACAAAAAAATATAGATAAATGG + Intronic
1065751673 10:28893321-28893343 ATAGAAAATATATAAATGAATGG - Intergenic
1065758341 10:28956562-28956584 AACAAAAATAAATAAATAAAAGG + Intergenic
1065837153 10:29669040-29669062 CTGACAAATAAATAAATGAATGG + Intronic
1066074607 10:31860636-31860658 CTCATATATAAATAAAACAATGG + Intronic
1066363118 10:34750306-34750328 GTCAAACATATATTAATCTATGG + Intronic
1066406645 10:35125828-35125850 CTCAAAAATAAAAAAAGTAATGG - Intergenic
1066471040 10:35698452-35698474 CTGAAACATCTTTAAATCAAGGG + Intergenic
1066583137 10:36902331-36902353 CTCAATAATTTATAAAGAAAAGG + Intergenic
1066619427 10:37328861-37328883 CTCAAAACTATAAAAATAAATGG + Intronic
1066716445 10:38292194-38292216 GTTAAAAATATATATATCACTGG + Intergenic
1067245955 10:44543999-44544021 CTCAAAACTATATAAGTATATGG - Intergenic
1067412986 10:46080910-46080932 CCCAAAAATATTTTAAACAAAGG + Intergenic
1067422137 10:46161138-46161160 CCCAAAATTAAATAGATCAAAGG - Intergenic
1067488297 10:46673430-46673452 ATAAAAAATAAATAAATAAAAGG + Intergenic
1067491874 10:46715638-46715660 TTAAAAAATAAATAATTCAAAGG + Intergenic
1067507443 10:46867235-46867257 CCCAAAATTAAATAGATCAAAGG - Intergenic
1067602785 10:47624737-47624759 TTAAAAAATAAATAATTCAAAGG - Intergenic
1067606506 10:47668598-47668620 ATAAAAAATAAATAAATAAAAGG - Intergenic
1067868660 10:49936773-49936795 CTCAAATATACAAAAATCAATGG + Intronic
1068011149 10:51453598-51453620 CTCAAAACTATACAAATACATGG - Intronic
1068184025 10:53562535-53562557 CTCAAAATTATACGAATAAATGG + Intergenic
1068209024 10:53896417-53896439 TTAAAAAATATATATCTCAAAGG - Intronic
1068224900 10:54095105-54095127 CTAAAATAGATAAAAATCAATGG + Intronic
1068546805 10:58356276-58356298 GGCAAAAATAAATAAATAAAAGG - Intronic
1068562892 10:58536420-58536442 CTCAAAACTGTATAAATACATGG + Intronic
1068838583 10:61584386-61584408 CAAAAAAATAAATAAATAAAAGG + Intergenic
1068986785 10:63114927-63114949 CTCAAAAAAATAAAAAGAAAAGG + Intergenic
1069123645 10:64601938-64601960 GTAAAAAATATAATAATCAAAGG - Intergenic
1069164640 10:65138104-65138126 GACAGACATATATAAATCAATGG - Intergenic
1069341417 10:67413782-67413804 CTCAAAATTACACAAATAAATGG + Intronic
1069390563 10:67930392-67930414 CACAAAAATCTGTAAACCAAGGG - Intronic
1069462464 10:68608533-68608555 CTCAAAAATAAATAAATAATAGG - Intronic
1069516800 10:69084063-69084085 CTCAAAAATATATTAAAGTAGGG + Intergenic
1069529633 10:69207004-69207026 CTCAAAAAAATAAAAAATAAGGG + Intronic
1069947503 10:71998140-71998162 CCCAAAAATAAATAAATCAAAGG + Intronic
1070074185 10:73119044-73119066 CTCAAAAAAAAAGAAAACAAAGG - Intronic
1070183049 10:74032757-74032779 CTCAAAAGTAGATATATAAATGG + Intronic
1070512122 10:77170953-77170975 CTCAAAAACATATGAAATAAAGG + Intronic
1071534586 10:86417368-86417390 CTCAAAAATAAGTAAATACATGG - Intergenic
1071744853 10:88405563-88405585 CTCAAAAAAATTTAAGTAAAGGG - Intronic
1072112825 10:92339367-92339389 CTCAAAAATAAATAAATAGCTGG + Intronic
1072159121 10:92749946-92749968 CTCAAAAATAAATAAATAAAGGG - Intergenic
1072581821 10:96746413-96746435 CTAATAAATAAATAAATAAATGG + Intergenic
1073722672 10:106191286-106191308 AAGAAAAATATATAAATCATTGG + Intergenic
1073944434 10:108733638-108733660 TTTATAAATATATAAATTAAGGG + Intergenic
1074042623 10:109807194-109807216 AACATAAATATATAAATTAATGG + Intergenic
1074195914 10:111185144-111185166 TTTTAAAATATATAAATCATAGG - Intergenic
1074466620 10:113688698-113688720 CTCAAAACTATATAAAAACAAGG - Intronic
1074565737 10:114576132-114576154 CTCTATAATATATAAATAATTGG - Intronic
1074605962 10:114966336-114966358 TTTAAAAATAAATACATCAATGG - Intronic
1074626550 10:115195306-115195328 CTCAGAAAAATAAAAACCAAAGG - Intronic
1075019650 10:118942265-118942287 CTTAAAAATATAAAAATTAGCGG - Intergenic
1075118127 10:119644232-119644254 CTCAAACATAAGTGAATCAACGG - Intergenic
1075819599 10:125295469-125295491 ACCAAAAATATAGAAATAAATGG + Intergenic
1076089558 10:127670403-127670425 CTGAAAAATATAAAAATTACTGG + Intergenic
1076210491 10:128639579-128639601 ATCAAAAAAATCTAAATAAATGG + Intergenic
1076468448 10:130702040-130702062 CTGGAAAATATATAATGCAAAGG - Intergenic
1076839148 10:133037111-133037133 ATTAAAAATAAATAAATAAAAGG - Intergenic
1077450735 11:2642948-2642970 TTCAAAACTGTATAAATAAATGG - Intronic
1077685965 11:4292266-4292288 CTCAAAAATAAATAATAAAAAGG + Intergenic
1077691114 11:4343424-4343446 CTCAAAAATAAATAATAAAAAGG + Intergenic
1077740148 11:4837206-4837228 CTCAAAAATAAATAAATGTTAGG - Intronic
1077759669 11:5079216-5079238 CATAAAAGTATAAAAATCAATGG + Intergenic
1077821250 11:5743583-5743605 CTCAAAAATATACAAATACTTGG + Intronic
1077824452 11:5789682-5789704 CTCAAAAATATTTGATTCTATGG - Intronic
1078116475 11:8457074-8457096 ATCAAAAGTAGACAAATCAATGG - Intronic
1078163336 11:8861166-8861188 AACAAAAATAAATAAATAAATGG + Intronic
1078294428 11:10053109-10053131 GTTAAAAATATATAAATACATGG - Intronic
1078381650 11:10847739-10847761 CAAAAAAATAAATAAATAAATGG - Intronic
1078411579 11:11124787-11124809 AACAAAAATAAATAAATAAATGG - Intergenic
1078808471 11:14732481-14732503 CTCAAAAATCTATAATTAAAAGG - Intronic
1078842217 11:15088981-15089003 CTCAAAATTATACAAATACATGG - Intergenic
1078883513 11:15476925-15476947 CTGAAAAAAATAAAAATAAAAGG + Intergenic
1079369359 11:19837246-19837268 TTTAAAAATAGATATATCAATGG + Intronic
1079564302 11:21862945-21862967 ATCAAGAAGATATAAATAAATGG - Intergenic
1079740192 11:24049004-24049026 CTCAACAAAATATAAATGCAAGG + Intergenic
1079973877 11:27068582-27068604 AACAAAAATACATAAATAAATGG - Intronic
1080101058 11:28459983-28460005 TTCAAAAACACATAAATAAATGG - Intergenic
1080337292 11:31212380-31212402 CTAAAAAATGTATAAGACAAAGG + Intronic
1080358319 11:31479367-31479389 CACAGAAAGATATAAACCAATGG + Intronic
1080436075 11:32245979-32246001 CTCCAAAATATATAAACCAGTGG + Intergenic
1080805999 11:35654562-35654584 TTCCAAAATAAATAAATAAATGG + Intergenic
1080844911 11:36018576-36018598 CTTAGAAATATATAAATGCAGGG - Intronic
1080947554 11:36991523-36991545 CTCATAAATATAAAAATAGATGG + Intergenic
1081012070 11:37826112-37826134 TTCAGAAAGATATAAAACAAAGG - Intergenic
1081060138 11:38464320-38464342 TGCAAAAATAAATAAATAAATGG + Intergenic
1081155500 11:39684523-39684545 GACAAAAATAAATAAATGAAAGG - Intergenic
1081249458 11:40811932-40811954 ATCAGATATATAGAAATCAATGG + Intronic
1082099889 11:48163869-48163891 ATAAACAATATATAAATAAATGG - Intronic
1082104454 11:48205818-48205840 CTCAAAATTATACAAATACATGG - Intergenic
1082126936 11:48444121-48444143 CTCAAAACAATACAAATCCATGG - Intergenic
1082560515 11:54615099-54615121 CTCAAAACAATACAAATCCATGG - Intergenic
1082917160 11:58449730-58449752 CTCAAAAATAGATATACAAATGG + Intergenic
1082983923 11:59150293-59150315 ATCAAAAATAAATAAATAAAAGG - Intronic
1083049466 11:59764016-59764038 CTCAAAAAAAAAAAAATAAAAGG + Intronic
1083448201 11:62725196-62725218 CTCAAAAAAATATATATTGAAGG - Intronic
1083537492 11:63483458-63483480 CTCAAAACTATACAAATACAAGG + Intronic
1083576450 11:63795425-63795447 CAAAAAAATAAATAAATAAAAGG - Intergenic
1083942547 11:65904649-65904671 CTCAAAAATAAATAAATAAATGG - Intergenic
1084142571 11:67242834-67242856 CTGGAAAACAAATAAATCAAAGG - Intronic
1084663868 11:70565243-70565265 CTCAAAAATAAATAAATGGATGG - Intronic
1084783265 11:71425350-71425372 CTCAAAAATAAAAAAAAGAAAGG + Intergenic
1085105143 11:73835921-73835943 ATTAAAAATAAATAAATAAATGG - Intronic
1085177283 11:74500875-74500897 CTCTTAAATAAATAAATAAATGG - Intronic
1085451002 11:76632868-76632890 CTTAAGAAGATATATATCAAGGG + Intergenic
1085636557 11:78163706-78163728 CTGGAAAATACAGAAATCAAGGG + Intergenic
1085676772 11:78528225-78528247 CTAAAAAAAATAAAAATAAATGG + Intronic
1085858294 11:80201253-80201275 CTCAAAATTACATAATTGAAAGG + Intergenic
1085925882 11:81020323-81020345 CACAAAAATAGACAGATCAATGG - Intergenic
1086270921 11:85065665-85065687 CTCAAAAGTATAAAAATACATGG + Intronic
1086391948 11:86374616-86374638 CTTAAAAATAAATAAATAATGGG - Intergenic
1086769371 11:90742935-90742957 CTCATAAATAAATACATTAATGG - Intergenic
1086803562 11:91209567-91209589 CTCAAAAAATTATGAAACAAAGG + Intergenic
1086940928 11:92797815-92797837 CCCTAAAATACAGAAATCAATGG - Exonic
1087030700 11:93701362-93701384 CAAAAAAATAAATAAATGAAAGG + Intronic
1087084853 11:94206944-94206966 CTCAAAAAAATAAAAATAAAAGG - Intergenic
1087176589 11:95101987-95102009 TTCAAGAATATATAACTCACAGG + Intronic
1087263183 11:96033571-96033593 CTCAAAAATTTTTGAATAAATGG + Intronic
1087427665 11:98011935-98011957 CTCACAATTTTATATATCAATGG + Intergenic
1087577170 11:100003794-100003816 CTCAAAAGTAAATACATAAAAGG + Intronic
1087583080 11:100083715-100083737 ATCACAAATATCTAAATTAATGG + Intronic
1087594365 11:100235180-100235202 GTACAAAATATATAAATAAATGG - Intronic
1087619597 11:100526524-100526546 CTCAAAAAAATATATACAAATGG + Intergenic
1088021688 11:105127282-105127304 CTCAAAAGTATAAAACTCACTGG + Intergenic
1088180759 11:107106821-107106843 CTCAAAACTATACAAATACATGG + Intergenic
1088235316 11:107717019-107717041 CTCAAAAAAATAAAAAGAAAGGG + Intronic
1088255785 11:107902322-107902344 CAAAAAAATAAATAAATAAAAGG + Intronic
1088413282 11:109560412-109560434 CTCAAAACTATACAAATACATGG - Intergenic
1088413563 11:109564645-109564667 CTCAAAACTATACAAATACATGG - Intergenic
1088525742 11:110752112-110752134 CTCAAAACTATACAAATACATGG - Intergenic
1088632779 11:111789833-111789855 CTTAAAAATATAGAAAACAGAGG + Intronic
1088800311 11:113299836-113299858 CTCAAAACTATACAAATACAGGG + Intergenic
1088806278 11:113355759-113355781 CTCAAAACTATATAATTAAATGG - Intronic
1089665774 11:120017737-120017759 CTCAAAGATATGCAAATCCAAGG + Intergenic
1089670004 11:120049002-120049024 CTCAGAAAAATAGAAATGAAGGG + Intergenic
1089693050 11:120198478-120198500 CTCTAAAATAAATAAATAAGAGG + Intergenic
1089851880 11:121504674-121504696 CAAAAAAATAAATAAATAAAAGG - Intronic
1090286864 11:125507081-125507103 CTTAAGAATATATAAAGGAAGGG + Intergenic
1090391625 11:126392620-126392642 CTGACAAATATTTAAATGAATGG - Intronic
1090507710 11:127336995-127337017 CTCATAAATACAAAAATTAAAGG + Intergenic
1090509693 11:127361872-127361894 ATCAAATATATTTAAATCTATGG - Intergenic
1090549220 11:127801256-127801278 ATTAACAATACATAAATCAATGG + Intergenic
1090569914 11:128034719-128034741 CTAATAAATAGATAAATAAAGGG - Intergenic
1090813845 11:130272902-130272924 CACAAGGACATATAAATCAATGG - Intronic
1090993810 11:131846387-131846409 CCAAAGAATATATAAAACAAAGG - Intronic
1091063725 11:132489368-132489390 TTAAAAAATATATAAGTAAAAGG + Intronic
1091305691 11:134534738-134534760 CTCTAAAAAATAAAAATAAAAGG + Intergenic
1091516468 12:1187816-1187838 CTATAAATTATATAAGTCAAGGG - Intronic
1091905231 12:4180858-4180880 CTAAATAATATATGGATCAAAGG + Intergenic
1091973230 12:4805640-4805662 CTCAAAAATAGATAAGAGAATGG - Intronic
1092330842 12:7585734-7585756 CTCAAAAATACACAAATGCATGG + Intergenic
1092703140 12:11255885-11255907 CACAAAAATACCAAAATCAAAGG - Intergenic
1092802707 12:12186539-12186561 CTAAAAAATACAAAAATTAATGG - Intronic
1092811749 12:12277067-12277089 CTCAAAAATAAATAAATAAATGG + Intergenic
1092905629 12:13098303-13098325 ATTAAAAATAAATAAATAAAAGG - Intronic
1092935605 12:13360824-13360846 CCCAAAAAAATATAATTAAAAGG - Intergenic
1093465652 12:19446116-19446138 CGCAAAAATAAATTAATCATAGG - Intronic
1093533683 12:20198290-20198312 CTCAAAACTATACAAATATATGG - Intergenic
1093666805 12:21824163-21824185 CTCAAAAAACTAGATATCAATGG - Intronic
1093945564 12:25104790-25104812 TTTAAAAATATATAAATAGATGG - Intronic
1094068644 12:26388461-26388483 CAAAAAAATAAATAAATAAAAGG - Intronic
1094115212 12:26903958-26903980 TTTAAAAATAAATAAATAAAAGG + Intergenic
1094165830 12:27442605-27442627 TCAAAAAATAAATAAATCAATGG - Intergenic
1094621280 12:32082871-32082893 CTCAAAAATATATATATATTTGG - Intergenic
1094783921 12:33823719-33823741 CACAAAAATATATAATCAAATGG - Intergenic
1095041259 12:37443625-37443647 CTAACAAATATATAGATCAATGG + Intergenic
1095121071 12:38419977-38419999 CTCAAAACCATATAAATACATGG + Intergenic
1095157836 12:38880245-38880267 CTGAAAAATAGATAAATAAAAGG - Intronic
1095402715 12:41833616-41833638 CCTAAAAGTATATAAATCCAAGG + Intergenic
1095522958 12:43089207-43089229 CTCAACAATCTATAAATAAAAGG - Intergenic
1095531609 12:43193068-43193090 CTCAAAAGAATATATATAAATGG - Intergenic
1095647575 12:44566162-44566184 TTCAAAATTACATAACTCAATGG + Intronic
1095774463 12:45997163-45997185 CTCAAAAAAATATATATATATGG - Intergenic
1095831705 12:46594053-46594075 CTGAAAAATATAGAAATATATGG - Intergenic
1095973267 12:47920127-47920149 CTTAAAAATATATTCGTCAATGG + Intronic
1096236417 12:49930372-49930394 CTTAAAAATGTATAAAGCTATGG + Intergenic
1096270559 12:50163197-50163219 CTCAAAAATAAATAAATATTGGG - Intronic
1096281928 12:50262816-50262838 CTCAAAAATAAGTAAGTAAAGGG + Intronic
1096313488 12:50543290-50543312 CTCAAAAATAAATAAAAAAGGGG - Intronic
1096657398 12:53100158-53100180 CTCAAAAATAAATAAATTATTGG - Intronic
1096667353 12:53174789-53174811 TTCAAAAATATATATATATATGG + Intronic
1096897354 12:54836872-54836894 CTCAAAACTATACAAATACATGG - Intronic
1096902178 12:54895798-54895820 ATTAAAAATATGTAAATCCAAGG - Intergenic
1096935044 12:55264295-55264317 ATCAAATATATATATATGAATGG + Intergenic
1096990565 12:55798495-55798517 CTCAAAAATAAATAAATAAAGGG + Intronic
1097868032 12:64576191-64576213 CTCAAAAATAAACAAACCAAAGG + Intergenic
1098406769 12:70134801-70134823 CTCAAAACTATACAAATACATGG + Intergenic
1098518852 12:71412068-71412090 CTCAAAATTATACAAATACATGG + Intronic
1098596870 12:72283182-72283204 CTCAAAAATAAATGATTAAAAGG + Intronic
1098654467 12:73010517-73010539 CTCAAAATTATACAAATACATGG - Intergenic
1098836969 12:75435277-75435299 CTCAAAACTATACAAATACATGG - Intergenic
1098961077 12:76740058-76740080 CTCAAAAATATAAAAAAGAGAGG + Intergenic
1099106279 12:78500262-78500284 TTAAAAAATATATAAATAATCGG + Intergenic
1099397701 12:82161089-82161111 CTCAAAAATATATTTATCTGGGG - Intergenic
1099487576 12:83247668-83247690 CTCAAAACTATATAATTCCATGG - Intergenic
1099726672 12:86439326-86439348 CTCAAAACTATACAAATACATGG + Intronic
1099768660 12:87023638-87023660 CTCAAAACTATAAAAATACAAGG + Intergenic
1099833066 12:87870290-87870312 CTCCTAAATATCCAAATCAATGG - Intergenic
1100052689 12:90469392-90469414 ATGAAAAATATAAAACTCAATGG - Intergenic
1100325149 12:93533336-93533358 ATCAAAAATGAATAAATCACAGG + Intergenic
1100678031 12:96889081-96889103 CAAAAGAACATATAAATCAAGGG - Intergenic
1100683976 12:96965385-96965407 CATAAAAATATATAAACCAGTGG + Intergenic
1101184567 12:102261339-102261361 AACAAAAATAAATAAATAAATGG - Intergenic
1101271659 12:103152827-103152849 CTATAAAATATTTAAATAAAGGG + Intronic
1101294249 12:103404342-103404364 GGCAAAAATAAATAAATAAAAGG + Intronic
1101761391 12:107661643-107661665 CTAAAAAATACAAAAATTAACGG + Intergenic
1102144517 12:110644863-110644885 CTCAAAAATAAATAAACAAAGGG + Intronic
1102332059 12:112042401-112042423 TTAAAAAATAAATAAATAAAAGG + Intronic
1102725144 12:115056869-115056891 ATAAAAAATATATATAACAATGG - Intergenic
1103162157 12:118738457-118738479 CACAAAACCATACAAATCAAGGG - Intergenic
1103558541 12:121780055-121780077 CTCAAAAATAAATAAATAAAAGG - Exonic
1103753365 12:123182911-123182933 CTCAAAAATAAATAAATAAGAGG + Intronic
1104274571 12:127313443-127313465 CTCTAAAATATTTAAGCCAATGG - Intergenic
1104308344 12:127631015-127631037 CTCTGAAATATTTAAATGAAAGG + Intergenic
1104325839 12:127797299-127797321 CTCAAAGAAATTTAATTCAAAGG - Intergenic
1104421593 12:128640586-128640608 ATTTAAAATATATAATTCAATGG - Intronic
1104643768 12:130483403-130483425 ATTAAAAATAAATAAATAAAAGG + Intronic
1104669517 12:130670772-130670794 CTCATAAATAAATAAATAAATGG - Intronic
1104796083 12:131520055-131520077 TTCAAAAAAAAAAAAATCAAAGG + Intergenic
1105035614 12:132918576-132918598 CTCAAAAAAAGAGAAAACAAGGG - Intronic
1105331222 13:19417460-19417482 CTCAAAACTACATAAATACATGG + Intergenic
1105669118 13:22592768-22592790 CTCAAAAAGTTATGAATCATAGG - Intergenic
1105697351 13:22901568-22901590 CTCAAAGATGTAAAAATAAATGG - Intergenic
1105735298 13:23262856-23262878 CTCAAAATTATACAAATGTATGG + Intronic
1105802400 13:23918963-23918985 CTCAACAATCTAGACATCAAAGG + Intergenic
1105820514 13:24076985-24077007 CTCAACAACATATGAATCAAAGG - Intronic
1105880669 13:24603712-24603734 CTCAAAACTACATAAATACATGG - Intergenic
1106572764 13:30942527-30942549 AACAAAAATAAATAAATAAATGG - Intronic
1106597404 13:31158216-31158238 CTAAAAATTAGATAAATGAAAGG + Intronic
1106710788 13:32330031-32330053 CTGAAAAATATAAAAATTACTGG - Intronic
1106840935 13:33684283-33684305 CTAAAAAATATAAAAATTACCGG + Intergenic
1107253079 13:38389644-38389666 CTCAAAACTATACAAATACATGG - Intergenic
1107296934 13:38919209-38919231 CTCAACAATCTAGACATCAAAGG - Intergenic
1107354307 13:39550091-39550113 CTTTAAAATATATAATTCAATGG - Intronic
1107484867 13:40816305-40816327 TTCAAAAATACATAAATACATGG + Intergenic
1107619063 13:42206176-42206198 CTCAAAAATAATTATATCACTGG + Intronic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1108098669 13:46932225-46932247 GTAAAACATATATAAATGAATGG + Intergenic
1108156163 13:47586958-47586980 CTCAAGAATATAGACATCAAGGG + Intergenic
1108160699 13:47635487-47635509 TTCAAAAAAAAAAAAATCAACGG + Intergenic
1108435087 13:50393984-50394006 CTAAAGAAGATATAAATAAATGG + Intronic
1108648560 13:52453677-52453699 CTCAAAAATAGACATATCATTGG + Intergenic
1108744345 13:53376237-53376259 CTGAAACATGTATAAATAAAAGG - Intergenic
1108845567 13:54675939-54675961 CGCAAAAATAGATTAATGAATGG + Intergenic
1108982939 13:56542861-56542883 TTAAAAAATAAATAAATAAAAGG - Intergenic
1109094741 13:58098360-58098382 CCACAAAATATATAAAACAATGG - Intergenic
1109174594 13:59139475-59139497 CACAAAAATATCCAACTCAATGG + Intergenic
1109485862 13:63018336-63018358 CTGAAAAATTTATAAATGCATGG + Intergenic
1109508650 13:63338497-63338519 CCCAAAAGTATAAAAATAAAAGG - Intergenic
1109521656 13:63520228-63520250 CTACAAAATATAGTAATCAAAGG + Intergenic
1109662450 13:65481341-65481363 TTCAAAAATATATAAATACGTGG - Intergenic
1109853981 13:68105073-68105095 CTTAAAAATATAAAAATCAGTGG - Intergenic
1109907810 13:68867766-68867788 CTCAAAACTATACAAATGCATGG + Intergenic
1109916292 13:68988848-68988870 ATAAAAAATAAATAATTCAAAGG - Intergenic
1109983380 13:69941300-69941322 CTCAAAACTATACAAATGCATGG + Intronic
1109995485 13:70118959-70118981 CTCAAAAATATGTCAAGCCATGG + Intergenic
1110194521 13:72771897-72771919 CTTAAAAAGATAAAAATAAAAGG + Intronic
1110390162 13:74964231-74964253 CTAAAACATATATAGACCAATGG + Intergenic
1110390372 13:74966677-74966699 CTCAAAACTATAAAACACAAGGG + Intergenic
1110423109 13:75335459-75335481 CTGAAAAAAGTATAAATTAATGG - Intronic
1110490440 13:76097937-76097959 AACAAAGATATATAAAACAACGG + Intergenic
1110631888 13:77718132-77718154 CTCTAAAATATAGATCTCAATGG - Intronic
1110635127 13:77758437-77758459 CTCAAACAAAAATAAATAAATGG - Intronic
1110660132 13:78050979-78051001 CGCAAAAATATAAAACCCAATGG + Intergenic
1110667656 13:78136710-78136732 GTCAACAATATTTAAGTCAAGGG + Intergenic
1110877111 13:80523454-80523476 CTCAAAAAAATAGAAATTGAGGG - Intergenic
1110946133 13:81420705-81420727 CTCAAAACTATACAAATACATGG - Intergenic
1111135725 13:84040014-84040036 CTCAAAAATTTATAACTGTATGG - Intergenic
1111153618 13:84293184-84293206 CCCATAAATATAAAAATCATAGG + Intergenic
1111207135 13:85025945-85025967 CTTAAAGACATATAAATCAATGG - Intergenic
1111231736 13:85353509-85353531 ATGTAAAATACATAAATCAAAGG + Intergenic
1111578209 13:90187002-90187024 CGCAAATATATAAAATTCAAAGG - Intergenic
1111790123 13:92844727-92844749 CTATAAAACATATAAATAAATGG + Intronic
1111812786 13:93112775-93112797 TTCAAAGATAAATTAATCAAGGG - Intergenic
1111819762 13:93197955-93197977 CTCAAAACTATACAAATATATGG - Intergenic
1111856380 13:93642649-93642671 CACAAAAATATAAAAATGAGAGG - Intronic
1112002242 13:95221799-95221821 TTAAAAAATAAATAAATCATTGG + Intronic
1112075430 13:95907808-95907830 CTGAAAATTCTAAAAATCAAAGG + Intronic
1112217297 13:97446298-97446320 CTCAAAAATATATGCACAAATGG - Intronic
1112718378 13:102213291-102213313 CTGGAAAAAATATAAATGAAAGG + Intronic
1112775027 13:102834387-102834409 TTCAAATATATATTAATAAAAGG - Intronic
1113000073 13:105624905-105624927 ATCAAATATTTATAAATTAAGGG + Intergenic
1113278033 13:108756302-108756324 CTCATACATATATAATTCAAAGG - Intronic
1113293400 13:108930804-108930826 ATCAAATATAAATAAACCAATGG + Intronic
1113381929 13:109812435-109812457 CTCATAAATATATACACCTACGG + Intergenic
1113496539 13:110734674-110734696 CCCTAAAATAAATAAATAAATGG - Intergenic
1113617303 13:111689913-111689935 CTTAAATATATGTAAATTAAAGG - Intergenic
1113622832 13:111775183-111775205 CTTAAATATATGTAAATTAAAGG - Intergenic
1114698433 14:24650061-24650083 CTCAAAACTATACAAATACATGG + Intergenic
1115180042 14:30613340-30613362 ATCAAATATATTTAAATCTATGG - Intronic
1115393378 14:32878690-32878712 CTGAAAACTATATAAATACATGG - Intergenic
1116031048 14:39572134-39572156 CTTAAAAATACATAGACCAATGG - Intergenic
1116099347 14:40412800-40412822 CTAAAAAATATATAAGTGATTGG - Intergenic
1116187700 14:41618844-41618866 CTCAAAAATATATGAATCCATGG - Intronic
1116752597 14:48905459-48905481 ATTAAAAATAAATAAATAAAAGG + Intergenic
1117240954 14:53832050-53832072 CTCAAAACTATACAAATACATGG + Intergenic
1117288379 14:54309241-54309263 CTCTCAAATAAATAAATAAAAGG + Intergenic
1117473165 14:56067205-56067227 ATTTAAAATATATAATTCAATGG - Intergenic
1117794095 14:59374036-59374058 CTCAAACATAAATAATTCATAGG - Intergenic
1117828191 14:59725255-59725277 CTCAAAAGTAGATAAATCTGAGG - Intronic
1117836950 14:59817624-59817646 CTTAAAAAAAAAAAAATCAAAGG - Intronic
1117923571 14:60751900-60751922 ATTAAATATATATAAATCAGTGG - Intronic
1117964923 14:61197211-61197233 TTCAAAACAATATAAATAAAAGG + Intronic
1118152671 14:63206536-63206558 TTCAAAAACTTTTAAATCAAAGG + Intronic
1118179015 14:63472298-63472320 CTCAAAAAAAAATAAAATAAAGG + Intronic
1118192040 14:63589543-63589565 CAGAAAAATAAATAAATAAAAGG - Intergenic
1118385253 14:65250855-65250877 CAGAAAAATAAATAAATGAAAGG + Intergenic
1118664896 14:68057087-68057109 CTCAAAAAAAAAAAAAACAAAGG + Intronic
1118800543 14:69185566-69185588 CTTAAAAAAAAAAAAATCAATGG + Intergenic
1118828095 14:69402668-69402690 CTTAAAAATTTATAAAACAAAGG + Intronic
1119521902 14:75292865-75292887 CTCAAAAATAAATAAGCAAAAGG - Intergenic
1120551384 14:85877135-85877157 CACCAAAATATGCAAATCAATGG + Intergenic
1120785514 14:88531139-88531161 CTCAAAACTATATAAATAAATGG + Intronic
1120959256 14:90109708-90109730 CTCAAAAAAAAAAAAATAAAGGG - Intronic
1121136262 14:91501648-91501670 CTCAAAAAAAGAAAAGTCAATGG + Intronic
1121147879 14:91601782-91601804 CCCAAAAATATATAAAGTTAGGG + Intronic
1121206117 14:92169176-92169198 TCCAAAAATATTTAAAACAAGGG - Exonic
1121287816 14:92750070-92750092 CTCAATAATACCTAAGTCAATGG - Intergenic
1121375784 14:93409685-93409707 CTGTAAAATAAATAAATAAATGG + Intronic
1121395693 14:93621143-93621165 CATACATATATATAAATCAACGG - Intronic
1121663869 14:95657032-95657054 TTCCAAAATAAATAAATAAAAGG - Intergenic
1121831929 14:97060225-97060247 CTCACAAATAAATAAATTCATGG + Intergenic
1122473755 14:101991170-101991192 CTCAAAAAAACAAAAAGCAAAGG + Intronic
1122541712 14:102501541-102501563 CTCAAAAATAAATAAATAGAAGG + Exonic
1122567350 14:102669791-102669813 ATCAAAAAGATAGAAATCAAAGG - Intronic
1122709029 14:103641929-103641951 CTCAAAAAAATAAAAAATAAAGG - Intronic
1123005626 14:105321659-105321681 CTCAAAAATATATTAAGTGACGG - Intronic
1123024189 14:105416333-105416355 CTGAAAAATATAAAAATTAGCGG - Intronic
1123892926 15:24799333-24799355 TTCAAAAATGTAAAAATAAAGGG - Intergenic
1124082104 15:26509409-26509431 GTAAAAAATAAATAAATAAAAGG + Intergenic
1124241240 15:28029722-28029744 TCTGAAAATATATAAATCAATGG + Intronic
1124583225 15:30980914-30980936 CTGAATAATAAATAAATAAATGG + Intronic
1124590017 15:31045301-31045323 CCTAAAAATATTTAAATGAATGG - Intronic
1125362876 15:38882624-38882646 GTCAAAAATAAATAAATAAAAGG + Intergenic
1125757435 15:42073001-42073023 CTCAAAATAAAATAAAACAAAGG - Intronic
1126293520 15:47110074-47110096 CTAACAAATATATAGACCAATGG - Intergenic
1126504322 15:49386352-49386374 CTCAAAACTATACAAATACATGG + Intronic
1127090462 15:55461487-55461509 CTCAAAACTATACAAATATATGG + Intronic
1127235085 15:57040634-57040656 TTCAAAAATAAATAAACCATAGG - Intronic
1127676038 15:61239998-61240020 CTCAAAATTCTATAAATACATGG + Intergenic
1128006697 15:64249131-64249153 ATAATAAATATATAAATAAATGG + Intronic
1128163518 15:65440768-65440790 CTCAAAAAAATAAAAAGTAATGG - Intergenic
1128884650 15:71275572-71275594 CTGATAAATATATAAAGCATGGG - Intronic
1129094492 15:73189147-73189169 ATCAAAGATATAAAATTCAATGG - Intronic
1129316136 15:74745784-74745806 CTCAAAAATAAATAAATAAATGG - Intergenic
1129427953 15:75478404-75478426 CTCAAAAATAAATAAATTAAAGG - Intronic
1130139566 15:81213177-81213199 CTCAAAACTACATAAATGCATGG - Intronic
1130533854 15:84768939-84768961 CTCAAAAAAAAATAAAAGAAAGG - Intronic
1130560405 15:84953793-84953815 GTAAAAAATGTATAAATCAGAGG + Intergenic
1130779433 15:87019344-87019366 CTCTAAAATTTATAAATAATTGG + Intronic
1130859446 15:87873702-87873724 TTCATAAATAAATAAATAAATGG + Intronic
1131004820 15:88968868-88968890 CTCAAAATTATACAAATATATGG - Intergenic
1131105450 15:89730881-89730903 CTCAAAAAAAAAAAAATTAATGG + Intronic
1131535578 15:93234587-93234609 CACAAGAATATATAATGCAAGGG - Intergenic
1131606919 15:93915311-93915333 AGCCAAAATATAAAAATCAAAGG - Intergenic
1131703440 15:94966307-94966329 CTAAAAAATACAAAAATCAGCGG - Intergenic
1131733267 15:95304479-95304501 CTAGAAAATAAATAAATAAAGGG + Intergenic
1131886517 15:96921010-96921032 CTAACAAATGTATTAATCAAAGG - Intergenic
1132116738 15:99142427-99142449 CTCATAAATATATAAACACAGGG - Intronic
1132137792 15:99360517-99360539 TTAAAAAATAAATGAATCAAGGG + Intronic
1132158619 15:99515454-99515476 CTCAAAAATAAATAAATAAATGG - Intergenic
1132334324 15:101035826-101035848 CACAAAAGTATAAAAATCACTGG - Intronic
1133243672 16:4432185-4432207 ATTAAAAATAAATAAATAAATGG - Intronic
1133499580 16:6353324-6353346 CACAGAAATAAATAAATTAATGG - Intronic
1133548840 16:6834234-6834256 CTAAAAAATATAAAAACTAATGG - Intronic
1133573913 16:7069175-7069197 TTAAAAAATAAATAAATTAAAGG - Intronic
1134245675 16:12538114-12538136 CTCAAAAATAAAAAAATGCAAGG - Intronic
1134386135 16:13774236-13774258 CAAAAAAATAAATAAATAAAGGG + Intergenic
1134867178 16:17618941-17618963 CCAAAAATTATACAAATCAATGG + Intergenic
1135013471 16:18904634-18904656 CTCAAAAAAAAATAAAATAAAGG + Intronic
1135273929 16:21094663-21094685 CTCAAATATATATATATATATGG + Intronic
1135277193 16:21123567-21123589 CTCAAAAATATAGAAACCAGTGG - Intronic
1135347508 16:21701615-21701637 CAAAAAAATAAATAAATAAAAGG - Intronic
1135426238 16:22339116-22339138 CTCAAAAATAAATAAAAGAAAGG + Intergenic
1135500221 16:22989824-22989846 CTGGACAATATATAAATGAACGG - Intergenic
1135589230 16:23693284-23693306 CTCAAAAATATATATATATAGGG + Intronic
1135615623 16:23908529-23908551 CTCAAAAAAAAAGAAATAAAGGG - Intronic
1136012956 16:27376346-27376368 CTTAAAAATATATAACTCAGTGG + Intergenic
1137289134 16:47039715-47039737 CTGAAAAATAAGGAAATCAAAGG - Intergenic
1137414930 16:48267298-48267320 CTCAAAAATATATATATGAATGG - Intronic
1137536579 16:49331595-49331617 ATAAAAAATAAATAAATAAAAGG + Intergenic
1137678988 16:50322304-50322326 CTTATAAATATGTAAATAAATGG + Intronic
1138032331 16:53569645-53569667 CTCAAAAATAAAGAAAGTAAAGG - Intergenic
1138089756 16:54164632-54164654 TTTAAAAATATACAATTCAATGG - Intergenic
1138652494 16:58468712-58468734 CTCAAAAATATATATATTGTGGG + Intronic
1138883634 16:61048333-61048355 CTCAAAACTATACAATTAAATGG - Intergenic
1139024159 16:62793371-62793393 CTCAAAACTATACAAATACATGG - Intergenic
1139296395 16:65905330-65905352 CTCAAAGAAATATAAATAAGAGG + Intergenic
1139678381 16:68540539-68540561 TTCACCAATATGTAAATCAATGG - Intronic
1139825015 16:69750164-69750186 CTAAAAAATACAAAAATCAGTGG - Intronic
1139831697 16:69803905-69803927 CTCAAAAAAAAATAAAGTAAAGG + Intronic
1140070346 16:71643675-71643697 CAAAAAAATAAATAAATAAATGG + Intronic
1140223633 16:73062269-73062291 CACAAAAATATATGCATAAAGGG + Intergenic
1140356216 16:74309062-74309084 CTTAAAAATATCTCAATGAAGGG + Intergenic
1140591132 16:76353998-76354020 ATCAAAACTATATAAATTAATGG + Intronic
1140844404 16:78872787-78872809 ATTAAAAATAAATAAATAAAAGG - Intronic
1141177790 16:81732121-81732143 CTCAACAATAAATAAACCAGCGG - Intergenic
1141270361 16:82534261-82534283 TTAAAAAATATATAAATAAAAGG - Intergenic
1141313638 16:82939420-82939442 CTCAAAAAAAATTAAATAAAAGG + Intronic
1141449758 16:84090634-84090656 TTTAAAAATATATAAATAGAAGG + Intronic
1142392838 16:89813887-89813909 CTCAAAAATTAATGAATTAAAGG + Intronic
1142511672 17:399460-399482 CTCAAAAAAAGAAAAAACAAAGG - Intergenic
1142824819 17:2502686-2502708 CTCAAAAAAAAAAAAATCAGTGG + Intronic
1142883669 17:2899509-2899531 CTCAAAAAAATAAAAATAAGTGG - Intronic
1143047252 17:4091774-4091796 CTCAAAAAAATATAAAAATAAGG + Intronic
1143050802 17:4124138-4124160 ACCAAAAATAAATAAATCACCGG - Intronic
1143824276 17:9591558-9591580 TTTAAAAATAGATAAAACAAAGG - Intronic
1144091078 17:11857057-11857079 CTGAAAAATATAAAAATTATCGG - Intronic
1144268779 17:13597622-13597644 CTCTAAAATAAATAAAACAAAGG - Intronic
1144603551 17:16641999-16642021 CTAAAGAATACATAAATAAATGG + Intronic
1144886732 17:18468023-18468045 CTCAGAAATAAATTAATAAAAGG + Intergenic
1145068733 17:19784196-19784218 CTCATAATTATAAAACTCAATGG + Intronic
1145145481 17:20476284-20476306 CTCAGAAATAAATTAATAAAAGG - Intergenic
1145691843 17:26750337-26750359 CTCAAAAACACAGAACTCAAAGG + Intergenic
1145722416 17:27086299-27086321 TTCAAAAAAATATATATCTAGGG + Intergenic
1145866096 17:28242614-28242636 CTACAAAATAAATAAATAAAAGG + Intergenic
1146556131 17:33825698-33825720 CTCAAAACTATAAAAACCTAAGG + Intronic
1146775252 17:35608676-35608698 CTTAAATATATATAAATTTACGG - Intronic
1146899524 17:36573855-36573877 CTTAAAAGTAAATAAATAAATGG - Intronic
1147202840 17:38814995-38815017 CTCAAAAACATATTTGTCAATGG + Exonic
1147285022 17:39395421-39395443 CTCAAAAATAAATAAATAAAAGG + Intronic
1147587637 17:41661541-41661563 CTCTAAAATAAATAAAATAAAGG + Intergenic
1148012272 17:44492569-44492591 CTCAAAAAAATAAAAAACTAAGG + Intronic
1148024062 17:44573500-44573522 CCCAAAATTTTATAAGTCAAGGG - Intergenic
1149055713 17:52362252-52362274 CACAAAAATATATAGATGAATGG + Intergenic
1149121979 17:53180162-53180184 CTCAAAAAAAGATAAACAAATGG - Intergenic
1149266031 17:54928569-54928591 CTGGAAAATATATAAATAACTGG - Intronic
1149527322 17:57366760-57366782 GGCAAAAATAAATAAATAAAAGG - Intronic
1149654630 17:58303646-58303668 CTCAAAAATAAAAAAATAAAAGG - Intronic
1149719015 17:58824393-58824415 CACAAAATTATAAAAATAAAAGG - Intronic
1149931443 17:60760285-60760307 CACAAAAATATAAAACTCACTGG - Intronic
1150188146 17:63208157-63208179 CACAAAAATATAAAATACAAAGG - Intronic
1150189931 17:63227844-63227866 ATGAAAAATAAATAAATAAATGG - Intronic
1150199047 17:63334452-63334474 ATCAATAATAAATAAATAAATGG + Intronic
1150282360 17:63936484-63936506 CTCAAAATTATACAAATATATGG - Intergenic
1151026591 17:70684523-70684545 TTCAAAAGTATATGAATGAATGG - Intergenic
1151209389 17:72533054-72533076 CTCAAAAAAATTTAAAAAAAAGG + Intergenic
1151609828 17:75165524-75165546 CTCAAAAAAACAAAAAACAAAGG + Intronic
1151644798 17:75423085-75423107 CTAATAAATAAATAAATAAAAGG + Intergenic
1151709139 17:75790628-75790650 CTGAAAAATAAATAAATAATTGG + Intronic
1152163163 17:78682260-78682282 GTCACAGAAATATAAATCAAAGG - Intronic
1153403411 18:4706924-4706946 ATCAAAAATGAATAAATCATAGG - Intergenic
1153424667 18:4948909-4948931 CTCAAAACTATACAATTCCATGG + Intergenic
1153556411 18:6318980-6319002 CTCAAAGCTATATAAATACATGG + Intronic
1153582209 18:6585044-6585066 CTCAAAACTATAAAAATACATGG + Intronic
1153702370 18:7709261-7709283 CTCAAAACTATACAAATAAATGG + Intronic
1153750332 18:8222921-8222943 CTCAAAAATAGATAAATAATAGG + Intronic
1155010667 18:21774789-21774811 ATAAAAAATAAATAAATAAATGG - Intronic
1155105333 18:22659380-22659402 CTCAAAATTATGTAAATACATGG + Intergenic
1155344923 18:24848538-24848560 CCCAAAAATTTCTAAAACAATGG - Intergenic
1155377776 18:25179988-25180010 CTTTAAAATACATACATCAAAGG - Intronic
1155499732 18:26475092-26475114 CACTGAAATATACAAATCAATGG - Intronic
1155607679 18:27626018-27626040 GTGAAAAATATATAGAACAATGG + Intergenic
1155743571 18:29321433-29321455 TTCAAAAATATATATATTTATGG + Intergenic
1155755240 18:29486180-29486202 CTCAAGAATATATATCTCAGAGG + Intergenic
1155772126 18:29714712-29714734 GACAAAAATAAATAAATAAATGG + Intergenic
1155804781 18:30155339-30155361 CTCCAAAATATAAGCATCAATGG + Intergenic
1155886988 18:31220152-31220174 CTCAAAACTATATGAATACATGG + Intergenic
1155992762 18:32296954-32296976 CTTACAAAAATATAGATCAAAGG + Intronic
1155994521 18:32316451-32316473 CTCAAAAATAAAGAAATGTAAGG - Intronic
1156314321 18:35952800-35952822 CTTCAAAATAAATAAATAAAAGG + Intergenic
1156645256 18:39154248-39154270 CATAAAAACATATAAACCAAAGG + Intergenic
1156929922 18:42629311-42629333 CAGAAAAATATAAAAATTAATGG - Intergenic
1157144200 18:45144621-45144643 CATAAAAATATATACCTCAATGG + Intergenic
1157204283 18:45685471-45685493 CAAAAAAATAAATAAATAAAAGG + Intergenic
1157930271 18:51814066-51814088 CTCAAAAATAAATAAGTGAAAGG - Intergenic
1158011120 18:52729256-52729278 CTCAAATAAATAAAAATAAAAGG - Intronic
1158788447 18:60744414-60744436 CTCATATAAATATACATCAAAGG + Intergenic
1158811630 18:61044333-61044355 TTCAAAAATATAAAAGACAAAGG - Intergenic
1158944978 18:62440392-62440414 TTGAAAAATATATCAAACAATGG - Intergenic
1158990223 18:62861110-62861132 CTCAAAAAAATAAAAAATAAAGG - Intronic
1159253666 18:65916363-65916385 GTCAAATATATATAATGCAATGG + Intergenic
1159419131 18:68193332-68193354 CTCAAAACTATATAAATATATGG - Intergenic
1159457738 18:68682995-68683017 ACCAAAAATAAATAAATAAAAGG + Intronic
1159662521 18:71115982-71116004 ATGATAAATATATAAATCTATGG - Intergenic
1159687657 18:71443503-71443525 GTATAAAATATATAAAACAATGG + Intergenic
1160303466 18:77707628-77707650 CAAACAAATATATAGATCAATGG + Intergenic
1160361190 18:78281292-78281314 ATAAATAATATATAAATAAATGG - Intergenic
1161463163 19:4411228-4411250 CTCAAAAATAAATAAATAAATGG - Intronic
1161490558 19:4558839-4558861 CACAAAAATATTAAACTCAAAGG + Intronic
1161695417 19:5764615-5764637 CTCAAAAATAAATAAATAAATGG - Intronic
1162023009 19:7876509-7876531 CTCAAAAATAAATAAATAGGAGG - Intergenic
1162290220 19:9774166-9774188 CTCAAAAATATAACAATCCCAGG + Intronic
1162355080 19:10178253-10178275 CTCAAAAAAAAATAAAATAAAGG + Intronic
1162649749 19:12078849-12078871 CTCAAAAAAAAAGAAATGAACGG - Exonic
1162889040 19:13718831-13718853 CTCAAAAATAAATAAATAAAAGG + Intergenic
1162893322 19:13749434-13749456 CCAAACAATATATAAATGAACGG - Intronic
1163705726 19:18811933-18811955 CTAAAAAATACAAAAATTAACGG - Intergenic
1164026057 19:21354310-21354332 CTCAAAACTATACAAATACATGG - Intergenic
1164660391 19:29960422-29960444 CTGTAAAATATATAAAGCAAAGG - Intronic
1164833349 19:31339951-31339973 TTAAAAAATAAATAAATAAAAGG - Intronic
1164863734 19:31585713-31585735 CTTAAAAATAAATATATAAATGG - Intergenic
1165013052 19:32862647-32862669 ATAAAAAATATATAAAAGAAAGG - Intronic
1165134966 19:33662033-33662055 CTCAAAAATGAATAAATAAAAGG + Intronic
1165188046 19:34038979-34039001 CTGAAAAAGATAGAAATCCATGG - Intergenic
1165200313 19:34138276-34138298 ACCAAAAATATATATATGAATGG - Intergenic
1165429703 19:35765577-35765599 CTCAAAAATAAATAAATAAATGG + Intronic
1165689022 19:37848478-37848500 AGCAAAAATATAAAAATCCAGGG + Intergenic
1165875298 19:39002396-39002418 CTCAAAAAAAAAAAAATTAATGG - Intronic
1166025547 19:40080843-40080865 ATTAAAAATAAATAAATAAATGG + Intronic
1166595617 19:44046576-44046598 TTTAAAAATATATAATTTAATGG - Intergenic
1167202972 19:48079958-48079980 CTCAAAAATAAACAAATATATGG + Intronic
1167224132 19:48225488-48225510 CTCAAAAATAAATAAATAAAGGG + Intronic
1167516555 19:49926694-49926716 TTCAAAAATCTATACAGCAATGG + Intronic
1167529132 19:50004037-50004059 TTAAAAAATAAATAAATAAAGGG + Intronic
1167610158 19:50503513-50503535 CTCATAAATAAATAAATAAGTGG - Intergenic
1167869570 19:52356536-52356558 CTCAAAAATATATAAATCAATGG - Intronic
1167872109 19:52379196-52379218 CTCAAAAATATATAAATCAATGG - Intronic
1167885551 19:52496935-52496957 CTCAAAAAAATAAAAATTAAAGG - Intronic
1167912886 19:52718498-52718520 CTCAAAAAAACAGAAATTAAAGG + Intronic
1167920882 19:52782221-52782243 CTCAAAAAAATAAAAATTAAAGG + Intronic
1167957528 19:53078407-53078429 CTCTAAAAAAAATAAATAAAAGG + Intronic
925175584 2:1781531-1781553 CTCAAAAAAATAAAGAACAAAGG - Intergenic
925467158 2:4116650-4116672 CAAACAGATATATAAATCAATGG - Intergenic
925677662 2:6382540-6382562 TTCAAAAATATATATATAGATGG + Intergenic
926263536 2:11291592-11291614 TTCAAAAAAATAAAAATAAAAGG + Intronic
926519527 2:13893940-13893962 CACAAAAATATAAAACTCACTGG - Intergenic
926578369 2:14607932-14607954 CACAAAAAAATAAAAATCAGAGG + Intergenic
926950841 2:18241507-18241529 CACATAAATATATGAATCCATGG + Intronic
927360447 2:22226065-22226087 CTCAAAAAACTAGAAATAAAAGG - Intergenic
927379238 2:22458906-22458928 ATTAAAAATAAATAAATAAAAGG - Intergenic
927749774 2:25657173-25657195 CTCAAAAATAAATAAATGAAAGG + Intronic
927790258 2:26003945-26003967 CTCAAAAAAATATAAATGGCTGG + Intergenic
927791262 2:26011591-26011613 CTCAAAAATAAAAAAGTCAGGGG - Intergenic
927793330 2:26027983-26028005 ATAAAAAATAAATAAATAAATGG - Intergenic
928044152 2:27910641-27910663 TTTAAAAATATATATATAAATGG + Intronic
928159646 2:28910601-28910623 ATCAAAAATATATATTACAAAGG - Intronic
928232106 2:29507287-29507309 CTCAAAAATGTAGAATTCGATGG - Intronic
928473190 2:31594908-31594930 CTCAAAACTATACAAATACATGG + Intergenic
928564110 2:32525672-32525694 CTTAAAACTATGTAAATCAGAGG + Intronic
928622735 2:33107695-33107717 ATTAAAAAGATATAAATCCAGGG - Intronic
928724658 2:34158190-34158212 ATTTAAAATAAATAAATCAAAGG - Intergenic
928798884 2:35062026-35062048 CTATAAAATATATTAATTAAAGG + Intergenic
928826091 2:35423024-35423046 CACATAAATATATCAATGAAAGG + Intergenic
928831370 2:35489236-35489258 CTAAAAAATAAATAAATAACTGG + Intergenic
928845669 2:35668807-35668829 CTTTAAAATATATAATTCAGTGG + Intergenic
928988219 2:37201770-37201792 CTCAAAAAACTAAAAAACAAAGG - Exonic
929092493 2:38233319-38233341 CTCAAAACTTTATACATCCAAGG + Intergenic
929225395 2:39507043-39507065 CTAGAAAATATGTAAATGAATGG + Intergenic
929287454 2:40151710-40151732 ATCATAACTATATAATTCAATGG - Intronic
930265278 2:49192478-49192500 TTCAAAATGATATAAATAAATGG + Intergenic
930300490 2:49609851-49609873 CTCTGAAAAATATAAAGCAAAGG - Intergenic
930339335 2:50092699-50092721 TTCAAAATTGTATTAATCAAAGG + Intronic
930822272 2:55658496-55658518 CTGAAAACTGTATAAAACAAAGG - Intronic
930836073 2:55794760-55794782 CTCAAAAAAATAAAAAATAAAGG - Intergenic
930881867 2:56279294-56279316 CTTAAAAATATATAATCCAATGG + Intronic
930925109 2:56808673-56808695 ATCAAAAATAAATAAATAAAAGG - Intergenic
931268534 2:60681707-60681729 CTCAAAAATAAACAAAAAAATGG + Intergenic
931883850 2:66594342-66594364 CTCAAAAATAAAAAAAAAAAAGG - Intergenic
931970322 2:67578723-67578745 GTCAAAAATTTATAAATAGAAGG + Intergenic
932022376 2:68100299-68100321 GTCAAGAATAGATAAATCTATGG + Intronic
932107782 2:68962810-68962832 GTCAAAAATATAAAAATAAGAGG + Intergenic
932333386 2:70914094-70914116 CTCCAAAGTATATACAACAATGG - Intronic
932628179 2:73315511-73315533 CTCAAAAAAATAAAAAAAAAAGG + Intergenic
932919659 2:75896654-75896676 CTCAAAAATCTGTAAATTTATGG + Intergenic
933040156 2:77454872-77454894 ATAAAAAATAAATAAATAAAAGG - Intronic
933041120 2:77468152-77468174 CTCAAAAAAATAGAAACTAAAGG + Intronic
933120886 2:78536625-78536647 CTCAAAAAAATAAAAATACAGGG + Intergenic
933173142 2:79146228-79146250 CTAAAATATACATAGATCAATGG - Intergenic
933394580 2:81714601-81714623 GTCAAAAATATAAAAAAAAAAGG + Intergenic
933431574 2:82186680-82186702 CTGAAAAATTTATCAATTAAAGG + Intergenic
933433245 2:82212338-82212360 CTCAAAACCATGTAAATCCATGG - Intergenic
933482352 2:82873614-82873636 CTCAAAACTATAGAAATACATGG - Intergenic
934111129 2:88744295-88744317 CTCAAAACTATACAAATACATGG - Intronic
934902067 2:98167378-98167400 GACAAAAATGTATGAATCAATGG + Intronic
935000878 2:99013689-99013711 CTCAAAACTATAAAAATACATGG + Intronic
935002623 2:99034398-99034420 CTCAAAAATAAAAAAAATAAAGG + Intronic
935002927 2:99038989-99039011 CTCAAAACTATAAAAATATATGG + Intronic
935177259 2:100660540-100660562 CACATAAACAGATAAATCAAAGG + Intergenic
935266056 2:101395194-101395216 CTTAAAAATAAATAAGTAAATGG - Intergenic
935393718 2:102582478-102582500 CTTAAAAAGATATAGTTCAAAGG - Intergenic
935530576 2:104228216-104228238 TGCAAAAATATATAAATGGATGG - Intergenic
935919829 2:108000895-108000917 TTAAAAAATAAATAAATAAATGG - Intronic
936815299 2:116453370-116453392 CTCAAAACTATACAAATACATGG - Intergenic
937410908 2:121674244-121674266 CTCAAAACTATACAAATACAGGG + Intergenic
937442861 2:121931787-121931809 CTCAAAAAAAAATAAATAAATGG - Intergenic
937601203 2:123735919-123735941 CTGAAAAATACACAAATAAATGG - Intergenic
937788416 2:125930041-125930063 CTGCACAATATATAAAGCAAGGG - Intergenic
938730103 2:134140721-134140743 TTCATGAATAGATAAATCAATGG - Intronic
939357734 2:141126031-141126053 CTCAAAAAAAAAAAAATAAAAGG - Intronic
939362739 2:141194894-141194916 GTCAAAAAGATATAAATTAAAGG - Intronic
939433451 2:142141728-142141750 AGCAAAAATAAATAAATAAAAGG - Intergenic
939650957 2:144761355-144761377 CTTAGAAATATATCAAACAAAGG + Intergenic
940039389 2:149344323-149344345 GTCTAAAATATAAAAATAAAAGG - Intronic
940061262 2:149572332-149572354 CTCCAAAAAAAAAAAATCAAGGG + Intronic
940141748 2:150499035-150499057 ATTAAAAATAAATAAATAAATGG - Intronic
940143054 2:150516251-150516273 CTTAAAGATATATAATTTAATGG - Intronic
940218085 2:151321647-151321669 CTCAAAAGAAGATAGATCAATGG + Intergenic
940345584 2:152624475-152624497 CTTAAAAATAAATAAATAAAAGG - Intronic
940411890 2:153374369-153374391 CTCCAAAGAATATATATCAATGG - Intergenic
940473439 2:154129692-154129714 CTCAAAAATAGAAAATTAAAAGG - Intronic
940501418 2:154498853-154498875 CTCACAAATATGAAAATAAAAGG + Intergenic
940533841 2:154912947-154912969 CTTTAAAATTTATAAATAAATGG - Intergenic
940544576 2:155067141-155067163 CTCAAAACTATACAAATACATGG - Intergenic
940690702 2:156916141-156916163 TTTAAAAATATAAAAATTAAAGG - Intergenic
940741044 2:157507910-157507932 CTTTAAAATATATAAATCTAAGG - Intergenic
940763972 2:157769764-157769786 TTCAAAAATACAGAAGTCAATGG + Intronic
940970277 2:159889226-159889248 TTAAAAAATAAATAAATAAAAGG - Intronic
941060906 2:160845588-160845610 CTCAAAACTATACAAATACATGG + Intergenic
941104631 2:161339422-161339444 CCCTAAAATATATAGATGAATGG - Intronic
941265132 2:163351959-163351981 CGCAAACATACATAAATAAAAGG - Intergenic
941295259 2:163730928-163730950 CTCAAGAATATATTGATCAAAGG + Intronic
941376057 2:164732153-164732175 AAGAAAAATAAATAAATCAAAGG + Intronic
941524532 2:166590075-166590097 CTCAGAAAAATAGAAATCAAAGG - Intergenic
942017537 2:171831896-171831918 CTCAAAAAAAAAAAAATTAAAGG + Intronic
942196212 2:173523017-173523039 CTCAAAAAAATAGAAAAAAAAGG - Intergenic
942209633 2:173657764-173657786 CTCAAAAAAAAAATAATCAATGG + Intergenic
942216684 2:173727835-173727857 TTAAAAAATAAATAAATAAAAGG + Intergenic
942978576 2:182049736-182049758 CTAGAAAATATACAAATCAGAGG - Intronic
943212259 2:184982147-184982169 TTAAAAAATATGTAAATAAATGG - Intergenic
943284900 2:185985214-185985236 CTCAAAAAAATTTAAAACTAGGG + Intergenic
943478827 2:188392876-188392898 CTCAAAATTATACAAATACATGG - Intronic
943511418 2:188831701-188831723 TTTAAAAATATGTAAATAAATGG + Intergenic
943666367 2:190613586-190613608 CTCAAAAAAAAATAAATTATTGG - Intergenic
943829221 2:192437717-192437739 CTCTAATATATATAAAGCTATGG + Intergenic
943893847 2:193327694-193327716 ATCATAAAAATATAAAACAAAGG + Intergenic
944366455 2:198926239-198926261 ACCATAGATATATAAATCAATGG + Intergenic
944694981 2:202192752-202192774 CTCAAAAATATAAAAACAAGGGG - Intronic
944737664 2:202582468-202582490 CTCAAAACTATATAAATACGTGG - Intergenic
945101057 2:206262669-206262691 CTCAAAACTGTATACAACAAAGG - Intergenic
945172447 2:207011179-207011201 TTAAAAAATAAATAAATAAAGGG - Intergenic
945277065 2:207998520-207998542 TTTAAAAATAAATAAATAAATGG + Intronic
945465607 2:210167143-210167165 CTCAAAAATACAGGAATTAATGG + Intronic
945544347 2:211131352-211131374 TTGAAAAATAAATAAATAAAAGG + Intergenic
945648733 2:212535234-212535256 CTCATATATATATATATAAAAGG - Intronic
945708123 2:213260968-213260990 CTCAAAAATAAAAAAAAAAACGG + Intergenic
945746709 2:213727368-213727390 GAGAAAAATATATAAATCAATGG + Intronic
945765315 2:213969299-213969321 GTCAAAAATATGTAAGTCATAGG - Intronic
945810038 2:214537730-214537752 CACAAAAATGTATGAATGAATGG + Intronic
945873092 2:215248722-215248744 CTTTAAAAAACATAAATCAAGGG + Intergenic
945949994 2:216030122-216030144 CTAAAATACTTATAAATCAAGGG + Intronic
946069485 2:217019638-217019660 CTCAAGAATATACAAATTAATGG + Intergenic
946531305 2:220573417-220573439 TTCAACAATATATACTTCAAAGG - Intergenic
946586522 2:221194656-221194678 CTAAATAAGATAAAAATCAATGG + Intergenic
946630601 2:221663774-221663796 CTCCATAATATAAAAATAAATGG + Intergenic
946874770 2:224116799-224116821 CTCAAAACTATACAAATACATGG + Intergenic
946916207 2:224524815-224524837 ATCAAAAGTATAAAAACCAAAGG + Intronic
947146547 2:227071748-227071770 CTCAAAATTATACAAATACATGG + Intronic
947335008 2:229073022-229073044 CAAAAAAATAAATAAATAAATGG - Intronic
947433871 2:230055402-230055424 CTCATAGTTATATAAATGAAAGG - Intronic
947458351 2:230279162-230279184 TTGAAAAATATACAAATAAATGG + Intronic
947492487 2:230607615-230607637 CTCAATAAAATAGATATCAATGG + Intergenic
947652035 2:231795078-231795100 CTAAAAAATATAAAAATTATGGG - Intronic
948432602 2:237929602-237929624 CTAAAAAATACAAAAATTAAAGG - Intergenic
948746549 2:240099051-240099073 CTCAAAACTATACAAATACATGG + Intergenic
1169139618 20:3219878-3219900 CTCAAAAATAAATAAATAGCCGG + Intronic
1169255611 20:4094919-4094941 TTGAAAAATGTATAAAACAATGG + Intergenic
1169255996 20:4099559-4099581 CAAAAAAATAAATAAATAAAAGG - Intergenic
1169623075 20:7529712-7529734 CTCAAAACTATATAAATATATGG + Intergenic
1169993597 20:11531215-11531237 CTCAACAAAGTATGAATCAAAGG + Intergenic
1170099534 20:12683528-12683550 TTCAAAAATAAATAAATAGATGG - Intergenic
1170225413 20:13986831-13986853 CTCAAAAAAATAAAAAGTAATGG - Intronic
1170270901 20:14526480-14526502 CTTAAAAATTAATAAATAAAAGG + Intronic
1170531474 20:17296986-17297008 CTTAAAAATAAATATATAAAGGG - Intronic
1170690412 20:18610255-18610277 GTCAAAAAGAAATAAATAAAAGG - Intronic
1170697002 20:18668148-18668170 CTTAAAAATATATAAACACATGG - Intronic
1170865609 20:20153072-20153094 CTCAAAACTATACAAATACATGG + Intronic
1171176860 20:23057914-23057936 ATCTAAAATGTATAATTCAATGG - Intergenic
1171198314 20:23220404-23220426 CTCAAAACTATACAAATACATGG - Intergenic
1171242060 20:23578881-23578903 CTCAAAACTATAAAAATATATGG - Intergenic
1171772696 20:29336807-29336829 ATCAAAAATATAGCAATAAAAGG - Intergenic
1171805239 20:29672640-29672662 CTAACAAATATATAGACCAATGG - Intergenic
1171838819 20:30183793-30183815 CTAACAAATATATAGACCAATGG + Intergenic
1172161835 20:32874219-32874241 CTAAAAAATAAATAAAATAAAGG - Intronic
1172369852 20:34380786-34380808 CTCAAAAATAAATTAAAAAAGGG - Intronic
1172401519 20:34655671-34655693 CTCAAAAAAATAAAAAAGAATGG + Intronic
1172406054 20:34690260-34690282 CTCAAAAAAACAAAAATAAAAGG - Intergenic
1172465223 20:35151669-35151691 ATGACAAATATATAAATAAAAGG + Intergenic
1172686427 20:36758981-36759003 CTCAAAAATAAATAAATAGCTGG - Intronic
1172711714 20:36929710-36929732 CTCAAAAATAAAAAAATAAATGG + Intronic
1172945666 20:38686667-38686689 CTCAAAAACATGTTAATCAGAGG + Intergenic
1173109382 20:40171562-40171584 CTCAAAAATTTGTAATTCACTGG + Intergenic
1173892621 20:46524856-46524878 CTCAATAATAAATAAATGAGGGG + Intergenic
1174089863 20:48038231-48038253 CTGAAAAATAAATAGATCAGAGG - Intergenic
1174736407 20:52969879-52969901 AACAAAAATAAATAAATAAATGG + Intergenic
1174953471 20:55068257-55068279 CTCAGAAAAATAAAAATAAATGG - Intergenic
1174976081 20:55336466-55336488 AGAATAAATATATAAATCAATGG - Intergenic
1175410444 20:58764225-58764247 CACAAATATAGATAAAGCAAAGG + Intergenic
1175570618 20:60017896-60017918 CTCAAAACTATACAAATACATGG - Intronic
1175712156 20:61230105-61230127 GTTAAAAATAAATAAATTAATGG - Intergenic
1176741778 21:10611162-10611184 CTCAAAACTACATAAATACATGG - Intergenic
1177082701 21:16661002-16661024 CTCATAAATATATATTTTAAAGG - Intergenic
1177229771 21:18304772-18304794 ATCAAAAATTTTTAAATCCATGG - Intronic
1177265888 21:18783397-18783419 CTCAAAGAAATAAAAATCAGTGG - Intergenic
1177353511 21:19977022-19977044 CTCAAAAAAATAAAAGTCAAAGG + Intergenic
1177498651 21:21921274-21921296 CATATAAATATATAAATAAATGG + Intergenic
1177566031 21:22821348-22821370 CTCAAAAGTATTTAAGACAAAGG + Intergenic
1177829065 21:26116723-26116745 CTTAAAATTACATAAATCCACGG - Intronic
1177884761 21:26734247-26734269 CTCAATAATATCTGAATCACAGG + Intergenic
1177925052 21:27203751-27203773 TTAGAAAATATATAAATCTATGG + Intergenic
1177934988 21:27334127-27334149 CTCAAAACTATACAAATATATGG + Intergenic
1177951030 21:27537653-27537675 CTCAAAACTATACAAATACATGG + Intergenic
1178277552 21:31252659-31252681 TTTAAAAATAAATAAATAAAAGG + Intronic
1178678529 21:34652175-34652197 CACAAAAAAAGGTAAATCAAGGG - Intergenic
1179082346 21:38183469-38183491 ATCAAAAATACAGCAATCAAAGG + Intronic
1179371867 21:40813602-40813624 CTCAAAACTATACAAATATATGG - Intronic
1179896884 21:44368118-44368140 CTCAAAAATAAATAGATGGATGG - Intronic
1179968885 21:44822907-44822929 CTCAAAAAAAAATTGATCAAAGG + Intergenic
1180124511 21:45780139-45780161 CTCAAAAATATATAATTTCTTGG + Intronic
1180563656 22:16644400-16644422 CTCAAAACTACATAAATACATGG - Intergenic
1180574667 22:16761416-16761438 CATAAAAATATATGACTCAAAGG - Intergenic
1180578697 22:16807906-16807928 TTCAAACATGTATAAACCAAAGG + Exonic
1180690238 22:17708696-17708718 CTCAAAAATATAAAACTCATGGG - Intronic
1180896613 22:19339153-19339175 CTCAAAACTATACAAATACATGG + Intronic
1181385842 22:22545052-22545074 CTCAAAAAAAGAAAAATAAATGG - Intergenic
1182456336 22:30453409-30453431 CAAAAAAATAAATAAATGAAAGG - Intronic
1182642718 22:31781293-31781315 CTCAAAAATAATTAATTTAATGG - Intronic
1182685333 22:32118624-32118646 CTCAAAAATTCATAAATATATGG + Intergenic
1182925656 22:34121853-34121875 CTGAAAAAAATATATAACAATGG + Intergenic
1183522109 22:38301431-38301453 CTCAAAAAAAAAAATATCAAAGG - Intronic
1183952770 22:41360934-41360956 CTCAAAAATAAATAAATAAAAGG + Intergenic
1184377399 22:44123355-44123377 CTCAAAATTATGTACCTCAAAGG - Intronic
1184524812 22:45015700-45015722 ATAAAAAATAAATAAATAAAAGG + Intergenic
1184625712 22:45727221-45727243 CTCAAAACTACATAAATACACGG - Intronic
949302336 3:2598800-2598822 CTCCAACATATATACATGAAAGG + Intronic
949529302 3:4938533-4938555 ATAGATAATATATAAATCAAAGG + Intergenic
949573891 3:5320016-5320038 CTCAAAACAAAATAAAACAAGGG + Intergenic
950060398 3:10066723-10066745 CTCAAAAAAACAAAAAACAAAGG - Intronic
950157342 3:10732114-10732136 GACAAAATTATATAAAACAATGG + Intergenic
950222943 3:11210393-11210415 CAAAAAAATAAATAAATAAATGG + Intronic
950319655 3:12039076-12039098 CTCAACAACCTAGAAATCAAAGG - Intronic
950344119 3:12276615-12276637 CTTTAAAATGTATAATTCAATGG + Intergenic
950369033 3:12511860-12511882 CTCAAAAATATATAAAACCTAGG - Intronic
950395504 3:12730915-12730937 CACAAAAAAATAAAAACCAAAGG - Intergenic
950588124 3:13911544-13911566 CTCAAAACTATACAAATACATGG + Intergenic
950594012 3:13962869-13962891 CTCAAAACTATACAAATACATGG - Intronic
951060328 3:18199192-18199214 CTCAAAAGTACACAAATAAATGG - Intronic
951180007 3:19648806-19648828 CAAAAGAATATATAAATCAATGG + Intergenic
951260431 3:20501524-20501546 CTGAAAACTATATAAATACATGG - Intergenic
951389672 3:22087310-22087332 CAGAAAAAAATATAAATAAAAGG - Intronic
951758742 3:26121082-26121104 CTCAAAACTACATAAATACATGG + Intergenic
951831522 3:26933931-26933953 CTCTGAAATATATGAATCATTGG + Intergenic
951911722 3:27757262-27757284 CCCAAAAATATATACAGCATTGG - Intergenic
951930903 3:27966189-27966211 CTCAAACAGAGATAGATCAATGG + Intergenic
952040908 3:29260807-29260829 CTAAAAAATAAATGAATCACAGG - Intergenic
952046634 3:29329400-29329422 ATCAAAAATTTAAAAATCACAGG + Intronic
952074498 3:29679332-29679354 CTCAAAAATAGAAAAATCGACGG - Intronic
952243516 3:31560346-31560368 CACAAAAATATAAAAACCACTGG - Intronic
952398447 3:32941285-32941307 ATCAAACATATATCAAACAAGGG - Intergenic
952521731 3:34166831-34166853 CTGAAAAAGACATAAATAAATGG - Intergenic
952612114 3:35224431-35224453 CTCAAAAATATCGTATTCAAGGG - Intergenic
952642911 3:35619693-35619715 CACTTAAATATAAAAATCAAGGG + Intergenic
952728136 3:36610734-36610756 ATTTAAAATATAGAAATCAATGG + Intergenic
953817611 3:46173295-46173317 CTCAAAAATACATAAACAAGGGG - Intronic
954021449 3:47745726-47745748 CTCAAAAATAAATAAATACGTGG + Intronic
954126511 3:48533854-48533876 CAAAAAAATAAATAAATAAAGGG + Intronic
954271330 3:49511898-49511920 CTTTACAATATATAAATCAATGG + Intronic
954606735 3:51916778-51916800 CTCAAAAATAAAAAAAAAAAAGG - Intergenic
954816936 3:53289921-53289943 ACCAAAAATAAATAAATAAAAGG - Intronic
955048570 3:55386222-55386244 CACAAAAATAGATATATAAAAGG + Intergenic
955446048 3:59010910-59010932 CTCAAAATGATACAAATAAATGG + Intronic
955572949 3:60327441-60327463 CCAATAAATATATAAATAAACGG + Intronic
955762957 3:62308457-62308479 CTCAAAAATATATAATTTTATGG - Intergenic
955771105 3:62385469-62385491 ATAAAAAATAAATAAATAAATGG - Intergenic
956097004 3:65727394-65727416 CTCAAAAACAAATAAATAAATGG - Intronic
956165028 3:66391725-66391747 CTTTAAAATATATAAATTGATGG - Intronic
956217621 3:66865386-66865408 ATCAAAAATATATAAATCTCAGG - Intergenic
956866646 3:73375766-73375788 CAAAAAAATAAATAAATAAAAGG - Intergenic
956935617 3:74097545-74097567 CTATAAAAGATATTAATCAAGGG - Intergenic
957069587 3:75556492-75556514 TTCAAAAATTTTTAAATCCATGG + Intergenic
957281696 3:78158311-78158333 CTCAAAATTATACAAATACATGG + Intergenic
957395361 3:79629351-79629373 CTCAAAACTATACAAATACATGG + Intronic
957463995 3:80561625-80561647 GTCAAAACTATATAAATGCATGG + Intergenic
957640033 3:82841442-82841464 CTGAAAAATATACAAATAAATGG + Intergenic
957670444 3:83294407-83294429 CTCAAAAATAAATAAACAAATGG - Intergenic
957768360 3:84656847-84656869 CTCAAAAATATACAAGTTATAGG + Intergenic
957921507 3:86754575-86754597 CTCAAAATTATACAAATACATGG - Intergenic
958506804 3:94989538-94989560 TTCAAAGTTATATAAATTAAAGG + Intergenic
958647510 3:96891200-96891222 CAGTAAAATATATAAATAAATGG + Intronic
958660090 3:97055767-97055789 CTTAAAAATAAAGAAATCAAAGG - Intronic
958827073 3:99042914-99042936 CACAAAAATATAAAACTCACTGG + Intergenic
959096195 3:101958846-101958868 CCCACATATATAAAAATCAAAGG + Intergenic
959467177 3:106702296-106702318 TTAAATAATATATAAATGAATGG - Intergenic
959617045 3:108360056-108360078 CTGAAAAATATAAAAATTACTGG - Intronic
960468426 3:118028341-118028363 CTCAAAACTATACAAATACATGG - Intergenic
960712097 3:120541564-120541586 CTCAAAACTATACAAATACATGG - Intergenic
961011409 3:123438743-123438765 CTCAAAAAAATAAAAAGGAAAGG - Intronic
961053909 3:123770322-123770344 CTCAAAATAAAATAAAACAAAGG + Intronic
961134757 3:124499892-124499914 GTGAAAAATATATAAATATAAGG - Intronic
961564342 3:127752966-127752988 CTCAGAAAAAAATCAATCAAGGG - Intronic
961703800 3:128767861-128767883 TTAAAAAATAAATAAATAAAAGG - Intronic
962128175 3:132644637-132644659 CAAAAAAAGATATAATTCAAGGG + Intronic
962411433 3:135144555-135144577 CTCAAACACATACACATCAAAGG + Intronic
962420498 3:135224999-135225021 CCCAGACAGATATAAATCAAAGG - Intronic
962530200 3:136273105-136273127 CTCAAAACTATACAAATACATGG - Intronic
962594344 3:136924909-136924931 CTCAAAAATGAACAAATCAAGGG - Intronic
962651728 3:137500811-137500833 CTCAAAACTATATAAATACATGG - Intergenic
962861944 3:139412011-139412033 CTCAAAACTATACAAATACATGG - Intergenic
962938596 3:140104976-140104998 CTCAAAAATAAAAAAACAAAAGG + Intronic
963318879 3:143790837-143790859 TTCAAAAATATTTAAAGAAAGGG - Intronic
963501546 3:146133173-146133195 CTCAAAAAAATAAAAATAAAAGG + Intronic
963559563 3:146846241-146846263 ATCAAAAATATATAATACATAGG + Intergenic
963612713 3:147492114-147492136 CTCAAAAATAAATACATGAATGG - Intronic
963659763 3:148110559-148110581 ATAAACAATATATAAATGAAAGG - Intergenic
963918318 3:150881380-150881402 CTCAAAAATAAATAAATAGAGGG + Intronic
963991125 3:151655581-151655603 ATGAAAAATGTTTAAATCAATGG - Intergenic
964016005 3:151947601-151947623 CTGAAAGATATAAAAAGCAATGG + Intergenic
964082211 3:152773265-152773287 CTCAAAAATTTAAAAAAAAAAGG - Intergenic
964186028 3:153944084-153944106 CTGAACAACATCTAAATCAAAGG + Intergenic
964274096 3:154990058-154990080 CTCAAAACTATACAAATACATGG + Intergenic
964347672 3:155770666-155770688 CTCAAAAAGATAAAAAATAAAGG - Intronic
964514233 3:157490053-157490075 TTTAAAAACATATAAATAAAGGG + Intronic
964565115 3:158041487-158041509 CTCAAAACTATACAAATACATGG + Intergenic
964676147 3:159282511-159282533 CACAAAAATATATAGGTGAATGG - Intronic
964835175 3:160930083-160930105 GTCAAAAGTATGGAAATCAAGGG - Intronic
964901782 3:161669012-161669034 CACAAAAATATAAAAAGCACTGG - Intergenic
964935696 3:162083486-162083508 CACATAAATATATGAATGAATGG + Intergenic
964973254 3:162587137-162587159 TTCAAAAATAAATAACACAATGG - Intergenic
965004440 3:163000911-163000933 ATCAAAAATAAATAAAAGAAAGG + Intergenic
965144383 3:164881378-164881400 TTCAAAAATATTTAAATAATAGG + Intergenic
965254797 3:166392529-166392551 CTCAAAACTATACAAATAAATGG - Intergenic
965277027 3:166697630-166697652 ATAAAAAATAAATAAATAAAAGG + Intergenic
965364452 3:167781342-167781364 TTCAAAAATATCTACTTCAAGGG + Intronic
965423371 3:168490391-168490413 ATAAAAAATAAATAAATAAAAGG - Intergenic
965483799 3:169253479-169253501 CTGATAAATATATAACTCTAAGG - Intronic
965677577 3:171213957-171213979 CCAAAAAATAAATAAATAAAAGG + Intronic
965861175 3:173152438-173152460 CTGAAAACTACAAAAATCAAAGG - Intergenic
965882726 3:173406589-173406611 CATATATATATATAAATCAAAGG + Intronic
965951171 3:174309751-174309773 CTCAAAAATCTATAATAAAATGG + Intergenic
966019624 3:175191561-175191583 CTCACAAATATATCATTCAGGGG - Intronic
966182622 3:177200377-177200399 TTCCAGAATATAAAAATCAAAGG - Intergenic
966449879 3:180046205-180046227 TTCAAAAATATATTCATAAAAGG - Intergenic
966897162 3:184454142-184454164 CTCAAATATATATATATATATGG - Intronic
967020556 3:185518719-185518741 TCCAAAAATAAATAAATAAAAGG - Intronic
967236343 3:187387509-187387531 CTCAAAACTATACAAATACATGG + Intergenic
967268941 3:187717182-187717204 CACCAAAATATATAAAACTATGG - Intronic
967430343 3:189377142-189377164 CACAAAAATAAAAAAATGAATGG - Intergenic
967527308 3:190509614-190509636 CCCAAAAAAATGTAAATCAAAGG + Intergenic
967774896 3:193376192-193376214 GTAAAAAATAAATAAATCGAGGG - Intronic
968018424 3:195360795-195360817 CTCAAAAAAATAAAAAAAAAAGG + Intronic
968044123 3:195614102-195614124 ATCAAAAATATATACATCTTAGG - Intergenic
968122927 3:196138829-196138851 CACAAAAATAAATAAATGATTGG + Intergenic
968777724 4:2554081-2554103 CAAAAAAATAAATAAATAAAAGG - Intronic
969550044 4:7859416-7859438 CTCGAAAAAAAATAAAACAAGGG + Intronic
970185858 4:13452556-13452578 TTCAAAACTATACAAATAAATGG - Intronic
970433779 4:16013522-16013544 CTTTAAATTATATCAATCAAAGG + Intronic
970774971 4:19662653-19662675 ATCAAAAATTAATAATTCAATGG + Intergenic
970792074 4:19869282-19869304 TTTAAAAAGATCTAAATCAATGG - Intergenic
970828830 4:20310765-20310787 CTCATAAATCTTTAAATGAAGGG + Intronic
971126816 4:23763491-23763513 CTCAAAAATATGACAATAAATGG + Intronic
971168313 4:24206914-24206936 TAGAAAAATATAAAAATCAAAGG - Intergenic
971176648 4:24288752-24288774 ATCCAAAATAAATAAATAAACGG + Intergenic
971417514 4:26446186-26446208 CTCAAAACTATACAAATACATGG + Intergenic
971663105 4:29446248-29446270 CAGAAAAATAAATAAATTAATGG + Intergenic
971720702 4:30242087-30242109 TTCAAAACTATATAAATGCATGG - Intergenic
971840558 4:31846845-31846867 ATCAAAAGTAAATAAAACAAAGG - Intergenic
972017606 4:34265818-34265840 CACAAAAATATAAAATTCACTGG + Intergenic
972129762 4:35817686-35817708 ATCATAAATATTGAAATCAAGGG - Intergenic
972181274 4:36469447-36469469 TTGAAATATAAATAAATCAAAGG - Intergenic
972472497 4:39420523-39420545 CTCAAAAAAAAAGAAGTCAAGGG - Intronic
972493972 4:39615375-39615397 TTAAAAAATAAATAAATGAATGG + Intronic
972618074 4:40719381-40719403 CTCAAAAACAGAGAAAACAAAGG - Intergenic
972624919 4:40787828-40787850 CAAAAAAATAAATAAATAAAAGG - Intronic
972906144 4:43749899-43749921 CTCTCGAATATATAAAGCAATGG + Intergenic
973091583 4:46144072-46144094 CTCAAAACTATATAAATACATGG - Intergenic
974140663 4:57882283-57882305 ATAAAAAATATAAATATCAACGG + Intergenic
974153298 4:58038324-58038346 AATAAAAATATATAAATCTAAGG - Intergenic
974209594 4:58752762-58752784 CACAAAAATTTATAAATCTATGG + Intergenic
974371228 4:61019068-61019090 CTGAAAATTATAAAAATCAGAGG + Intergenic
974376039 4:61077136-61077158 CTCAAAACTATACAAATAGATGG + Intergenic
974497363 4:62649793-62649815 CTCAAAATTATACAAATACATGG - Intergenic
974609858 4:64203120-64203142 AACAATAATATATAAATTAAAGG - Intergenic
974777306 4:66501711-66501733 ATCATAAATAAATAAATCAGTGG + Intergenic
974982070 4:68968965-68968987 CTAAGAAATATATACATGAATGG + Intergenic
975623468 4:76317858-76317880 CTCAAAACTATATAAATACATGG + Intronic
975650448 4:76587946-76587968 CTAGAGAATATATAAATCAAAGG + Intronic
976362929 4:84201851-84201873 CTCAAAACTATACAAATACATGG + Intergenic
976479041 4:85518034-85518056 CTCAAAATTATAGCAATCTAAGG + Intronic
976562552 4:86518905-86518927 CTCAAAACTATACAAATACATGG - Intronic
976666434 4:87598739-87598761 CTCAAAAATAGACAAATACATGG - Intergenic
976680592 4:87752037-87752059 ATTAAAAATATATAAACAAATGG + Intergenic
976869795 4:89777308-89777330 CTCAAAACTATACAAATACATGG + Intronic
977039124 4:91993012-91993034 CTCTAAAATACATCAAGCAAAGG + Intergenic
977284220 4:95082184-95082206 TTAAAAAATGTATAATTCAATGG - Intronic
977481553 4:97584231-97584253 CTCAAAATTATACAAATACATGG + Intronic
977484183 4:97620984-97621006 CTCAAAACTATATAATTACATGG + Intronic
977617332 4:99101298-99101320 CTCAAAAAAATAAAAATAAAAGG - Intergenic
977623633 4:99165521-99165543 ATCAAAAAAATGCAAATCAAAGG - Intergenic
977655276 4:99514238-99514260 AACAAAAATAAATAAATAAATGG + Intronic
977846184 4:101770408-101770430 CTCAAAACTATATAAATTCATGG - Intronic
978043970 4:104103863-104103885 CCCAAAACTATATAAATACATGG + Intergenic
978364889 4:107970822-107970844 CTCAATAAGAAATAACTCAATGG - Intergenic
978400577 4:108326100-108326122 CTGAAATAAATATAAATGAATGG + Intergenic
978414997 4:108465409-108465431 CTCAATAATATATGAATTAGGGG - Intergenic
978499669 4:109395760-109395782 CTCTCAAATTTATAATTCAATGG + Intergenic
978864056 4:113486123-113486145 CTTAAAAAAAAAAAAATCAAAGG - Intronic
979510771 4:121550962-121550984 CTAAATAATCTATGAATCAATGG - Intergenic
979660286 4:123245285-123245307 TTTAAAAATATATAAACCCATGG - Intronic
979838815 4:125409874-125409896 CTCATCAATATATAAAACAAGGG + Intronic
979955732 4:126951650-126951672 CTTAAAACTATAAAAATAAATGG + Intergenic
980162113 4:129177349-129177371 ATCAAAAATGTATAACTTAAAGG - Intergenic
980186844 4:129472937-129472959 CTCAAAACTATACTAATAAATGG - Intergenic
980313850 4:131170176-131170198 GACAAAAATTTAAAAATCAATGG + Intergenic
980338962 4:131516772-131516794 CAAAAAAATATAAAACTCAATGG + Intergenic
980341709 4:131557981-131558003 CAAAAAAATAAATAAATAAAAGG + Intergenic
980405500 4:132350032-132350054 ATAAAAAATATATATATCTAGGG + Intergenic
980436783 4:132786295-132786317 ATTAAAAATAAATAAATAAAAGG - Intergenic
980438183 4:132808305-132808327 CTCAAAAAAAAAAAAAACAATGG + Intergenic
980471275 4:133255282-133255304 CTAAAAAATATATAAAGTTATGG - Intergenic
980518118 4:133891793-133891815 CTAAAATATATATATTTCAAAGG + Intergenic
980639483 4:135557240-135557262 ATCAAAAATACAGAAATAAAAGG - Intergenic
980820911 4:138015949-138015971 TTCTTATATATATAAATCAAAGG + Intergenic
980870320 4:138603770-138603792 CCCAAAAATAGATAAATTCATGG + Intergenic
981061842 4:140432950-140432972 CTAATAAATATATAAATCAGTGG + Intergenic
981064876 4:140472070-140472092 CTAAAAAGTATATAAATTTAAGG - Intronic
981079554 4:140625050-140625072 CTCAAAAAAAAAAAAATTAATGG + Intronic
981175751 4:141681428-141681450 TTTAAAAATAAATAAATAAAAGG + Intronic
981249447 4:142582333-142582355 CACAAAAATATATAAGAGAAAGG + Intronic
981306547 4:143252801-143252823 CTAAAATATATTTAAAGCAAGGG + Intergenic
981322771 4:143411932-143411954 GTTAAAAATAAATAAATAAATGG + Intronic
981495472 4:145386802-145386824 CATAAAAACATATGAATCAATGG - Intergenic
981736879 4:147962675-147962697 CTCAAAAAAATAAAAATAAAGGG - Intronic
981797751 4:148616484-148616506 TTCATAACTAGATAAATCAATGG + Intergenic
981870124 4:149475736-149475758 ATTAAAAAAATATATATCAAAGG + Intergenic
981935083 4:150230664-150230686 CTTCAAAATATGTGAATCAATGG + Intronic
981969819 4:150654098-150654120 ATTAAAAATTTTTAAATCAATGG - Intronic
982498296 4:156119868-156119890 CTCAGAAAAATAAAAATTAAGGG + Intergenic
982669195 4:158299674-158299696 TTTAAAAATATATAAATTACTGG + Intergenic
982730979 4:158955095-158955117 TTTAAAAATGTATAAATTAAAGG - Intronic
982783467 4:159515313-159515335 GTATAAAATGTATAAATCAAAGG - Intergenic
983150924 4:164280347-164280369 CACAATAATAGAAAAATCAATGG + Intronic
983198194 4:164831764-164831786 CTCAAAGATATGGAAATCACTGG + Intergenic
983362142 4:166739751-166739773 TTAAAAAATAAATAAATAAATGG + Intronic
983731906 4:171005337-171005359 CTCAACAAATTAGAAATCAAAGG - Intergenic
983742743 4:171155479-171155501 CTGAAAAATTTATAAAGGAAAGG - Intergenic
983771431 4:171554508-171554530 TTCAAGAATAAATAATTCAATGG + Intergenic
983894322 4:173065739-173065761 CTCACAACTATATAAATACATGG - Intergenic
984502387 4:180572521-180572543 CTCTAAATGATCTAAATCAAAGG + Intergenic
984508286 4:180648407-180648429 CTGAAAAAAATATCAAGCAATGG + Intergenic
984912904 4:184691128-184691150 CTCAGTAATTTATAGATCAAAGG - Intronic
985295935 4:188437470-188437492 CAATAAAATATATAACTCAAGGG - Intergenic
985336172 4:188897499-188897521 CCAAAAAATATGAAAATCAAAGG + Intergenic
986145595 5:5074385-5074407 TTCAAAAGTTTATAAATAAATGG - Intergenic
986444924 5:7812907-7812929 CTCAAAAAAAAATAAAAGAAAGG + Intronic
986617640 5:9636227-9636249 CTCAAAACTATACAAATACATGG - Intronic
986704629 5:10444973-10444995 CTAAAAAATAAATAAATAAATGG - Intronic
986843526 5:11725759-11725781 TACAAAAATATGTAAATTAAAGG + Intronic
986875425 5:12101851-12101873 CTCACAAATAAAACAATCAATGG - Intergenic
987186730 5:15428742-15428764 CAAAGAAATATATAAATAAATGG - Intergenic
987284881 5:16446340-16446362 CTCCAAAATAAATTAATAAAAGG + Intergenic
987533607 5:19154121-19154143 TTAAAAATAATATAAATCAATGG - Intergenic
987558988 5:19494222-19494244 CTAAAACATAAATAAATCGATGG - Intronic
987815335 5:22893577-22893599 CTGAACAATATGTAAATGAAAGG + Intergenic
987851010 5:23354433-23354455 CACTAAAATATTTAAATCACTGG + Intergenic
987962295 5:24825567-24825589 CTCAAAAATAAAAATATAAATGG - Intergenic
987979138 5:25057972-25057994 ATCATATATATATAAATTAAGGG + Intergenic
988018039 5:25585364-25585386 CTCAAAATTATACAAATACATGG - Intergenic
988027407 5:25714475-25714497 CTCTAAAATACATAAATAACTGG - Intergenic
988287905 5:29245138-29245160 CTCAAAAAAATAGGCATCAAAGG + Intergenic
988773495 5:34454431-34454453 ATCAAAAATGAATAAATAAAAGG + Intergenic
988804069 5:34724014-34724036 CTCAAAAATAAATAAATAAAAGG - Intronic
989013226 5:36898396-36898418 CTCAAAAATATCTATCTCATGGG - Intronic
989019309 5:36982921-36982943 CTCAAAAATATAGAAATCTTAGG + Intronic
989251686 5:39324158-39324180 ATGGAAAATATACAAATCAATGG + Intronic
989284187 5:39679848-39679870 ATCAAAAATATTTTAAACAATGG + Intergenic
989311964 5:40029954-40029976 AAGAAAAACATATAAATCAAAGG + Intergenic
989377298 5:40777770-40777792 CTAAAAAATACAAAAATTAATGG + Intronic
989460610 5:41694028-41694050 CTCAAAACTATACAAATACATGG - Intergenic
989534142 5:42544302-42544324 CTCAAATAAATGTAAAACAATGG + Intronic
989608340 5:43267740-43267762 CTCAAAACTATACAAATACATGG - Intronic
989818053 5:45760650-45760672 CTCAAAAGTATACAAATACATGG - Intergenic
989952481 5:50316047-50316069 CTCAAAAATTTTTAAATGCATGG + Intergenic
990071189 5:51785110-51785132 CTAAAAAATATACAAATACATGG + Intergenic
990129998 5:52569259-52569281 CAAAAAAATATATAGATGAATGG - Intergenic
990270980 5:54138653-54138675 AACAAAAATAAATAAATAAATGG + Intronic
990327569 5:54693619-54693641 CAGAAAAATAAATAAATAAATGG + Intergenic
990331710 5:54733584-54733606 AACAAAAATATAGAAAACAATGG - Intergenic
990612208 5:57468858-57468880 CTCACAAAAATACAAAACAAGGG - Intergenic
990880939 5:60537762-60537784 TTTAAAAATATACAAATCAATGG - Intergenic
990898856 5:60728824-60728846 CTCAAAAAAAAAAAAAACAAAGG + Intergenic
991543400 5:67754501-67754523 CTCAAAACTATACAAATACATGG + Intergenic
991623472 5:68571410-68571432 CACAAAAAGAAATAAATTAATGG + Intergenic
991719647 5:69483369-69483391 CTCAAAAAAAGAAAAAACAAAGG + Intergenic
992303038 5:75404844-75404866 ATCAAAAATACAAAAATCAGTGG + Intronic
992484753 5:77183863-77183885 TGCAGAAATATATAAATAAATGG - Intergenic
992689974 5:79232814-79232836 CTCAAAAATAAATAAATAAATGG - Intronic
992971847 5:82068916-82068938 TTCAAAAAAAAAAAAATCAAAGG - Intronic
992974012 5:82093580-82093602 CTCAGAAATACATAAACAAATGG - Intronic
993071100 5:83165463-83165485 GTTAAAAATAAATAAATAAATGG - Intronic
993150721 5:84158689-84158711 CACATAAATATAGAAATCATTGG + Intronic
993384653 5:87250606-87250628 CCAAAAAATATATAAATTGAGGG + Intergenic
993423022 5:87725392-87725414 CTAAAATATCTACAAATCAAAGG - Intergenic
993439443 5:87937330-87937352 CCAAAAAATAAATAAATAAAAGG - Intergenic
993485308 5:88476603-88476625 TACAAAAATATGGAAATCAAAGG + Intergenic
993628129 5:90250782-90250804 CACAAAAAAATGTAACTCAAAGG + Intergenic
993778080 5:92027257-92027279 CTGCAAAATATACAAAACAATGG - Intergenic
993883181 5:93386695-93386717 CTCAAAAATAATTAAATCTTAGG + Intergenic
993981830 5:94551760-94551782 CTCAAAATTATAGAACTCACTGG + Intronic
994327751 5:98468712-98468734 GACAAAAATAAATAAATAAAAGG + Intergenic
994334001 5:98542511-98542533 CTCAAAAATATACAACTACATGG + Intergenic
994358203 5:98819142-98819164 CTCAAAACTATACAAATACATGG + Intergenic
994563347 5:101407095-101407117 CTCAAAAATATACAAATACATGG + Intergenic
994564167 5:101419140-101419162 ATAAAAAATAAATAAAGCAAGGG - Intergenic
994698045 5:103097782-103097804 CTGAAAAATATATAAAACAAAGG + Intronic
994836185 5:104856304-104856326 TTTAAAAATATCTAAATAAATGG + Intergenic
995900237 5:117057155-117057177 TTTAAAAATATATAAATAGAAGG - Intergenic
995992040 5:118251993-118252015 CTCAAAAGTAAAGACATCAAAGG + Intergenic
995999093 5:118336536-118336558 ATGAAAAATAAATAAATAAAAGG + Intergenic
996110399 5:119559217-119559239 CTCAAAACTGTACAAATAAATGG + Intronic
996142822 5:119933868-119933890 CTTAAAAAGATATAAGTAAATGG - Intergenic
996160793 5:120161200-120161222 CACACAAATATATAAATGACTGG - Intergenic
996211823 5:120819490-120819512 TTTAAAAATCTGTAAATCAAAGG - Intergenic
996219009 5:120905716-120905738 CTCAAAAATATACAAGTACATGG - Intergenic
996469914 5:123848125-123848147 ATGAAAAATATGAAAATCAATGG - Intergenic
996503864 5:124246444-124246466 CTCAAAAATATACTAATACATGG + Intergenic
996507646 5:124286319-124286341 CTAATAAATAAATAAATAAACGG + Intergenic
996566697 5:124887116-124887138 CTTAAAAGTATATATTTCAAGGG + Intergenic
996608781 5:125355089-125355111 CTCAAAACTATACAAATACATGG - Intergenic
996874975 5:128230383-128230405 CTCAAAAAGAGATATATAAATGG - Intergenic
997127303 5:131240636-131240658 CTCAAAACTTTATAAACCAGAGG - Intergenic
997440317 5:133904686-133904708 CTCAAAAATAAAAACAGCAAGGG + Intergenic
998246844 5:140514546-140514568 CTTAATAATATATGATTCAAAGG + Intronic
998479701 5:142452594-142452616 CTAAAAAATACAAAAATCAGTGG - Intergenic
998598923 5:143564365-143564387 CTCTTAAATATATAAATAACAGG - Intergenic
998683019 5:144491524-144491546 CTCAAAATTATACAAACGAAAGG + Intergenic
998722819 5:144974265-144974287 CTGAAAAATAAATAAATAAGTGG + Intergenic
998741860 5:145212561-145212583 CTCAAAACTATACAAATACATGG + Intergenic
998898605 5:146827541-146827563 CTGAAAAATACATAAATAAATGG - Intronic
999264871 5:150260102-150260124 CTAAAAATTAAATAAACCAATGG - Intronic
999341249 5:150775296-150775318 CTCAAACATATAAAAATAAGAGG + Intergenic
999723207 5:154413911-154413933 ATCTAGAATATATAAATGAAAGG + Intronic
999893283 5:156001896-156001918 CTCAAAAATATGTACTTCTAAGG + Intronic
1000202384 5:159024403-159024425 TTCCAAAATATATCAAGCAAGGG - Intronic
1000264714 5:159624164-159624186 CTCAAAACTATAAAAATACATGG + Intergenic
1000479585 5:161755386-161755408 CTCAAAACTATATAATTACAAGG - Intergenic
1000688163 5:164279095-164279117 CTCAAAAATATATATGGGAATGG + Intergenic
1000831855 5:166111717-166111739 TTTAAAAGGATATAAATCAAAGG + Intergenic
1000878197 5:166666627-166666649 CTCAAAAAAGTAAAAATAAAAGG - Intergenic
1001166060 5:169368661-169368683 CTCAAAACTATACAAATACATGG + Intergenic
1001487720 5:172131543-172131565 CAAAAAAATAAATAAATAAAAGG - Intronic
1001729305 5:173938120-173938142 GTTGAAAAGATATAAATCAAAGG - Intronic
1001887135 5:175303143-175303165 CACTAAAATATAAACATCAACGG - Intergenic
1002479685 5:179492038-179492060 ATCTTAAATATATAATTCAATGG - Intergenic
1002504042 5:179666462-179666484 CTCAAAAAAATAAAAATAAAAGG - Intergenic
1002978676 6:2112337-2112359 CTCAAAAACCTATATATTAAAGG + Intronic
1002984119 6:2171443-2171465 GGCAAAAATAAATAAATAAATGG + Intronic
1002984173 6:2172253-2172275 CTCAAGAAGATAAAAATAAAAGG + Intronic
1003411089 6:5863553-5863575 CACTAAAGTATATAATTCAATGG - Intergenic
1003451621 6:6239810-6239832 CTCAAAAATATCTGAATTAAAGG + Intronic
1003492041 6:6631463-6631485 AACAAAATTATAGAAATCAAAGG + Intronic
1003498893 6:6687659-6687681 ATCTAAAATAAATAAAACAATGG - Intergenic
1003580687 6:7337707-7337729 TGTAAAAATATAAAAATCAATGG - Intronic
1003765987 6:9237216-9237238 CTGAGAAAAATATAAATCAGAGG - Intergenic
1003839440 6:10104995-10105017 TTCAAAAACAAATAAATAAAAGG + Intronic
1004110898 6:12717722-12717744 CTGCAAAAAATAAAAATCAAAGG - Intronic
1004211103 6:13645328-13645350 CTCAAATATATGTATTTCAAGGG + Intronic
1004322855 6:14646414-14646436 CTCAAAAAATTAAAAATAAAAGG + Intergenic
1004438357 6:15620350-15620372 CAAAAAAATATATATATAAATGG - Intronic
1004594969 6:17090912-17090934 ATCCAAAATATATAAAACAATGG - Intergenic
1004831357 6:19479940-19479962 CTCAAACAAATAAAAATCAAAGG + Intergenic
1004862160 6:19815905-19815927 CTCAAAATAAAATAAATGAAAGG + Intergenic
1004901645 6:20199965-20199987 CTCAAAAAAAAATAAAATAATGG + Intronic
1005205593 6:23400233-23400255 ATCTAAAATAGTTAAATCAATGG + Intergenic
1005259235 6:24040141-24040163 CTCAAAACTATACAAATACATGG - Intergenic
1005262530 6:24076903-24076925 CTCAAAACTATATAAATACCTGG - Intergenic
1005414890 6:25589487-25589509 CTCAAAAATAAATAAATAAAAGG - Intronic
1005732486 6:28711585-28711607 CTGAAAAATATAAAAATTATTGG + Intergenic
1007526393 6:42498348-42498370 CTCAAAACTATACAAATACACGG - Intergenic
1008156523 6:48021695-48021717 TTCCAAACTACATAAATCAATGG - Intronic
1008157280 6:48031713-48031735 CCCAAAAATACATTAAACAAGGG + Intronic
1008262577 6:49385335-49385357 CAAAAAAATAAATAAATAAAAGG + Intergenic
1008351928 6:50501407-50501429 CACAAAAATATAAAACTCAGTGG + Intergenic
1008357869 6:50576197-50576219 GTGAAAAAAATATAGATCAATGG + Intergenic
1008375668 6:50788211-50788233 CTCAGAAATATAAACATCATTGG + Intergenic
1008446352 6:51596600-51596622 ATAAAAAAGACATAAATCAATGG - Intergenic
1008840376 6:55895721-55895743 TTCAAAACTAAATAAACCAATGG + Intergenic
1008964026 6:57296436-57296458 GTCAAAAATGAATAAATAAAAGG + Intergenic
1009054598 6:58319597-58319619 TTCAAAAATCAATAAATCCAGGG + Intergenic
1009236541 6:61130974-61130996 TTCAAAAATCAATAAATCCAGGG - Intergenic
1009328656 6:62386253-62386275 TTAAAATATATATAAATAAATGG + Intergenic
1009871985 6:69464632-69464654 TTCCAAACTATATAAATTAAAGG + Intergenic
1010090583 6:71975759-71975781 CTCATAAATATAGAAAGTAATGG - Intronic
1010101725 6:72117625-72117647 CTCAAAACTATAGAAATACATGG + Intronic
1010134621 6:72536421-72536443 TTTAAAAATATAAAAATCATAGG - Intergenic
1010152688 6:72753282-72753304 CTCAAAAATATAAGAAATAAGGG - Intronic
1010176128 6:73030197-73030219 CCTCAAAGTATATAAATCAATGG - Intronic
1010225330 6:73483615-73483637 CTCAAAAAAATTAAAAACAAAGG - Intronic
1010303748 6:74291553-74291575 CTCAAAAATAGACATATGAATGG - Intergenic
1010524843 6:76888226-76888248 CTGAAAAATATCTAACTCACAGG - Intergenic
1010880046 6:81155916-81155938 CTCAAAACTATATAAATACATGG + Intergenic
1011005487 6:82639958-82639980 CTCAAAACTATATAAAAACATGG + Intergenic
1011272377 6:85593011-85593033 CTCAAAAATAAAAAATTCTAAGG + Intronic
1011454022 6:87527305-87527327 CTCAAAAAAATAAAAAGGAAAGG + Intronic
1011606660 6:89113173-89113195 CTCAAAAAAAAATAAATCATTGG - Intronic
1011694817 6:89902636-89902658 CTCCAAAAAATAAAAATAAAGGG - Intergenic
1011717307 6:90120983-90121005 CTCAATCATATCTAATTCAATGG - Intronic
1011737085 6:90321771-90321793 CTCAGAAATATATAAATGAATGG + Intergenic
1011816635 6:91198950-91198972 CACAGCAATATATAAACCAAAGG - Intergenic
1011921281 6:92580051-92580073 CTCAAAACTGTATAAATACATGG + Intergenic
1011933254 6:92739847-92739869 TAGAAAAATATATAAATCAATGG - Intergenic
1011948128 6:92933254-92933276 CTATAAGAAATATAAATCAAAGG - Intergenic
1012004268 6:93692968-93692990 GTCAAAAATGTATACAACAATGG - Intergenic
1012012236 6:93804046-93804068 TTTAAAAATATATAAATCATTGG - Intergenic
1012016152 6:93854307-93854329 CTCGAAACTATACAAATCCATGG - Intergenic
1012123523 6:95397486-95397508 AACAAAAATATATAAAAGAAGGG - Intergenic
1012363831 6:98415413-98415435 TTAAAAAATATATAAATAAAAGG + Intergenic
1012405160 6:98887808-98887830 GTCAAATAGAAATAAATCAAAGG + Intronic
1012603176 6:101123464-101123486 CATAAAAATATATAAATAACTGG - Intergenic
1012658996 6:101862427-101862449 CTTAAAAATATATAAATATAAGG - Intronic
1012704617 6:102505934-102505956 GGAAAAAAAATATAAATCAATGG + Intergenic
1012738257 6:102978698-102978720 CTCAAAAGTATATATACAAATGG + Intergenic
1012787063 6:103644240-103644262 ATCAAAATTATTTTAATCAAGGG + Intergenic
1012858202 6:104528000-104528022 CTCAGAAACAAATAAAGCAAAGG + Intergenic
1012870075 6:104662078-104662100 CTCAAAACTATACAAATACATGG + Intergenic
1012890070 6:104887129-104887151 CTCAAAAATATAAAATTCCTAGG + Intergenic
1012965878 6:105672270-105672292 CTCAAAACTATAGAAATACATGG + Intergenic
1013168349 6:107614367-107614389 TTAAAAAATATATATATGAAAGG + Intronic
1013262485 6:108459448-108459470 ATCTAAAATATATGAAACAATGG - Intronic
1013495730 6:110695205-110695227 CTCAAAACTATACAAATACATGG + Intronic
1013619778 6:111876975-111876997 CACACAAATAAATAAATAAATGG - Intergenic
1013699867 6:112752603-112752625 CAAACAAATACATAAATCAATGG - Intergenic
1013897804 6:115112742-115112764 CTAATAAATATATAATTCAATGG - Intergenic
1014355043 6:120397916-120397938 CTCAAAAATAGACATATAAATGG + Intergenic
1014410242 6:121107599-121107621 CACAAAAGAAGATAAATCAATGG - Intronic
1014421250 6:121248169-121248191 CTCAAAACTATACAAATACATGG + Intronic
1014581609 6:123144441-123144463 CTCAAAACTATACAAATACATGG + Intergenic
1014746926 6:125211339-125211361 CTTACAGATATATAAAACAATGG - Intronic
1015140781 6:129929069-129929091 CTGAAAAATATAAAAATTACTGG - Intergenic
1015268921 6:131319095-131319117 CTCAAAAAAATATTAATAAGTGG - Intergenic
1015609979 6:135006540-135006562 TTCAAAAGAATAGAAATCAAGGG + Intronic
1015610950 6:135017611-135017633 TTTAAAAATATATAAAGAAAAGG + Intronic
1015941437 6:138456398-138456420 ATAAGAAATATTTAAATCAAAGG - Intronic
1016044226 6:139464940-139464962 GTCCAAAATTTATAAATTAAAGG + Intergenic
1016136454 6:140549824-140549846 CTCAAAATAATATAGATAAATGG - Intergenic
1016167311 6:140962767-140962789 CTCAAAAAAAGATAAACAAATGG - Intergenic
1016312422 6:142748111-142748133 CTCAAAAAAATAAAAATCCATGG + Intergenic
1016570826 6:145510441-145510463 CTCAAAACTACATAAATACATGG + Intronic
1016718218 6:147259098-147259120 TTTAAAAATATATAAATAATGGG - Intronic
1016735279 6:147471718-147471740 CTCAAAACTATACAAATACATGG - Intergenic
1016847152 6:148579876-148579898 AGCAAAAATAAATAAATAAATGG - Intergenic
1017049841 6:150380087-150380109 TTCACTAATATATATATCAAAGG + Intronic
1017640297 6:156487317-156487339 CTCAAAAATAAATAAATAAAAGG - Intergenic
1018130641 6:160729594-160729616 CTCAAAAATATATTAAGGAAAGG + Intronic
1018176935 6:161185230-161185252 ATCAAAAGAATATAAATTAATGG - Intronic
1018217231 6:161540412-161540434 CCCATAAAAATATATATCAATGG + Intronic
1018636688 6:165866992-165867014 CACAAAAATATAAAACTCACTGG + Intronic
1018759467 6:166878797-166878819 TTCCAAAATATATAAAACAATGG + Intronic
1018925001 6:168199697-168199719 TTAAAAAATAAATAAATAAATGG - Intergenic
1019871661 7:3769450-3769472 CTCATTAATATATTAATCCATGG + Intronic
1020248181 7:6447007-6447029 CTCAAAAAAATAAAAAGAAAAGG + Intronic
1020384447 7:7582753-7582775 CTGAAAAATAAATTAATAAATGG + Intronic
1020410216 7:7883945-7883967 GACAAAAATAAATAAATAAATGG + Intronic
1020465243 7:8471179-8471201 CTCAAAATTAAAGAAAACAATGG + Intronic
1020592087 7:10152447-10152469 CTCAAAACTATACAAATATATGG + Intergenic
1020637083 7:10709787-10709809 ATCAAAAAAATAAAAATCACTGG - Intergenic
1020985856 7:15133583-15133605 TTCAAAGATATATGAGTCAAAGG + Intergenic
1021057831 7:16072573-16072595 CTCAAAAAAATAAAAATAAAAGG + Intergenic
1021182457 7:17523651-17523673 TTGAAAAATTCATAAATCAATGG + Intergenic
1021367776 7:19802332-19802354 GACAAAAATAAATAAATAAAAGG - Intergenic
1021424977 7:20488762-20488784 CTGAAATAAATATAAACCAAAGG + Intergenic
1021591205 7:22264690-22264712 CTCAAAAATCTCTAAATCAGAGG + Intronic
1021750292 7:23792459-23792481 CTCAAGAAGACATAAATAAATGG + Intronic
1021934979 7:25621302-25621324 CTCAAAAATGTTTAACTGAAAGG - Intergenic
1022390489 7:29939604-29939626 CCAAACAATATATAAATAAATGG + Intronic
1022471958 7:30687571-30687593 CACAAAAAAATTTAACTCAAAGG - Intronic
1022549433 7:31224772-31224794 CACAAAAATATAAAACTCACTGG - Intergenic
1023571461 7:41576659-41576681 CACAAAAGTATATAAGTCCATGG - Intergenic
1023692901 7:42810510-42810532 AAAAAAAACATATAAATCAAGGG + Intergenic
1023807884 7:43887287-43887309 CTCAAAAATAAATAAGTTTAAGG - Intronic
1024416316 7:49111720-49111742 ATTAAAAATAAATAAATAAATGG - Intergenic
1024438843 7:49391181-49391203 TTAAAAAATGTACAAATCAATGG - Intergenic
1024702706 7:51921964-51921986 ATCAAAAATATAAAAAACCAGGG + Intergenic
1024702777 7:51922669-51922691 TTGAAAAATATAGAAATAAAGGG + Intergenic
1024773312 7:52751665-52751687 ATCAAAAAGATCTAAATGAATGG + Intergenic
1024782053 7:52862591-52862613 CTCAAAAATAGATAAATGTTAGG - Intergenic
1025195023 7:56925901-56925923 CTCAAAAATAAATAAATAAAAGG + Intergenic
1025287318 7:57675236-57675258 CTAACAAATATATAGACCAATGG + Intergenic
1025676929 7:63651042-63651064 CTCAAAAATAAATAAATAAAAGG - Intergenic
1025714674 7:63943630-63943652 CACCAAAATATAAAGATCAATGG + Intergenic
1025789624 7:64677169-64677191 CTCAAAAAAAAAAAAATCCATGG - Intronic
1026093337 7:67319236-67319258 CTCAAAAAAATATAAAATACTGG - Intergenic
1026144332 7:67733349-67733371 TACAAAAATACATAAATGAATGG - Intergenic
1027027904 7:74867737-74867759 CTCAAAAAAATAAAAAATAAGGG + Intergenic
1027059845 7:75076334-75076356 CTCAAAAAAATAAAAAATAAAGG - Intergenic
1027074676 7:75181237-75181259 CTCAAAAAAAAAGAAATCACAGG - Intergenic
1027391104 7:77704563-77704585 GCCAAAAATAAATAAATTAATGG - Intronic
1027626766 7:80554559-80554581 ACCAAAAATAAATAAATAAATGG - Intronic
1027834627 7:83224442-83224464 AGACAAAATATATAAATCAATGG + Intergenic
1027887366 7:83926336-83926358 CTCCAAAAAAGATAAATAAATGG - Intergenic
1027928299 7:84496655-84496677 CTCTAAAATATATCATGCAATGG + Intergenic
1028261901 7:88676640-88676662 CTCAAAATCATATAAATACATGG + Intergenic
1028319729 7:89444405-89444427 CACAAAAATAGAGAAAGCAATGG - Intergenic
1028402146 7:90435334-90435356 CTCAAAACTATGTAAATACATGG + Intronic
1028583232 7:92427873-92427895 ATGAAAAATAAACAAATCAATGG - Intergenic
1028605635 7:92652411-92652433 CTAAAAAATAAATATATGAAAGG - Intronic
1028967909 7:96823260-96823282 ATAAAAAATAAATAAATAAAAGG - Intergenic
1029100064 7:98122165-98122187 CACAAAAGCATATAAATCAATGG - Intronic
1029225745 7:99027167-99027189 CTCAAAAAAATAAAAAAAAAAGG + Intergenic
1029273196 7:99389231-99389253 CTCAAAAATATATATATGGCCGG - Intronic
1029310719 7:99661130-99661152 CTCAAACATATATAGAGAAAAGG - Intronic
1029315702 7:99711366-99711388 CTCAAACATATCTAAAGGAAAGG - Intronic
1029546050 7:101211179-101211201 CTCAAGAAAATAAAAAACAAGGG - Intronic
1029619939 7:101684060-101684082 CTCAAAAATAAATAAATAGGCGG + Intergenic
1029627406 7:101728860-101728882 ATTAAAAATATACAATTCAATGG - Intergenic
1029673306 7:102048826-102048848 CTCAAAAATAAATAAATAAAGGG + Intronic
1029903768 7:104070381-104070403 CTCATAAATAAATAAATAAATGG - Intergenic
1030251092 7:107445900-107445922 GTCAAAAATACATAAATACAGGG + Intronic
1030376541 7:108758862-108758884 CTCAAAACTATATAATTACATGG + Intergenic
1030476952 7:110048044-110048066 CTCAAAGATTTGTAACTCAAAGG - Intergenic
1030529188 7:110691668-110691690 CTCAAAAAAAGATAAACAAATGG + Intronic
1030639629 7:111989414-111989436 TTAAAAAATAAATAAATAAAAGG - Intronic
1030904564 7:115166124-115166146 CTCAAAACTATACAAATACATGG - Intergenic
1030921999 7:115402487-115402509 TTCAAAAATATGTAACTTAAAGG + Intergenic
1030946618 7:115730616-115730638 CACAACAAAATATAAATGAATGG - Intergenic
1031033274 7:116758365-116758387 ATCAAAAGGATATAACTCAATGG - Intronic
1031139811 7:117930046-117930068 CTCAAAAAATTTTAAATCCAGGG + Intergenic
1031160551 7:118162311-118162333 TTCAAAAAGACATAAATAAATGG - Intergenic
1031254055 7:119425646-119425668 GAAAAAAATATATAAATAAATGG - Intergenic
1031432663 7:121691775-121691797 CTTAAAAAAAAATAAGTCAAAGG - Intergenic
1031523956 7:122801152-122801174 CTCAAAAATATGTACATATAGGG + Intronic
1031567270 7:123316051-123316073 CTCAAAACTATACAAATACATGG + Intergenic
1031695477 7:124847082-124847104 CTGAAGAAAATATAAATAAATGG + Intronic
1031703133 7:124949856-124949878 CTCAAAACTATAAAAATCCTGGG + Intergenic
1031730498 7:125294125-125294147 CTCTACAATAAATAAATAAATGG - Intergenic
1031874875 7:127128100-127128122 CTCAAAAATATAAAAGATAAAGG + Intronic
1031925967 7:127638933-127638955 CTCAAAAATAAATAAATAAAAGG - Intergenic
1031959392 7:127975225-127975247 CTCAAAAACACCTAAATTAATGG - Intronic
1032064698 7:128758307-128758329 ATTAAAAAGATAGAAATCAAAGG - Intronic
1032166741 7:129551247-129551269 CTCGAAAATATATATATGCAAGG - Intergenic
1032279543 7:130490029-130490051 ATGAAAAATATATAATGCAAAGG + Intronic
1032310096 7:130778351-130778373 CTCAAAACTATATAATTTCATGG - Intergenic
1032888089 7:136163836-136163858 CTCAAAAGCCTATAAATCTAAGG - Intergenic
1033081788 7:138305761-138305783 TTCAAAAATATATATATGTACGG + Intergenic
1033427196 7:141254885-141254907 TTCAGAAATATATGAATCAGGGG + Intronic
1033462396 7:141559093-141559115 CTAAAAACAATATATATCAAAGG - Intronic
1033777762 7:144631758-144631780 ATGAAAAATATAAAAATTAAAGG + Intronic
1033779522 7:144651999-144652021 CACAATAATATATAAAACACGGG + Intronic
1034153702 7:148937192-148937214 CTCAGAAAAATAAAATTCAATGG + Intergenic
1034219807 7:149435169-149435191 CTCAAAAATATGTACATATATGG - Intronic
1034228818 7:149502988-149503010 CTCAAAAATTGACAACTCAAAGG - Intergenic
1034653863 7:152713065-152713087 CTCAAAAAAAAATAAAGAAAAGG - Intergenic
1034790535 7:153963994-153964016 CTCATAAATAAATAAATAAAAGG - Intronic
1034853082 7:154514273-154514295 CTCAAAAAGAAAAAAATAAATGG + Intronic
1035138413 7:156730934-156730956 TTCATAAATAAATAAATAAATGG + Intronic
1035149711 7:156859645-156859667 TTTAAAAATATCTAAATTAATGG + Intronic
1035348315 7:158223632-158223654 TTCAGAAAAATAGAAATCAAGGG + Intronic
1035367081 7:158356057-158356079 TTCACACACATATAAATCAATGG + Intronic
1035903259 8:3480363-3480385 CTCAAAAATAAAAAATTAAAAGG + Intronic
1036179623 8:6573032-6573054 TTAAAAAATAAATAAATAAAAGG + Intronic
1036437961 8:8753000-8753022 CTCAAAAAAAAAAAAATCAAAGG + Intergenic
1037061250 8:14512457-14512479 CTAAAATATAAATAAATAAATGG - Intronic
1037102299 8:15061552-15061574 ATTAAAAATAAATAAATAAAAGG + Intronic
1037207526 8:16341183-16341205 CTCAAAATAATAAAAGTCAATGG - Intronic
1037293419 8:17375087-17375109 CTCAAAAATGAATAAATAATAGG + Intronic
1037369253 8:18156609-18156631 TTCATAAAGAAATAAATCAAAGG + Intergenic
1037394419 8:18427038-18427060 TTCAAAAATATAAATGTCAAAGG - Intergenic
1037462352 8:19124494-19124516 ATAAAAAATATCTAAATAAATGG - Intergenic
1037519638 8:19667728-19667750 ATCAAAAATGTAAAAATCATAGG + Intronic
1038284219 8:26192317-26192339 TTCAAAAGTATCTAAATCACAGG - Intergenic
1038903207 8:31867374-31867396 CTCTGAAACATACAAATCAAGGG - Intronic
1039038077 8:33381163-33381185 ATATAAAATATATAAAGCAATGG + Intronic
1039040373 8:33402224-33402246 CTCCAAATTAATTAAATCAAAGG + Intronic
1039044893 8:33441022-33441044 ATAAAATATATATAAATAAATGG + Intronic
1039418724 8:37418136-37418158 CCTAAAAATAGAGAAATCAACGG + Intergenic
1039843518 8:41309646-41309668 ACCAAAAATACATAAATAAAAGG + Intergenic
1040571014 8:48610269-48610291 CTCAGAAAAATAGAAATAAAGGG + Intergenic
1040784829 8:51153537-51153559 CTTAAAAATATATATTTGAAAGG + Intergenic
1040820376 8:51549532-51549554 CTCAAAAATATACAAATACATGG + Intronic
1040847806 8:51862870-51862892 CTCAAAAATATATAAGTACAAGG + Intronic
1041139280 8:54798012-54798034 CTCAAATAAAAATAAATAAAAGG - Intergenic
1041558535 8:59187031-59187053 ATCAAAAATAAATGAATAAATGG - Intergenic
1041602057 8:59730665-59730687 TTTAAAAATACATAAAACAAGGG + Intergenic
1041983286 8:63888920-63888942 CACACGAATATACAAATCAAAGG + Intergenic
1042176441 8:66041504-66041526 CTCACAAATAGAGAAAACAAGGG + Intronic
1042488616 8:69374302-69374324 AGCAAAGATATATAGATCAATGG + Intergenic
1042608215 8:70568159-70568181 CTCAAAACTATACAAATACATGG + Intergenic
1042937234 8:74072138-74072160 TTAAAAATTATATAGATCAATGG - Intergenic
1043072134 8:75651507-75651529 CTCAAAAAAAAATAAGGCAATGG + Intergenic
1043104090 8:76085936-76085958 CTCAAAGCTATATAAATACATGG - Intergenic
1043187866 8:77178039-77178061 CTCAAAAAAACATAAATAATGGG - Intergenic
1043193784 8:77263877-77263899 CTCAAATATATATAAATATATGG + Intergenic
1043360378 8:79464990-79465012 CTCAAAACTAAACAAGTCAAAGG + Intergenic
1043413214 8:80021337-80021359 CTCAAAAATTTATTAATGAAGGG + Intronic
1043537561 8:81223120-81223142 CTCAAAACTATACAAATACATGG - Intergenic
1043594416 8:81866970-81866992 CTCAAAACTAAATAAATACATGG + Intergenic
1043929504 8:86074828-86074850 CTCAATAATAAATAAATAAATGG + Intronic
1044341339 8:91049459-91049481 GTTAAAAATGTTTAAATCAAGGG - Intergenic
1044387654 8:91608721-91608743 TTGAAAAATAAATAAATAAAAGG + Intergenic
1044620201 8:94183376-94183398 CATAAACATATATAGATCAATGG + Intronic
1044646235 8:94446434-94446456 CAAGAAAATATATAAAGCAAGGG + Intronic
1045153334 8:99435357-99435379 CTCAAAATGATATCAATAAAAGG - Intronic
1045471894 8:102520084-102520106 CTCAAAAATATACAGATGAAAGG + Intergenic
1045634624 8:104169954-104169976 CTCAAAACTATACAAATACATGG - Intronic
1045883491 8:107068601-107068623 CTAAAGATAATATAAATCAAAGG + Intergenic
1045952168 8:107864882-107864904 CTCAAAACTATACAAATATATGG - Intergenic
1046140006 8:110079262-110079284 CTAAAAAAGAAATAAAGCAAAGG - Intergenic
1046456518 8:114471617-114471639 AACAAAAATATATAAATTTAAGG - Intergenic
1046538334 8:115545977-115545999 CTCAAAAAAGTATATAACAATGG + Intronic
1046628172 8:116597465-116597487 CACATAAATATATGAATGAATGG + Intergenic
1046795052 8:118362326-118362348 TTAAAAAATATATAAAACAAAGG + Intronic
1046972764 8:120240730-120240752 CTTAAACATATGTAAAACAAGGG + Intronic
1047001126 8:120573544-120573566 AGCAAAAATAAATAAATAAATGG - Intronic
1047552913 8:125895973-125895995 AAAAAAAATATATAAATAAAGGG - Intergenic
1047965638 8:130044358-130044380 CTCAAAAATAAACAAACAAAAGG + Intergenic
1048015975 8:130498343-130498365 CAAAAAAATAAATAAATAAAAGG - Intergenic
1048291716 8:133186243-133186265 CTGAAAAATATAGAACTCAGTGG + Intergenic
1048667136 8:136674943-136674965 CTCAATAATATATGAAAGAAAGG + Intergenic
1048983528 8:139716236-139716258 TTCAAAAAATTAAAAATCAATGG + Intergenic
1049002557 8:139835313-139835335 TTCAGAAATTTATTAATCAAAGG - Intronic
1049545269 8:143227875-143227897 TTCATAAATAGATAAATAAATGG - Intergenic
1049938881 9:525661-525683 CTCAAAAATATGAAATTCTACGG - Intronic
1049941695 9:552049-552071 CTCAAAAAAACAAAAATAAAGGG + Intronic
1049943140 9:568255-568277 AACAAAAATATAAAAATGAATGG - Intronic
1050340614 9:4634265-4634287 CTCAAAATAAAATAAATTAAAGG + Intronic
1050476050 9:6042156-6042178 CTCAAAACTATACAAATACATGG - Intergenic
1050582757 9:7078087-7078109 TTAAAAAATAAATAAATAAATGG - Intergenic
1050846501 9:10227360-10227382 TACAAAAATACACAAATCAATGG + Intronic
1050900513 9:10942290-10942312 CTTAAAAATATATATATTATTGG - Intergenic
1051072630 9:13190509-13190531 ATTAAAAATATATGATTCAAAGG + Intronic
1051096679 9:13474574-13474596 CTCAAAACTATATAATTACATGG - Intergenic
1051103447 9:13549613-13549635 ACCAAAAATATATAAAACAAAGG + Intergenic
1051133309 9:13888628-13888650 TTTAAAAAGATATAAATAAATGG + Intergenic
1051460504 9:17307892-17307914 CTCAAAATTATATACAGCTACGG - Intronic
1051477068 9:17519482-17519504 CTGAAACATAAATAAAACAAAGG + Intergenic
1051886007 9:21893855-21893877 TTCAAAAAAAAAAAAATCAAAGG + Intronic
1052036119 9:23682959-23682981 TTCCAAAAGACATAAATCAATGG + Intergenic
1052133915 9:24887686-24887708 TTATAAAATATATAAATCACAGG - Intergenic
1052189726 9:25645670-25645692 CTCAAAAACATATAATTACAGGG - Intergenic
1052302290 9:26966308-26966330 CTGACAAATATATAAAGAAAAGG - Intronic
1052311111 9:27070282-27070304 CTCAGAAATAAATAATTCACAGG - Intergenic
1052478198 9:28989010-28989032 TTTAAAAATATATAATTAAAGGG - Intergenic
1052620542 9:30903180-30903202 CTCAAAAATTTGTACACCAAAGG - Intergenic
1053107106 9:35419540-35419562 CTCAAAACTATACAAATACATGG + Intergenic
1053178861 9:35950342-35950364 CTCAAAAAAATAAAAAATAAAGG + Intergenic
1053213105 9:36248312-36248334 CTCAAAAAAAAAAAAAGCAAAGG - Intronic
1054844568 9:69779970-69779992 CTCAAAACTATACAAATACATGG - Intergenic
1055019263 9:71651218-71651240 TTCAAAAAAATTGAAATCAAGGG + Intergenic
1055028768 9:71750745-71750767 CTCTAAAAAATAGAAATTAAAGG - Intronic
1055178361 9:73349790-73349812 AGCAAAAATAAATAAATAAATGG + Intergenic
1055334729 9:75222008-75222030 TTCAAAAATATATAAGCAAATGG - Intergenic
1055408961 9:76006866-76006888 CCAAAAAATACATAAATAAAGGG - Intronic
1055471139 9:76612293-76612315 GTTAAAAATATATATATAAATGG + Exonic
1055478223 9:76684750-76684772 CTCAAAAATAAATAAATAAGAGG - Intronic
1055959545 9:81807437-81807459 CTCAAAAATAAATAAATAAATGG + Intergenic
1056170197 9:83978606-83978628 CTAAAAAATACAAAATTCAAGGG + Intronic
1056215633 9:84403602-84403624 CAAAAAAATAAATAAATAAAAGG - Intergenic
1056295322 9:85187437-85187459 CTCCAAAATATATACTTTAAAGG + Intergenic
1056898002 9:90569025-90569047 CTCAAAAAAACATAGCTCAAAGG + Intergenic
1057136163 9:92689545-92689567 CTCAAAAATAAAAAAAAAAAAGG - Intergenic
1057442784 9:95094105-95094127 CACATAAAGATATAAATGAAAGG - Intergenic
1057557369 9:96098664-96098686 CTCAAAAACAAATGAAACAAAGG + Intergenic
1057741684 9:97717490-97717512 CTCAATCAGACATAAATCAAAGG + Intergenic
1057998884 9:99845543-99845565 CCTAAAAATATATAACTGAAAGG - Intronic
1058244023 9:102602664-102602686 ATTAAAAATAAATAAATAAATGG - Intergenic
1058361158 9:104147951-104147973 ATCCATAATATATAAAACAATGG + Intergenic
1058690039 9:107512246-107512268 CTCAAAAATAAATAAATAAAAGG + Intergenic
1059073944 9:111169079-111169101 CTCAAAAAAAAAAAAATGAAAGG + Intergenic
1059143335 9:111874999-111875021 CTCAAAAATAAATAAATAAATGG - Intergenic
1059180254 9:112205452-112205474 CTCAAAAAACTAGACATCAAAGG - Intergenic
1059212947 9:112531394-112531416 ATAAAAAATAAATAAATAAAAGG + Intronic
1059261057 9:112977169-112977191 TTCACTAATATATAAATCAGTGG - Intergenic
1059294170 9:113254896-113254918 CTCAAAAATAAATAAATAAAAGG + Intronic
1059663451 9:116424215-116424237 TTTAAAAATAGATAAATAAAGGG + Intergenic
1060146279 9:121255242-121255264 CTCAAAAATAAATAAATGGCCGG - Intronic
1060615364 9:125008143-125008165 CTCAAAAAGAAAAAAATAAAGGG - Intronic
1060634727 9:125190827-125190849 CTCAAAAATAAATTAGTAAAAGG + Intergenic
1060635943 9:125200137-125200159 CAAAAAAATAAATAAATAAAAGG - Intergenic
1060873736 9:127064857-127064879 CAAAAAAATAAATAAATCCAGGG - Intronic
1060907444 9:127319479-127319501 CTCAAAAAAATAAAAAAAAAAGG + Intronic
1061155189 9:128855889-128855911 CTACAAAATATATAAATAATTGG + Intronic
1061185735 9:129052124-129052146 CTTAAAAATAAATAAATTACAGG - Intronic
1061294617 9:129670367-129670389 CTAAAAAATAAAAAAATTAAAGG - Intronic
1061345134 9:130017825-130017847 ATCAAAAAAATAAAAAACAATGG + Intronic
1061811590 9:133165255-133165277 CTTAAAAATATAATAATCAAAGG + Intergenic
1061811858 9:133166979-133167001 CTTAAAAATATAATAATCAAAGG + Intergenic
1061976764 9:134072269-134072291 CTCAAAAAAATAAAAAGAAAAGG + Intergenic
1062014826 9:134286045-134286067 ATTAAAAATAAATAAATAAAAGG - Intergenic
1062132652 9:134908327-134908349 TACAAAAATAAATAAATCACAGG - Intronic
1185781622 X:2852474-2852496 AGCAAAAATAAATAAATAAATGG + Intronic
1185879898 X:3731677-3731699 CTCAAAAATAAATAAATAAAAGG + Intergenic
1185984631 X:4818253-4818275 CTTATAAATAAATAAATGAATGG + Intergenic
1186029671 X:5354264-5354286 CTCAAAAATAAATAAGAAAAAGG - Intergenic
1186213792 X:7278116-7278138 CACAAACATCTATAAATCAGGGG - Intronic
1186236227 X:7513986-7514008 CTCATAAAAACATAAATAAATGG + Intergenic
1186416660 X:9389381-9389403 CTCTACAATAAATAAATAAATGG + Intergenic
1186477433 X:9868542-9868564 CTCAAAAAAATAAAAATAAAAGG - Intronic
1186766397 X:12774765-12774787 TTCAAAGATATAAAAATCAAAGG - Intergenic
1186910219 X:14156014-14156036 CATAAAAATAGACAAATCAATGG + Intergenic
1186921153 X:14281874-14281896 AACAAAAATAAATAAATAAATGG - Intergenic
1186956120 X:14684047-14684069 CTAAAAAATAAATAAATAAATGG + Intronic
1187203450 X:17158314-17158336 TTAAAAAATATACAAGTCAAGGG - Intergenic
1187242790 X:17528792-17528814 CTCAAATATTTATAAATATATGG + Intronic
1187249846 X:17587074-17587096 CTCATAAATTAATTAATCAATGG - Intronic
1187325294 X:18281200-18281222 CTCAAAACTACATAAATACATGG + Intronic
1187567971 X:20471147-20471169 TTAGAAAATATACAAATCAAAGG - Intergenic
1187924291 X:24236136-24236158 CTCAAAAAAATAAAAATAAGGGG + Intergenic
1188058414 X:25569063-25569085 CTCAAAACTATACAAATACATGG - Intergenic
1188177273 X:27006325-27006347 CTCAAAAGTAGATATATAAATGG - Intergenic
1188273643 X:28174892-28174914 CTCAAAACTATACAAATAGAAGG - Intergenic
1188408345 X:29839977-29839999 TTTAAAAATAGCTAAATCAATGG - Intronic
1188701134 X:33265365-33265387 CAAAAAAATAAATAAATAAAAGG - Intronic
1188921560 X:35984738-35984760 CTCAAAACCATATAATTAAATGG - Intronic
1189659603 X:43283118-43283140 CTCAAAATCATATAATTAAATGG - Intergenic
1189677950 X:43482345-43482367 CTTAAAAATATATAAAAACATGG - Intergenic
1189913986 X:45838877-45838899 CTCAAAAATATAAAAAATATAGG + Intergenic
1190028914 X:46952988-46953010 CTCAAAAAAAAAAAAAGCAATGG + Intronic
1190100011 X:47515452-47515474 CAAAAAAATAAATAAATAAAAGG - Intergenic
1190124776 X:47694250-47694272 CTCAAATATTTATGAATAAAAGG + Intergenic
1190257207 X:48772536-48772558 CTCTACAATAAATAAATAAAAGG + Intronic
1190715985 X:53104038-53104060 CTCAAAAATAAATAAATAAAAGG - Intergenic
1191115866 X:56852040-56852062 CTCAAAAAAATAAAAATAAATGG + Intergenic
1191176934 X:57514179-57514201 CTCAAAAACATAAAATTCCATGG - Intergenic
1191689302 X:63923418-63923440 CTCAAAAATAAAAAAAAAAAAGG + Intergenic
1191712808 X:64169914-64169936 CAAAAAAATAAATAAATAAAAGG - Intergenic
1191744657 X:64473194-64473216 ATTAAAAATAAATAAATAAAAGG - Intergenic
1191770238 X:64748089-64748111 CTCAAAACTATACCAATAAATGG - Intergenic
1191787411 X:64931642-64931664 CTCAAAACTATAGAAATACATGG - Intronic
1191832113 X:65427327-65427349 CTCAAAAAAATTAAAATAAAGGG - Intronic
1191995154 X:67087345-67087367 CACAAAAATATAAAACTCACTGG - Intergenic
1192002920 X:67175054-67175076 CTCAAAACCATATAATTAAATGG - Intergenic
1192117324 X:68423804-68423826 CTGAAAAATGGATAAATAAAAGG - Intronic
1192120304 X:68448991-68449013 AACAAAAATAAATAAATAAATGG + Intergenic
1192682928 X:73271202-73271224 CTCAAAATTATACAAATATATGG + Intergenic
1192700915 X:73471275-73471297 CTCAAAATTATAGAAATACATGG - Intergenic
1192745799 X:73937622-73937644 TATAAATATATATAAATCAAAGG + Intergenic
1192796134 X:74425273-74425295 CACAAAACTGTATACATCAAAGG - Intronic
1193019156 X:76770918-76770940 CTCAAAATTATACAAATACATGG + Intergenic
1193098094 X:77576676-77576698 CTCATAAATATATGTATCATTGG - Intronic
1193110008 X:77719305-77719327 CTCAAAAGAATATATACCAATGG + Intronic
1193207648 X:78767300-78767322 ATAAAAAATAAATAAATAAATGG + Intergenic
1193252022 X:79302188-79302210 CTCAAAACTACAAAAATCCATGG + Intergenic
1193270688 X:79526890-79526912 CTCAAAACTATACAAATATATGG + Intergenic
1193291097 X:79773700-79773722 CTCAACAATTTAAGAATCAAAGG - Intergenic
1193506886 X:82355788-82355810 TTCAAAAATATATAATTCTTAGG + Intergenic
1193509830 X:82385014-82385036 CCCAAAAATATGAATATCAATGG - Intergenic
1193749370 X:85324007-85324029 CTCAAAACCATATAATTAAATGG - Intronic
1193796233 X:85877913-85877935 AATAAAGATATATAAATCAATGG + Intronic
1193806401 X:86001097-86001119 CCCAAAAATATATACAACTATGG + Intronic
1193965361 X:87978233-87978255 CTCAAAATTATACAAATACATGG + Intergenic
1193981872 X:88191069-88191091 CTCAAAACTATACAAATACATGG + Intergenic
1193982357 X:88198532-88198554 CTCAAAAAAAGATATATAAATGG + Intergenic
1194001541 X:88435517-88435539 CTCAAAACTATACAAATACATGG - Intergenic
1194103399 X:89736129-89736151 CTCAAAACTATACAAATACATGG - Intergenic
1194110758 X:89831251-89831273 CTCAAAAGAAGATAAATAAATGG + Intergenic
1194350002 X:92814969-92814991 CTAAAGAATACATAAATAAATGG + Intergenic
1194393385 X:93348359-93348381 GACAGAAATATATAAATAAAAGG + Intergenic
1194490956 X:94548912-94548934 CTAAAGAAAATATAATTCAATGG - Intergenic
1194615087 X:96090537-96090559 CTCAAAACTATACAAATACATGG + Intergenic
1194770361 X:97896079-97896101 TTCAAAAATATTTAAAGCATGGG + Intergenic
1194771381 X:97910264-97910286 CAAAAAAATAACTAAATCAAAGG - Intergenic
1194824864 X:98549461-98549483 CTCAAAAATATAAAAACCCTGGG - Intergenic
1194871027 X:99131357-99131379 CTCACTTATATATAAATAAAAGG + Intergenic
1194934737 X:99935359-99935381 CTCAAAACTATACAAATACATGG - Intergenic
1195037791 X:100985963-100985985 CTTAAAAGTATAGAAATGAAGGG + Intronic
1195061933 X:101204808-101204830 CACACAAATATATAACTCAATGG - Intergenic
1195242920 X:102970945-102970967 CTCAAAACTATACAAATACATGG + Intergenic
1195503784 X:105633485-105633507 CTCGAAAATTTAAAAATGAAAGG + Intronic
1195508898 X:105691275-105691297 CTCAGAAGTATATAACTCATTGG + Intronic
1195604427 X:106786808-106786830 CAAAAAAATATATATATGAATGG + Intronic
1195632818 X:107077129-107077151 CTCAAAAAAATTCATATCAAAGG - Intronic
1195825312 X:108993402-108993424 TTCAAAAAAAAAAAAATCAATGG + Intergenic
1195926277 X:110028912-110028934 CTCAAAAATATATAAAGTAAAGG - Intronic
1195929641 X:110061751-110061773 CTCAGAAATAGGCAAATCAAGGG + Intronic
1196216494 X:113058339-113058361 CTCAAAATTCTATAAAGCACAGG - Intergenic
1196687031 X:118519819-118519841 CTTAAAAAAATATAAATTAGTGG - Intronic
1196751373 X:119120709-119120731 TTCAAAAATAGCTAAAGCAATGG + Intronic
1196835574 X:119810925-119810947 GACAAAAATAAATAAATAAATGG + Intergenic
1196998437 X:121410075-121410097 CTGAAAAAGATATAAAGAAAAGG - Intergenic
1196998712 X:121414339-121414361 CACAAAAGTATAAAATTCAATGG - Intergenic
1197027870 X:121777018-121777040 CTCAAAACTATACAAATGCATGG - Intergenic
1197325015 X:125082158-125082180 ATAAAAAATAAATAAATGAAAGG + Intergenic
1197436544 X:126435450-126435472 TTAAAGAATATATAAATAAATGG + Intergenic
1197536881 X:127701040-127701062 CTCAAAAAAATCTATATAAAAGG + Intergenic
1197564730 X:128068683-128068705 CTCAAAAATATAGTAATGGAGGG + Intergenic
1197641296 X:128971075-128971097 AGCAAAAATATATGAATCTAGGG - Intergenic
1198000518 X:132430770-132430792 TTCTAAAATAAATAAATAAAGGG - Intronic
1198008890 X:132530274-132530296 CCCAAAACTATATAAATACAAGG - Intergenic
1198068877 X:133128190-133128212 CTCATAAATAAATAAATAAGTGG + Intergenic
1198740061 X:139832747-139832769 TTCAAAAATATATGCAACAAAGG + Intronic
1198758734 X:140008943-140008965 CTCAAAACTATAAAAATACATGG + Intergenic
1198780023 X:140224654-140224676 CTCAAAACTATAAAAATACATGG - Intergenic
1198793608 X:140372422-140372444 ATGAAAAATATGTAAATGAATGG + Intergenic
1198859224 X:141051761-141051783 CTCAAAAAGATAAAAAAAAAAGG - Intergenic
1198950341 X:142062982-142063004 CTCAAAATTATACAAATACATGG - Intergenic
1199077438 X:143540470-143540492 CTCAAAACTATACAAATACATGG + Intergenic
1199109139 X:143909808-143909830 CTTAAAAGAATATAAATCATTGG - Intergenic
1199493391 X:148426202-148426224 CACAAAAATATCTTAATCAGTGG + Intergenic
1199564553 X:149200705-149200727 CTCAAAACTATACAAATACATGG - Intergenic
1199587087 X:149426268-149426290 CTCAAAACTATACAAATACATGG + Intergenic
1199916086 X:152342288-152342310 CTCAAAAGAATATATATAAATGG - Intronic
1199948591 X:152687261-152687283 CTCTAAAAAATAGAAATAAAAGG + Intergenic
1199961087 X:152781188-152781210 CTCTAAAAAATAGAAATAAAAGG - Intergenic
1200658321 Y:5931588-5931610 CTAAAGAATACATAAATAAATGG + Intergenic
1200783889 Y:7241639-7241661 CTCAAAAATAAATAAATAAATGG + Intergenic
1200788859 Y:7282210-7282232 CTCAAAAAAATAAAAATTCATGG + Intergenic
1200978272 Y:9236851-9236873 CTCAAAAATGTATACAGAAATGG + Intergenic
1201261056 Y:12159276-12159298 CTCTAAAATGTATAAAACCAAGG + Intergenic
1201264868 Y:12196187-12196209 CTCATAATCCTATAAATCAATGG + Intergenic
1201309357 Y:12581886-12581908 CTCAAAAATAAATAAATTTTAGG - Intergenic
1201391834 Y:13506048-13506070 CTCAAAACTATAGAAATACATGG + Intergenic
1201853941 Y:18520215-18520237 CTCTAACATATTTAAATAAAGGG + Intergenic
1201879380 Y:18800169-18800191 CTCTAACATATTTAAATAAAGGG - Intronic
1202600105 Y:26585361-26585383 CTCAAAACTACATAAATACATGG - Intergenic