ID: 1167870247

View in Genome Browser
Species Human (GRCh38)
Location 19:52363059-52363081
Sequence GTACAGAGACAGAGTGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1284
Summary {0: 2, 1: 34, 2: 106, 3: 157, 4: 985}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167870247 Original CRISPR GTACAGAGACAGAGTGAGGG GGG Intronic
900033290 1:386630-386652 GTACAGAGACAGAGGGAGAGGGG - Intergenic
900054128 1:616519-616541 GTACAGAGACAGAGGGAGAGGGG - Intergenic
900180077 1:1307491-1307513 GTGCAGACACAGAGCGGGGGCGG + Intronic
900236772 1:1596843-1596865 GGAGAGAGACAGAGAGAGGGAGG + Intergenic
900433252 1:2612715-2612737 GTAGAGAGATGGAGGGAGGGTGG - Intronic
900545855 1:3228820-3228842 GTTCAGAGAGAGAGAGATGGAGG - Intronic
900567459 1:3340566-3340588 GGACAGACTCAGAGTGGGGGAGG - Intronic
900685611 1:3945916-3945938 GCCCAGGGACAGAGAGAGGGGGG - Intergenic
900731279 1:4262481-4262503 ATATACAGACAGAGTGAGGGGGG + Intergenic
902078640 1:13806190-13806212 GTGCAGAGACTGGGAGAGGGCGG - Intronic
902087433 1:13874319-13874341 GCACAGAGAGAGGCTGAGGGAGG - Intergenic
902267605 1:15279465-15279487 GTACAGAGAAAGAGGGAGGGGGG - Intronic
902376420 1:16032173-16032195 GTAGAGAGGGAGAGGGAGGGAGG - Intronic
902634743 1:17727837-17727859 GGAAAGAGAAAGAGAGAGGGAGG - Intergenic
902643846 1:17784219-17784241 GGAGAGAGAAAGAGTGAAGGGGG + Intronic
902727543 1:18347161-18347183 GTTCAGAGAGGGAGGGAGGGAGG - Intronic
902969320 1:20035145-20035167 GTACAGAAAGAGAGGGAGAGAGG + Intronic
903396187 1:23003479-23003501 GTAGAGACACGGAGAGAGGGGGG + Intergenic
903508808 1:23857976-23857998 GCACAGAGACAGATTAAGAGTGG - Intronic
903682940 1:25109156-25109178 GGAGAGAGACAGAGGGAGAGTGG - Intergenic
903934828 1:26888272-26888294 GCACAGAGACAGAGAAGGGGTGG - Intronic
904182746 1:28678232-28678254 TTACAGAGACAGAGGGAAGGGGG + Intronic
904375244 1:30077185-30077207 GGAGAGAGAAAGAGTGAAGGGGG - Intergenic
904393027 1:30198168-30198190 ATACAGAGACAGAGGGGAGGGGG + Intergenic
904671797 1:32171588-32171610 GCAAAGAGTCAGAGGGAGGGAGG - Exonic
904747796 1:32721497-32721519 GGACAGAGACAGAGAGAGTGGGG - Intergenic
905442543 1:38004676-38004698 ATGCAGAGACAGAGAAAGGGAGG - Intronic
905615372 1:39393824-39393846 AGACAGAGAGAGAGGGAGGGAGG + Intronic
905696721 1:39980029-39980051 GTACAGAGACGGAGGGAGGGGGG - Intergenic
906259671 1:44377543-44377565 GTACGGAGAGAGAGGGAGGCGGG + Intergenic
906359343 1:45139395-45139417 GCAGAGAGAGAGAGAGAGGGAGG - Intronic
906951846 1:50341133-50341155 GGACAGAGGCAGAGAGAAGGAGG - Intergenic
907112095 1:51935639-51935661 GAACAGAGACTGAGGGAGGAAGG + Intronic
907293429 1:53433417-53433439 GTAGAGACACAGAGGGCGGGGGG - Intergenic
907770089 1:57452872-57452894 GAAGAGAGAAAGAGGGAGGGAGG + Intronic
908205571 1:61844832-61844854 GGAGAGAGAGAGAATGAGGGGGG - Intronic
908673215 1:66572032-66572054 GTACAGAGACAGAGAGACATTGG - Intronic
908789928 1:67771010-67771032 ATACAGAGAGAGAGAGAGAGAGG + Intronic
908910001 1:69062271-69062293 ACACAGAGACAGAGGGAGGCGGG + Intergenic
908912762 1:69091606-69091628 ACACAGAGACAGAGGGAGGGAGG - Intergenic
909038893 1:70627161-70627183 GGAGAGAGACAGAGTGAGAAGGG + Intergenic
909283055 1:73781545-73781567 GTACAGAGAGAGACAGAGAGAGG - Intergenic
909288726 1:73854895-73854917 AGACAGAGGCAGAGTGAGAGCGG + Intergenic
909985690 1:82158158-82158180 GGAGAGAGACAGAGAGAGTGAGG - Intergenic
910386769 1:86692606-86692628 GTACAGAGACAGAGGGTGGGGGG + Intergenic
910563688 1:88619646-88619668 AGAGAGAGAGAGAGTGAGGGAGG + Intergenic
910631365 1:89358389-89358411 AGACAGAGACAGAGAGAGGGAGG - Intergenic
911218997 1:95227524-95227546 GTAGAGAGAGAGAGAGAGAGAGG + Intronic
911536615 1:99107616-99107638 GGAGAGAGAGAGAGTGAAGGGGG - Intergenic
911589124 1:99726175-99726197 GGAGAGAGAGAGAGTGAAGGTGG - Intronic
911966725 1:104381017-104381039 GTAGAGACACGGAGAGAGGGGGG - Intergenic
911971672 1:104446269-104446291 ATACAGAGAAAGAGAGAGGGAGG - Intergenic
912047700 1:105480784-105480806 GTACAGAGACAGAGGGAGGGGGG - Intergenic
912345032 1:108956045-108956067 CTCCAGAGAGACAGTGAGGGTGG - Intronic
912609429 1:111028273-111028295 GTACAGAGACAGAAGGAGGGGGG - Intergenic
912730002 1:112093778-112093800 AGAGAGAGACAGAATGAGGGAGG + Intergenic
912738402 1:112170870-112170892 ACACAGAGAGAGAGGGAGGGAGG + Intergenic
913062495 1:115220988-115221010 ATAAAGAGAGAGAGTGGGGGTGG + Intergenic
913071429 1:115302532-115302554 GCACACATACAGAATGAGGGTGG + Intronic
913099395 1:115549379-115549401 GTAGAGACACAGAAGGAGGGGGG + Intergenic
913217615 1:116633621-116633643 ATACAGAGACAGAGGGAAGGGGG - Intronic
915103885 1:153520235-153520257 GGAGAGAGAGAGAGGGAGGGAGG + Intergenic
915116458 1:153603739-153603761 ATACAGAGACAGAGGGAGGGGGG - Intergenic
915116802 1:153606489-153606511 GTACAGAGACAGAGGGACGGAGG - Intergenic
915526754 1:156480806-156480828 CAACAGAGACAGAGTGAGTGGGG + Intronic
915537245 1:156544264-156544286 GGCCTGAGACTGAGTGAGGGTGG - Intronic
915551298 1:156636341-156636363 GGAGAGAGAAAGAGTGAGGGAGG - Intergenic
915672535 1:157502519-157502541 GTACAGAGACTGTGTAGGGGAGG - Intergenic
915885801 1:159719321-159719343 GGAGAGAGACAGTGTGAGTGGGG - Intergenic
915999509 1:160601193-160601215 AGAAAGAGACAGAGAGAGGGAGG - Intergenic
916178429 1:162062645-162062667 GTTCAGAGCCAGAGTGGGGGTGG - Intergenic
916294457 1:163202220-163202242 GTACAGGGACTGGGAGAGGGAGG - Intronic
916661479 1:166925914-166925936 GGCCAGAGACAGAGTGAGTCAGG - Intronic
916767780 1:167878436-167878458 GTACTGAGAAAGTGTGAGTGTGG - Exonic
916771434 1:167912633-167912655 ATACAGAGACAGAGGGAGGGGGG - Intronic
916801459 1:168220274-168220296 GTACAGAGACAGAGGGAGGGGGG + Intergenic
917147194 1:171904811-171904833 GTACGGAGGCTGAGGGAGGGTGG + Intronic
917367443 1:174247860-174247882 ATACAGAGACAGAGGGAGAGGGG - Intronic
918042519 1:180921860-180921882 GTACAGAGAGAGCCTGAGCGCGG - Intronic
918128527 1:181605066-181605088 GTCCAGAGATTGAGTGAGGGAGG + Intronic
918147293 1:181768293-181768315 GCATAGAGAGAGAGTGAGGGGGG + Intronic
918956585 1:191216715-191216737 AGAGAGAGAGAGAGTGAGGGTGG + Intergenic
919908290 1:202093468-202093490 GTACAGAGACAGAGGGAGGGAGG + Intergenic
920061635 1:203230819-203230841 ATACAGAGACACAGCGAGGAAGG - Intronic
920208612 1:204312228-204312250 TTTCAGGGACAGAGTGAGGTTGG - Intronic
920639763 1:207741016-207741038 TTACAGAGACAGAGGGAGGGGGG - Intergenic
920707593 1:208265835-208265857 AGACAGAGAAAGAGAGAGGGAGG - Intergenic
921221970 1:212979838-212979860 GTAAAGAGAAAGGGAGAGGGAGG + Intronic
921790777 1:219287881-219287903 GGAGAGAGAAAGAGTGAAGGGGG - Intergenic
922255649 1:223890784-223890806 GTACAGAGACAGAGGGAGAGGGG - Intergenic
922441547 1:225659123-225659145 GGAGAGAGAGAGAGAGAGGGAGG + Intergenic
922550607 1:226491473-226491495 ATACAGAGACAGAGGGAGGGGGG + Intergenic
922551039 1:226494744-226494766 ATACACAGACAGAGGGAGGGGGG + Intergenic
922637164 1:227185644-227185666 CTACAGAGACAGAGGGAGGGGGG - Intronic
922677151 1:227560123-227560145 AGAGAGAGACAGGGTGAGGGAGG - Intergenic
922683346 1:227618988-227619010 GGCAGGAGACAGAGTGAGGGGGG + Intronic
923037206 1:230292600-230292622 GTTGAGAGAGAGAGGGAGGGAGG - Intergenic
923128821 1:231057189-231057211 GGAGAGAGACACAGTGAGGGGGG + Intergenic
923246716 1:232139384-232139406 GTACAGAGACAGAGGGAGTGGGG + Intergenic
923285731 1:232493121-232493143 GGACAGAGAGAGAGTAAAGGGGG - Intronic
923959483 1:239061020-239061042 GAACAGAGACAGAGGGAGGGGGG - Intergenic
924116506 1:240753081-240753103 AGACAGAGAGAGAGGGAGGGAGG - Intergenic
924336845 1:242993649-242993671 GTACAGAGACAGAGGGAGAGGGG - Intergenic
924540620 1:244977579-244977601 GTACAGAGACAGAGGGATGGGGG - Intronic
924576142 1:245282732-245282754 GTATAGAGACAGAGGGAGCGGGG - Intronic
924588746 1:245383051-245383073 ATACAGAGAGAGAGAGAGAGAGG + Intronic
1062785111 10:258164-258186 TTACAGAGGCAGAATGAAGGAGG + Intergenic
1062964395 10:1596046-1596068 GTTCACAGAAAGAGTGAAGGGGG + Intronic
1063157927 10:3397147-3397169 GGAGAGAGAGAGAGAGAGGGAGG - Intergenic
1063692158 10:8297050-8297072 GGAGAGAGACAGAGAGAGAGAGG - Intergenic
1063713138 10:8500174-8500196 GAAGAGAGAAAGAGAGAGGGAGG - Intergenic
1063876484 10:10484202-10484224 GGAGAGAGACAGAGAGAGGAGGG - Intergenic
1064304958 10:14157254-14157276 GTGCAGAGACAGAGAAAGAGAGG - Intronic
1064367196 10:14718530-14718552 GGACAGAGAGAGAGAGAGGAAGG + Intronic
1064389408 10:14928717-14928739 GTACAGAGACAGAGGAAGAGAGG + Intronic
1064625512 10:17257676-17257698 ATACAGAGACAGAGAGAGACAGG + Intergenic
1064627967 10:17280940-17280962 GAAGAGAGAGAGACTGAGGGGGG + Intergenic
1065720843 10:28627585-28627607 ATACAGAGACAGAGAAAGAGAGG - Intergenic
1065781402 10:29171685-29171707 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1065995412 10:31055532-31055554 CAGGAGAGACAGAGTGAGGGGGG + Intergenic
1066110025 10:32187649-32187671 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1066471311 10:35700879-35700901 ATACAGAGACAGAGGGAGAGGGG - Intergenic
1066472788 10:35715726-35715748 ATACACACACAGAGAGAGGGAGG + Intergenic
1066548262 10:36525140-36525162 AACCAGAGACAGAGTGAGCGGGG - Intergenic
1066959671 10:42209392-42209414 GAAAAGAGAGAGAGGGAGGGAGG - Intergenic
1067005832 10:42661073-42661095 CTACATAAACAGAGTGAGGATGG + Intergenic
1067458382 10:46439755-46439777 GTACAAGGACAGACTGAGGAGGG + Intergenic
1067628816 10:47944879-47944901 GTACAAGGACAGACTGAGGAGGG - Intergenic
1067782241 10:49217048-49217070 AGACAGAGACAGAGAGAGAGAGG + Intergenic
1068202631 10:53802317-53802339 AAAAAGAGACAGAGAGAGGGTGG + Intergenic
1068522458 10:58093050-58093072 ATACAAAGACAGAGGGAGGGGGG + Intergenic
1068982894 10:63080058-63080080 ATACAGAGACGGGGTGGGGGAGG - Intergenic
1069777928 10:70937662-70937684 GGACAGAACCAGAGGGAGGGCGG + Intergenic
1069824866 10:71248835-71248857 AGAGAGAGACAGAGAGAGGGAGG - Intronic
1070258095 10:74827198-74827220 GTGCAGAGGGAGAGTTAGGGAGG + Intronic
1071165066 10:82796573-82796595 GTAAAGAGAGAGAGAGGGGGAGG + Intronic
1071200114 10:83212476-83212498 ATACAGAGAAAGAGAGAGAGAGG + Intergenic
1071279737 10:84089806-84089828 CAAGAGAGAAAGAGTGAGGGGGG - Intergenic
1071557595 10:86617074-86617096 GGAGAGAGAGAGAGTGAAGGGGG + Intergenic
1071902894 10:90139873-90139895 ACACAGAGACAGAGAGAGAGGGG - Intergenic
1071920200 10:90341326-90341348 GCAGAGAGAGAGAGGGAGGGAGG + Intergenic
1072677486 10:97479090-97479112 GTATAGAGGCAGAGGGAGGGAGG - Intronic
1072921607 10:99581764-99581786 AGACAGAGAGAGAGAGAGGGAGG + Intergenic
1073192006 10:101658213-101658235 GTACATAGAAAGGGAGAGGGAGG + Intronic
1073281704 10:102359353-102359375 GGACAGAGGCAGAGTCAGAGTGG - Exonic
1073512785 10:104052939-104052961 AAACAGAGACAGAGTGAAGGAGG + Intronic
1073838485 10:107471337-107471359 GTACAGAGACAGAGGGAGGGGGG + Intergenic
1073997638 10:109333889-109333911 GTTCAGGGAATGAGTGAGGGTGG - Intergenic
1074634954 10:115304528-115304550 TTACAGAGACAGAGGGATGGGGG + Intronic
1074695169 10:116044021-116044043 GGAGAGAGAGAGAGTGAGGGAGG - Intergenic
1074804094 10:117029861-117029883 AGACAGAGAGAGAGGGAGGGAGG - Intronic
1074894324 10:117761951-117761973 GCAGAGAGACAGAGGGAGAGAGG + Intergenic
1075546118 10:123356129-123356151 GGAAAGAGAGAGAGTGGGGGCGG + Intergenic
1075666481 10:124234177-124234199 GCACAGTGACAGAGTGGGTGGGG + Intergenic
1076086083 10:127633608-127633630 CAAGAGAGAGAGAGTGAGGGGGG + Intergenic
1076270940 10:129151554-129151576 GCAGAGAGACAGAGGGAGAGGGG - Intergenic
1076700574 10:132270695-132270717 TTACAGACGCAGAGGGAGGGAGG - Intronic
1076883387 10:133250388-133250410 GGACAGAGACAGAGACAGTGGGG + Intergenic
1077371952 11:2186443-2186465 GGAAAGAGATAGAGTGAGGGTGG - Intergenic
1077740705 11:4842497-4842519 GGAGAGAGACAGAGTGAAGAGGG + Intronic
1078142333 11:8701495-8701517 GTACAGAGACAGAGGGAGAGAGG - Intronic
1078456887 11:11482461-11482483 GTACAGAGGCAGAGAGAATGAGG + Intronic
1079026032 11:16948626-16948648 GCACACACACAGAGTGAAGGAGG + Intronic
1079036376 11:17024025-17024047 GAACAAGGACAGAGTAAGGGGGG - Intergenic
1079187647 11:18252030-18252052 AGACAGAGAGAGAGAGAGGGGGG - Intergenic
1079805088 11:24921196-24921218 ATACAGAGACAGAGGGAGGGGGG + Intronic
1079890239 11:26042800-26042822 ATGCAGTGACAGTGTGAGGGAGG + Intergenic
1079953517 11:26833885-26833907 GTACACACAGAGAGAGAGGGAGG + Intergenic
1080627418 11:34043075-34043097 CAGGAGAGACAGAGTGAGGGTGG + Intergenic
1080843208 11:36003892-36003914 GGAGAGAGAGAGAGTGAAGGGGG + Intronic
1080922876 11:36726367-36726389 GCACAGAGACAGAGGGAGGGAGG + Intergenic
1080935495 11:36858563-36858585 GTACAGAGACAGAGGGAGGGGGG - Intergenic
1081000930 11:37669961-37669983 GTTCAGAGAGAGAGAGAGAGAGG - Intergenic
1081043090 11:38235848-38235870 GGAGAGAGAGAGAGTGAAGGGGG - Intergenic
1081063355 11:38507149-38507171 GGAGAGAGACAGAGACAGGGCGG - Intergenic
1081374324 11:42340745-42340767 AGAGAGAGACAGAGAGAGGGAGG - Intergenic
1081545874 11:44071220-44071242 GTACAGAGGCAGAGTTAGCATGG - Intronic
1081687986 11:45056041-45056063 GGAGAGAGAGAGAGTGAGGGGGG + Intergenic
1082807262 11:57459070-57459092 GGTCCGAGAGAGAGTGAGGGAGG + Intergenic
1083183021 11:61000406-61000428 GTACAGAGCCAGAGGCAGGGTGG - Intronic
1083986121 11:66216664-66216686 GTACAGGGACAGAATGAGGGTGG - Intronic
1084230785 11:67751146-67751168 GAAAAGAGAGAGAGGGAGGGAGG + Intergenic
1084384274 11:68832880-68832902 GAACAGAGAAAGTGTGAGGCTGG + Intronic
1084563506 11:69917099-69917121 GGAGAGAGAGAGAGAGAGGGAGG - Intergenic
1084596940 11:70122582-70122604 AGACAGAGACAGAGAGAGGTGGG - Intronic
1085587821 11:77728083-77728105 GAACAGAGAACAAGTGAGGGAGG - Intronic
1086226037 11:84510915-84510937 ATACAGGGACAGAGGGAGGAGGG + Intronic
1086307149 11:85493753-85493775 AGACAGAGAAAGAGAGAGGGAGG + Intronic
1087495793 11:98889827-98889849 GTAGAGAGAGAGAGTGAATGGGG + Intergenic
1087605883 11:100377060-100377082 GGAGAGAGATAGAGAGAGGGAGG + Intergenic
1087908883 11:103729876-103729898 GGAGAGAGACAGAGGGAGGAAGG + Intergenic
1088025553 11:105177546-105177568 AGAGAGAGAGAGAGTGAGGGGGG + Intergenic
1088102610 11:106171799-106171821 GTACCCACCCAGAGTGAGGGTGG - Intergenic
1088235202 11:107715980-107716002 GGAGAGAGACAGAGTCAAGGAGG - Intronic
1088351392 11:108892271-108892293 GGCCAGAGAAAGAGGGAGGGAGG - Intronic
1088728106 11:112657146-112657168 GTCCAGAGAGAGAGAGAGAGAGG - Intergenic
1089199579 11:116715685-116715707 GGACAGAGAGAGAGAGAGAGAGG - Intergenic
1089296824 11:117474341-117474363 GCACAGAGACAGAGAGAAGCTGG - Intronic
1089536205 11:119162022-119162044 GCACAGAGGAAGAGTGATGGTGG + Exonic
1089754955 11:120679741-120679763 GAACTGAGAAAGAGTGAGGATGG - Intronic
1089882542 11:121788530-121788552 GTCCAGCGACTGAGTGAGGCTGG + Intergenic
1090029544 11:123195312-123195334 GAACAGCGAGAGAGAGAGGGAGG - Intergenic
1090129329 11:124123327-124123349 ATGAAGAGACAGAGTGAGAGAGG - Intronic
1090448953 11:126789302-126789324 GGAGAGGGACTGAGTGAGGGAGG - Intronic
1090903417 11:131052673-131052695 GCTCAGAGACAGAGAGAGAGAGG - Intergenic
1091585737 12:1815459-1815481 GTAGAGAGTGAAAGTGAGGGAGG - Intronic
1091831125 12:3551798-3551820 AGACAGAGAGAGAGGGAGGGAGG + Intronic
1091972100 12:4796319-4796341 GCACAGAGGCATAGAGAGGGAGG - Intronic
1092229935 12:6770617-6770639 GAACAATGGCAGAGTGAGGGTGG - Exonic
1092336445 12:7638404-7638426 GTACAGGGACAGAGGGAGGGGGG - Intergenic
1092337525 12:7646404-7646426 GTACAGAGACAGAGGGAGTGAGG - Intergenic
1093059666 12:14589426-14589448 CTGCAGAGACAGGGTGGGGGGGG + Intergenic
1093439392 12:19176226-19176248 TAATAGAGACAGAGGGAGGGAGG - Intronic
1093902855 12:24655577-24655599 ATACAGTGAGAGAGAGAGGGGGG + Intergenic
1094415291 12:30209453-30209475 GGAGAGAGAGAGAGTGAAGGGGG - Intergenic
1094614361 12:32022810-32022832 GTAAAGAGACAGAGGGAGGGGGG - Intergenic
1095572456 12:43699111-43699133 GTAGAGAGACAGAGGGAGGGGGG - Intergenic
1095573215 12:43705721-43705743 GTACAGAGACAGAGGGTTGGGGG - Intergenic
1095590748 12:43900822-43900844 GAACAGAGAGAGAGAGAGGAAGG + Intronic
1095715486 12:45341755-45341777 GTGTAGAGGCAGAGTGAGTGGGG + Intronic
1095817571 12:46441250-46441272 ATAAAGAGAGAGAGGGAGGGAGG - Intergenic
1095872602 12:47046776-47046798 GAACAGAGACACAGAGATGGAGG - Intergenic
1096280355 12:50247349-50247371 ATCCAGAGACAGAGGGAAGGAGG - Intronic
1096418477 12:51434690-51434712 CTAGAGAAACAGAGGGAGGGAGG - Intronic
1096523816 12:52198939-52198961 GCCCAGAGACAGAGGGAGGGAGG - Intergenic
1096733335 12:53632310-53632332 GAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1097473857 12:60029482-60029504 GAACAGAAACAGAGGGAGAGAGG - Intergenic
1097690827 12:62733141-62733163 ATTCAGAGACAGAGTGTGAGGGG + Intronic
1097772162 12:63600693-63600715 GTACAGAGACAGAGGAAGGGGGG + Intronic
1098130674 12:67346912-67346934 GGAGAGAGAAAGAGTGAAGGGGG - Intergenic
1098161649 12:67651091-67651113 ATAGAGAGACAGACAGAGGGAGG - Intronic
1098167478 12:67713231-67713253 GTACAGAGACAGAAGGAGCAGGG - Intergenic
1098167652 12:67714645-67714667 GTACAGAGACAGAGGGTGGGGGG - Intergenic
1098203503 12:68082354-68082376 GTACAGTGACAGAGAGAGGAGGG - Intergenic
1098277813 12:68831249-68831271 TTACACAGACAGAGGGAGGGGGG + Intronic
1098304394 12:69087879-69087901 GTATAGAGACAATGTGAGGGGGG + Intergenic
1098307411 12:69115877-69115899 GTACAGAGACAGAGGGAGGGGGG + Intergenic
1098365713 12:69701000-69701022 GAAGAGAGAGAGAGAGAGGGAGG - Intergenic
1098972700 12:76872765-76872787 GTACAGAGACACAGGGAGGGGGG - Intronic
1099106391 12:78501968-78501990 ATACAGAGGCAGAGACAGGGAGG - Intergenic
1099436294 12:82649780-82649802 GGAGAGAGACTGAGTGAGGGAGG - Intergenic
1099475473 12:83103485-83103507 GGAGAGAGTGAGAGTGAGGGAGG + Intronic
1100120586 12:91364888-91364910 CTACTGAAACAGACTGAGGGAGG - Intergenic
1100151962 12:91749693-91749715 GGAGAGAGAGAGAGAGAGGGAGG - Intergenic
1100169700 12:91960136-91960158 TTACTGGGGCAGAGTGAGGGAGG - Intergenic
1100250405 12:92815936-92815958 AGACAGAGACAGAGAGAGAGAGG + Intronic
1100406694 12:94278057-94278079 ATACAGAGACAGAGGGAGGGGGG - Exonic
1100976787 12:100130960-100130982 ATAGAGAGAGAGAGAGAGGGAGG + Intronic
1101326599 12:103721196-103721218 GAACAGAGACTGGGTGAGAGGGG + Intronic
1101480377 12:105090742-105090764 GAACAGAGACAGAGGGAGGGGGG - Intergenic
1101674903 12:106908784-106908806 AGACAGAGACAGAGAGAGAGGGG - Intergenic
1101757228 12:107630405-107630427 GAAGAGAGAAAGAGGGAGGGTGG - Intronic
1101925637 12:108969283-108969305 GTAGGGAGAGAGAGTGAGGAAGG - Intronic
1102013388 12:109632585-109632607 GTGCAGAGAGAGTGGGAGGGTGG + Intergenic
1102172500 12:110852865-110852887 GCAGAGAGACAGAGAGAGAGAGG + Exonic
1102718997 12:115000489-115000511 GGAGAGAGAAAGAGAGAGGGAGG + Intergenic
1103073811 12:117966689-117966711 GAAGAGAGAGAGAGAGAGGGAGG - Intronic
1103155996 12:118685328-118685350 GAAGAGAGAGAGGGTGAGGGGGG + Intergenic
1104215382 12:126728393-126728415 GTGAGGAGACAGAGTGACGGGGG + Intergenic
1104378939 12:128290337-128290359 GGAGAGAGAGAGAGTGAAGGGGG + Intronic
1104463224 12:128971471-128971493 GTAGAGAGAGGGAGGGAGGGAGG - Intronic
1104938047 12:132377159-132377181 GGAGGGAGACAGAGAGAGGGAGG + Intergenic
1105432808 13:20352417-20352439 GGACAGAGATATAGTAAGGGAGG - Intergenic
1105784533 13:23735271-23735293 GTACAGAGACAGAGGAAGGGGGG - Intronic
1105939090 13:25130939-25130961 AAACAGAGAGAGAGGGAGGGAGG + Intergenic
1106088095 13:26561002-26561024 GTACAGAGAGATGGTCAGGGAGG + Intronic
1106103443 13:26713973-26713995 GAAAAGAGACAGATTGAGAGAGG - Intergenic
1106428410 13:29656260-29656282 GGAGAGAGAGAGAGTGAAGGGGG + Intergenic
1106470972 13:30053947-30053969 ATACAGAGACCGAGGGAGGGGGG + Intergenic
1106472643 13:30071297-30071319 GTAGAGAGACAGAGGGAGGGGGG + Intergenic
1106615829 13:31326632-31326654 GAACAGACACAGAGTGTGGTAGG - Intronic
1106622904 13:31388698-31388720 GTACAGAGACAGGGGGAGGGGGG + Intergenic
1106763839 13:32894065-32894087 GGACAGAGGCAGAGAGAGGAAGG - Intergenic
1107835835 13:44411896-44411918 GGAGAGAGAGAGAGGGAGGGGGG + Intergenic
1107858065 13:44634814-44634836 AGAGAGAGACAGAGTGAGGCCGG - Intergenic
1108901686 13:55417812-55417834 GTACAGAGACAGAGGGAGGGGGG - Intergenic
1109031910 13:57201462-57201484 GGACAGAGACAGAAAGAGAGGGG - Intergenic
1109267348 13:60216766-60216788 GGAGAGAGACAGAGTTAGGAAGG + Intergenic
1109274365 13:60287120-60287142 GTACAGAGACAGAGGGAGGGGGG - Intergenic
1109367653 13:61377683-61377705 GTACAGAGACAAAGCGGGGTTGG + Intergenic
1109682278 13:65768589-65768611 ATACATAGACAGAGGGAGAGGGG + Intergenic
1110952629 13:81515762-81515784 ATACAGAGAAAGAGGGAGGAGGG + Intergenic
1110953456 13:81522753-81522775 GTAAAGAGACAGAGGGAGGGGGG + Intergenic
1111211259 13:85083096-85083118 GGAGAGAGAAAGAGTGAAGGGGG - Intergenic
1111255371 13:85660990-85661012 GTACAGAGACAGCTTTAGGCTGG + Intergenic
1111340753 13:86882516-86882538 ATACAGAGACAGAGGGAGGGGGG - Intergenic
1112170944 13:96971040-96971062 GTACAGAGACAGAGGGAAGGGGG - Intergenic
1112186424 13:97132379-97132401 GGAGAGAGAGAGAGGGAGGGAGG - Intergenic
1112237668 13:97650917-97650939 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1112263252 13:97897977-97897999 CAACAGAGACAGTGTGAGAGAGG + Intergenic
1112333799 13:98497678-98497700 GTCCAGAGCCAGGGTGTGGGTGG - Intronic
1112964822 13:105176423-105176445 GAAAAGAGAGAGAGGGAGGGAGG - Intergenic
1113146886 13:107217570-107217592 GTATTGAAACAGAGTGAGAGAGG - Intronic
1113222471 13:108120691-108120713 AAACAGAGACAGAAGGAGGGGGG - Intergenic
1113351366 13:109532575-109532597 GGAGAGAGAGAGAGTGAGGAGGG + Intergenic
1113585216 13:111460034-111460056 GGAGAGAGACAGGGAGAGGGGGG + Intergenic
1114041863 14:18686268-18686290 AGAGAGAGACAGAGGGAGGGAGG - Intergenic
1114422364 14:22595311-22595333 GTAATGTGACAGAGTGATGGGGG + Intergenic
1114452141 14:22834339-22834361 ATCCAGAGACAGGGTGAGGAAGG - Exonic
1114847264 14:26338144-26338166 AGACTGAGACAGAGTGAGAGAGG + Intergenic
1114876975 14:26732334-26732356 AGAGAGAGACAGAGAGAGGGAGG - Intergenic
1114962979 14:27918317-27918339 GTACAGAGACAGAATGGGTGGGG - Intergenic
1114965845 14:27958288-27958310 GGAGAGAGACAGAGAGAGAGAGG + Intergenic
1115114838 14:29867698-29867720 GTACAGAGGCAGAATGAGCCAGG + Intronic
1115211025 14:30967248-30967270 GAAGAGAGGCAGAGAGAGGGGGG + Intronic
1115445074 14:33480564-33480586 GGAGAGAGAGAGAGGGAGGGAGG - Intronic
1116069756 14:40028837-40028859 GTAAAGATAGAGATTGAGGGAGG - Intergenic
1116074432 14:40092294-40092316 GTACAGACAGAGAGAGATGGAGG - Intergenic
1116091166 14:40308521-40308543 AGAGAGAGACAGAGTGAAGGGGG - Intergenic
1116222187 14:42102352-42102374 GTACAGAGACAGAGAAAGAAAGG + Intergenic
1116301147 14:43184865-43184887 ATACAGAGACAGAGAAAGGAGGG - Intergenic
1116549126 14:46211678-46211700 GGACAGAGAGAGAGAGAAGGCGG - Intergenic
1116993012 14:51295015-51295037 AAAAAGAGACAGATTGAGGGAGG + Intergenic
1117019081 14:51550632-51550654 GTGCAGAGGCAGAGGAAGGGCGG + Intronic
1117374185 14:55105782-55105804 GGACAGAGAGAGAGGCAGGGAGG - Intergenic
1117958070 14:61137956-61137978 GTAGAGACACAGAGAAAGGGTGG + Intergenic
1117977722 14:61314882-61314904 AAACAGAGACAAAGTCAGGGCGG - Intronic
1117993641 14:61458757-61458779 GGAGAGAGAGAGAGTGAAGGGGG + Intronic
1118654090 14:67928367-67928389 ATACAGAGACAGAGGGAGGGGGG + Intronic
1119002742 14:70897768-70897790 GTACAGAAGCAGAGGGAGGAAGG + Intergenic
1119510019 14:75203687-75203709 AGACAGAGACAGAGAGAGGCAGG + Intergenic
1119936674 14:78598367-78598389 GCAGAGAGAGAGAGAGAGGGAGG + Intronic
1119950447 14:78738999-78739021 GGACAGAGACAGAGACAGTGTGG - Intronic
1119996176 14:79256093-79256115 GGAGAGAGACAGAGAGAGAGAGG - Intronic
1120468218 14:84888456-84888478 AGAGAGAGAGAGAGTGAGGGAGG - Intergenic
1120479824 14:85036093-85036115 GGAGAGAGAGAGAGTGAAGGGGG + Intergenic
1120584249 14:86291369-86291391 GGAGAGAGAGAGAGAGAGGGAGG - Intergenic
1120584563 14:86296250-86296272 GGAGAGAGACAGAATGATGGGGG - Intergenic
1120589388 14:86357244-86357266 TTTCAGAGACAGAGAGAGAGAGG - Intergenic
1120751490 14:88202700-88202722 GAACACAGACAGAGAGAAGGCGG + Intronic
1121092400 14:91191676-91191698 GTACAGATACAGAGGGCAGGGGG + Intronic
1121115229 14:91338582-91338604 GTAAGGAGAAAGAGTGTGGGAGG + Intronic
1121584096 14:95051112-95051134 GTGCAGAGACAGAGCCAGGCAGG - Intergenic
1121793693 14:96718497-96718519 GGACAGAGACAGAGAGAGGGCGG + Intergenic
1121926832 14:97934656-97934678 GTTCAGAGTCAGAGGGAGAGAGG + Intronic
1121962062 14:98270090-98270112 GTAGGGAGAGAGAGGGAGGGAGG - Intergenic
1122327400 14:100890851-100890873 GCACAGCGTCACAGTGAGGGTGG + Intergenic
1122653764 14:103243009-103243031 GTACAGAAACAGAGGGATGGGGG + Intergenic
1122882077 14:104694739-104694761 GAACAAAGACAGATTGAGAGTGG - Intronic
1123214257 14:106791855-106791877 GAGCAAAGAAAGAGTGAGGGTGG - Intergenic
1123477043 15:20597652-20597674 GTAAGGAGACAGAGTTATGGCGG + Intergenic
1123490607 15:20777377-20777399 AAAGAGAGACAGAGGGAGGGAGG - Intergenic
1123500922 15:20879427-20879449 GTACATAGAAAGAAAGAGGGGGG - Intergenic
1123547109 15:21346464-21346486 AAAGAGAGACAGAGGGAGGGAGG - Intergenic
1123558173 15:21453121-21453143 GTACATAGAAAGAAAGAGGGGGG - Intergenic
1123594401 15:21890402-21890424 GTACATAGAAAGAAAGAGGGGGG - Intergenic
1123640970 15:22402712-22402734 GTAAGGAGACAGAGTTATGGCGG - Intergenic
1124733290 15:32218891-32218913 GAAGAGAGAGAGAGTGAAGGGGG + Intergenic
1124885295 15:33679618-33679640 GCACAGAGACACAGAGAGGTAGG + Intronic
1125072443 15:35571941-35571963 GAGCAAAGACAGAGTGAGGAAGG - Intergenic
1125447688 15:39775701-39775723 GGAGAGAGAGAGAGTGAAGGAGG - Intronic
1126175401 15:45730910-45730932 GTAAAGCTACAGAGTGAGGTTGG + Intergenic
1126389114 15:48126715-48126737 AGACAGAGACACAGTGAGAGAGG + Intronic
1126456204 15:48864881-48864903 GACCAGAGACAGATTGTGGGGGG - Intronic
1126508629 15:49439277-49439299 GGAGAGAGAGAGAGAGAGGGAGG + Intronic
1127053238 15:55106412-55106434 GAAGAAAGAGAGAGTGAGGGGGG - Intergenic
1127166512 15:56249440-56249462 GGAGAGAGAGAGAGGGAGGGAGG + Intronic
1127385075 15:58460532-58460554 TTACAGGGTGAGAGTGAGGGTGG - Intronic
1127391143 15:58506059-58506081 CCACAGAGACAGAGTGGGGAGGG - Intronic
1127633602 15:60848730-60848752 GGAGAGAGAGAGAGTGAAGGGGG + Intronic
1127714913 15:61640592-61640614 GAGCAGAGACTGAGTGAGGAAGG + Intergenic
1128378328 15:67093059-67093081 TTACAAAGACAGGGTGAGGAAGG - Intronic
1129484540 15:75857087-75857109 GTACAGAGAGAGAGAGAAAGAGG - Intronic
1129652573 15:77501736-77501758 GAACAGAGAAAGACTGAAGGAGG - Intergenic
1129710499 15:77818380-77818402 GTACAGGTCCAGAGTGTGGGAGG + Intronic
1130533565 15:84766612-84766634 ATAGAGAGACAGAGAGAGAGAGG + Intronic
1130535012 15:84778241-84778263 GTACGGAGACAGAGGGAGGGGGG + Exonic
1130535151 15:84779071-84779093 GTAGAGAGACAGAGGGAGGGGGG + Intronic
1130544769 15:84847176-84847198 GCACAGAGAGAGAGGAAGGGAGG + Intronic
1130681586 15:86001608-86001630 ACACAGAGACAGAGACAGGGAGG - Intergenic
1130706323 15:86236701-86236723 ATACAGAGACAGAGGGAGGGGGG + Intronic
1130941480 15:88513154-88513176 GGACAGAGACAGAGAAAGAGGGG + Intronic
1131003438 15:88956466-88956488 GGAGAGAGACAGAGTGAAGGGGG - Intergenic
1131006923 15:88985995-88986017 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1131564122 15:93470365-93470387 GTACAGAGGCAGAGGGAGGGGGG - Intergenic
1132173793 15:99691188-99691210 CAACAGAGACAGAGGGAGGGGGG + Intronic
1132223509 15:100123208-100123230 CTACTGAGACTGTGTGAGGGTGG - Intronic
1132250595 15:100332963-100332985 GGACAGTGAGACAGTGAGGGAGG - Intronic
1132325129 15:100962627-100962649 AAACAGAGACAGGGAGAGGGAGG + Intronic
1202955439 15_KI270727v1_random:73680-73702 AAAGAGAGACAGAGGGAGGGAGG - Intergenic
1202966522 15_KI270727v1_random:180293-180315 GTACATAGAAAGAAAGAGGGGGG - Intergenic
1132662528 16:1068030-1068052 GTCCAGAGACAGAGGGAGCTGGG - Intergenic
1132755975 16:1485735-1485757 GAACAGAGACAGAGAGAGCCTGG - Intergenic
1132924348 16:2420754-2420776 GAAAAGAGAGAGAGGGAGGGAGG - Intergenic
1133368331 16:5228652-5228674 GGAGAGAGATAGAGCGAGGGAGG + Intergenic
1133414682 16:5597238-5597260 GTGCAGAGAAAGCGGGAGGGGGG - Intergenic
1133771137 16:8867803-8867825 GAACAGAGGCAGAGAGAGGCTGG + Intronic
1134316934 16:13127295-13127317 GGAGAGAGAGAGAGTGAGGGAGG + Intronic
1134606009 16:15571723-15571745 TTACATTGACAGGGTGAGGGAGG - Intronic
1134659344 16:15971935-15971957 GTACAGAGACAGAGGGTGGGGGG + Intronic
1134784860 16:16932932-16932954 ATACACAGAGAGAGGGAGGGAGG - Intergenic
1135128569 16:19832827-19832849 GGAGAGAGAGAGAGTGAGGGGGG + Intronic
1135292470 16:21251720-21251742 GAATAGAGACAGAGTGGTGGTGG + Exonic
1135531689 16:23260080-23260102 AGACAGAGAGAGAGAGAGGGAGG + Intergenic
1135886480 16:26313533-26313555 GTACTGAGAGAGAGAGAGAGGGG + Intergenic
1136083758 16:27869870-27869892 AGACAGAGACAGAGAGATGGAGG - Intronic
1136351199 16:29709234-29709256 GTACAGAGACAGAGGGAGGGGGG - Intergenic
1136352386 16:29719390-29719412 GTACAGAGACAGAGGGAGAGGGG - Intergenic
1136856101 16:33659174-33659196 AGAGAGAGACAGAGTGAAGGAGG + Intergenic
1137554585 16:49462514-49462536 GAGCAGAGACAGAGAGAGAGAGG + Intergenic
1137753192 16:50881692-50881714 GGACACAGACAGACAGAGGGAGG - Intergenic
1137942322 16:52700349-52700371 GTACAGATAAAGACTGTGGGTGG - Intergenic
1138550660 16:57746371-57746393 CTGCAGAGACAGAGAGAGAGAGG - Intronic
1138573077 16:57888442-57888464 AGACAGAGACAGAGAGAGAGAGG - Intronic
1138817335 16:60217726-60217748 GTACAGAGACAGAGGGCGGGGGG + Intergenic
1138835551 16:60430190-60430212 GAAAAGAGAGAGAGAGAGGGAGG - Intergenic
1138880660 16:61010596-61010618 AGACAGAGACAGAGTGAAGCTGG + Intergenic
1138992872 16:62412752-62412774 GGAGAGAGAAAGAGTGAAGGAGG + Intergenic
1139133357 16:64172658-64172680 GCAGAGAGACAGAGAGAGGCAGG + Intergenic
1139352747 16:66347600-66347622 AAACAGAGAGAGAGAGAGGGAGG + Intergenic
1140462813 16:75154661-75154683 TGACAGAGACAGAGGGAGGGGGG + Intronic
1140834013 16:78776788-78776810 GGAGAGAGAAAGAGGGAGGGAGG + Intronic
1141141668 16:81500422-81500444 GGAGAGAGAGAGAGGGAGGGAGG - Intronic
1141210251 16:81972958-81972980 GAACAGAGAGAAAGGGAGGGAGG + Intergenic
1142280932 16:89147220-89147242 GTCCACAGAGTGAGTGAGGGAGG + Intronic
1142281007 16:89147480-89147502 GTCCACAGAGTGAGTGAGGGAGG + Intronic
1203117687 16_KI270728v1_random:1507653-1507675 AGAGAGAGACAGAGTGAAGGAGG + Intergenic
1142507937 17:377224-377246 AGACAGAGACAGAGAGAGTGGGG + Intronic
1142542522 17:671367-671389 GAAAAGAGAAAGAGGGAGGGAGG + Intronic
1142698521 17:1646294-1646316 GTACAGAGACGTAGAGAGGGAGG + Exonic
1143326155 17:6099828-6099850 GTACAGAGACAGAGGGAGGGGGG - Intronic
1143767410 17:9146657-9146679 GTGCTGAGACAGAGTGAGGCGGG + Intronic
1144012371 17:11161845-11161867 ATACAGAGACAGAGGGAGGGGGG - Intergenic
1144127962 17:12220450-12220472 GTACAGAGACAGAAGGAGGGGGG + Intergenic
1145125781 17:20298975-20298997 GTAGAGAGAGAGAGAGAGAGAGG + Intronic
1145813414 17:27778792-27778814 CTACAGAGGCAGAGTGATAGCGG + Intronic
1145833655 17:27937474-27937496 GTACAGAGACAGAGGGAGGGGGG - Intergenic
1146542740 17:33711675-33711697 GAAGAGAGAGAGAGTGAAGGGGG + Intronic
1146582612 17:34052537-34052559 GTACAGCCACAGAAAGAGGGTGG - Intronic
1146918746 17:36695633-36695655 GTACACAGACAGTGTCAGGAGGG + Intergenic
1146946818 17:36878823-36878845 GGACAGAGAGAGAGAGAGGGAGG - Intergenic
1147701912 17:42401588-42401610 GGAGAGAGACAGAGGGAGGGAGG + Intergenic
1148014569 17:44512103-44512125 ATACAGAGACAGAGGGAATGAGG - Intergenic
1148571097 17:48669765-48669787 GAAGAGAGACAGAGAGAGGCGGG + Intergenic
1148789249 17:50164200-50164222 TCTCAGAGACAGAGGGAGGGAGG - Intronic
1149046693 17:52254858-52254880 GTACAGAGACAGAGGAAGCGGGG + Intergenic
1149411463 17:56412480-56412502 GTACCCACACAGAGTGAGGGTGG - Intronic
1149785917 17:59434868-59434890 GGAGAGAGAGAGAGGGAGGGAGG - Intergenic
1149855361 17:60078395-60078417 GCACAGAGAGGGAGTGAAGGAGG + Intronic
1150337857 17:64343363-64343385 GCACAGAGGGAGAGTGAGTGTGG - Intronic
1150485293 17:65538955-65538977 GTACAAAGAGAGAGGGAGGAGGG - Intronic
1151577210 17:74958823-74958845 GGACAGTGTCAGACTGAGGGGGG - Intronic
1151618356 17:75229567-75229589 AGAGAGAGACAGAGTGAGAGTGG + Intronic
1151679919 17:75617749-75617771 CTGCAGAGCCAGAGTGATGGGGG - Intergenic
1151754632 17:76066675-76066697 GTACAGAGACAGAGGAAGGGGGG + Intronic
1152024156 17:77797873-77797895 GAACATGGACAGAGTGTGGGGGG - Intergenic
1152291462 17:79442304-79442326 GGAGAGAGAGGGAGTGAGGGAGG + Intronic
1152510432 17:80783261-80783283 GGACAGAGACGGAGAGAGAGAGG - Intronic
1152728049 17:81957317-81957339 GTAAAGAGACAGAGAGAGGAAGG - Intronic
1153000869 18:454312-454334 GAACAAGAACAGAGTGAGGGAGG - Intronic
1153014725 18:573294-573316 GGACAGAGACAGAGGGAAGATGG - Intergenic
1153522581 18:5966524-5966546 GTCCAGAGATAGGGTGAGGATGG - Intronic
1153741496 18:8134169-8134191 GTACAGAGAAAGGCTGAGAGAGG - Intronic
1154005430 18:10523524-10523546 ATACAGAGACAGAGGTAGGGAGG + Intergenic
1154009431 18:10562416-10562438 GCACAGAGAAAGAGCGAGAGGGG + Intergenic
1154251169 18:12746418-12746440 GGACAGACACAGGGTGAGGGGGG + Intergenic
1154308347 18:13246986-13247008 GCACACAGACACAGTGATGGTGG + Intronic
1154408292 18:14117758-14117780 GGAGCAAGACAGAGTGAGGGTGG + Intronic
1154469097 18:14681058-14681080 CTACATAAACAGAGTGAGGATGG - Intergenic
1155073850 18:22338447-22338469 GCACAGAGACAGGGTGGGGATGG + Intergenic
1155316938 18:24581372-24581394 ATACAGAGACAGAGGGCGGGGGG + Intergenic
1155613485 18:27695406-27695428 GTACAGAGACAGAGGGAGGGGGG - Intergenic
1155625521 18:27829961-27829983 GGAGAGAGAGAGAGTGAAGGGGG + Intergenic
1155771859 18:29711899-29711921 GTACACAGACAGAGGCAGGAGGG + Intergenic
1155858952 18:30872087-30872109 GAGAAGAGACAGAGGGAGGGGGG - Intergenic
1155945150 18:31840364-31840386 ATAGAGAGACAGAGGGAGGGAGG + Intronic
1155993344 18:32303969-32303991 AAACAGAGAAAGAGGGAGGGAGG + Intronic
1156074672 18:33259535-33259557 GGAGAGAGAGAGAGTGAAGGCGG + Intronic
1156426721 18:37021690-37021712 GTACAGAGACAGAGGGAGGGGGG - Intronic
1156452764 18:37275793-37275815 GGCCTGAGACAGAGTAAGGGAGG - Intronic
1156503641 18:37575574-37575596 GTGCAGAGACAGGGACAGGGTGG - Intergenic
1156889871 18:42178382-42178404 AGAGAGAGACAGAGTGGGGGGGG + Intergenic
1157116038 18:44863736-44863758 GTAGAGAGACAGAGTGAAGATGG - Intronic
1157379222 18:47196158-47196180 GGAGAGAGAGAGAGTGAAGGGGG + Intergenic
1157453086 18:47802329-47802351 AGACAGAGACAGAGAGAGGTAGG - Intergenic
1157740679 18:50090070-50090092 GTACAGAGACAAAGGGAGTGGGG - Intronic
1157888235 18:51389422-51389444 GGAGAGAGACAGAGTGAAGGGGG + Intergenic
1157951504 18:52043465-52043487 GTAGAGAGAAAAAGAGAGGGAGG + Intergenic
1158033342 18:52993856-52993878 TTACAGAGAGAGAGAGAGAGTGG - Intronic
1158089476 18:53694039-53694061 GTACAGAGACAGAGGGAGAGGGG + Intergenic
1158090099 18:53700962-53700984 AGACAGGGACAGAGAGAGGGAGG + Intergenic
1158346178 18:56519228-56519250 AGAGAGAGACAGAGGGAGGGAGG + Intergenic
1158762984 18:60412308-60412330 GTGCAAAGACAGAGAGAAGGTGG + Intergenic
1158774458 18:60560637-60560659 AGACAGAGACAGAGAGAGAGTGG + Intergenic
1158841699 18:61394846-61394868 GGAGAGAGACAGGGTGAGGGAGG - Intronic
1158959469 18:62577025-62577047 GGCCGGAGACAGAGTGAGGCTGG - Exonic
1159058502 18:63490609-63490631 GTACAGAGACAGAGTAGCTGGGG - Intronic
1159240544 18:65737733-65737755 GAAGAGAGAGAGAGAGAGGGAGG - Intergenic
1159653123 18:71000635-71000657 GAACAGAGAGGGAGGGAGGGAGG + Intergenic
1159801383 18:72904493-72904515 GGACAGAGACACAGAGAGGAAGG + Intergenic
1160111055 18:76031561-76031583 GTACATACACATAGAGAGGGAGG - Intergenic
1160402941 18:78624298-78624320 GTAGAGAGAGAGAGCCAGGGGGG + Intergenic
1160429266 18:78800361-78800383 GTGCAGGGAGGGAGTGAGGGAGG - Intergenic
1160429275 18:78800400-78800422 GTGCAGGGAGGGAGTGAGGGAGG - Intergenic
1160429284 18:78800439-78800461 GTGCAGGGAGGGAGTGAGGGAGG - Intergenic
1160429293 18:78800478-78800500 GTGCAGGGAGGGAGTGAGGGAGG - Intergenic
1160429302 18:78800517-78800539 GTGCAGGGAGGGAGTGAGGGAGG - Intergenic
1160429311 18:78800556-78800578 GTGCAGGGAGGGAGTGAGGGAGG - Intergenic
1160429320 18:78800595-78800617 GTGCAGGGAGGGAGTGAGGGAGG - Intergenic
1160533448 18:79578401-79578423 GTCCAGAGACACAGAGAGGGAGG + Intergenic
1160545787 18:79653267-79653289 AGAGAGAGACAGAGAGAGGGAGG + Intergenic
1160595295 18:79969249-79969271 GGAGAGAGAGAGAGGGAGGGAGG + Intronic
1160871656 19:1280525-1280547 GGACAGAGACAAAGTGAAGGAGG - Intergenic
1160950458 19:1664407-1664429 AGACAGAGAGAGAGGGAGGGAGG - Intergenic
1160971962 19:1773263-1773285 GGAGAGAGAGAGAGGGAGGGAGG - Intronic
1161059808 19:2209276-2209298 GCAAAGAGACAGAGAGAGGGTGG - Intronic
1161256505 19:3312898-3312920 GGAGAGAGACAGAGAGAGGAAGG - Intergenic
1161267405 19:3370711-3370733 GAACAGAGAGAGAGGAAGGGAGG - Intronic
1162029918 19:7912883-7912905 GAAGAGAGACAGAGGCAGGGAGG - Exonic
1163322807 19:16584482-16584504 GCACAGAGACAGCCTGAGGGAGG + Intronic
1163525799 19:17820762-17820784 GGCCAGAAACAGAGTGAGGCAGG - Intronic
1164004238 19:21134305-21134327 GTAGAGACACAGAGAGAGAGGGG + Intergenic
1164188787 19:22896649-22896671 GTAGAGAGAGAAAGAGAGGGAGG - Intergenic
1164398353 19:27885758-27885780 GTACAGAGACAGAGTGAGGGGGG - Intergenic
1164460951 19:28446863-28446885 GTACAGAGACAGAGGGAGAGGGG - Intergenic
1164691129 19:30211497-30211519 GAATAGAGAGAGAGTGAAGGGGG + Intergenic
1164743845 19:30596245-30596267 ATACAGAGAGAGAGGGAGAGGGG + Intronic
1164820442 19:31246617-31246639 GAAGGGAGAGAGAGTGAGGGAGG + Intergenic
1164951247 19:32338840-32338862 GGAGAGAGACAGAGTAAGGGGGG - Intergenic
1164976536 19:32577034-32577056 AGAGAGAGACAGAGGGAGGGAGG - Intergenic
1165073547 19:33268878-33268900 GGACAGCCACAGAGCGAGGGGGG + Intergenic
1165112460 19:33510344-33510366 ATATGGAGACAGAGGGAGGGGGG + Intronic
1165426802 19:35750357-35750379 GAGGAGAGACAGAGTGAGGGTGG - Intronic
1165468132 19:35987157-35987179 GGACAGAGACAGAGAGAGGTGGG - Intergenic
1165742421 19:38211845-38211867 GGACAGAGAGGGAGGGAGGGAGG + Exonic
1165752232 19:38267408-38267430 GAACAGAGAATGTGTGAGGGAGG + Intronic
1165786513 19:38464914-38464936 TTTCAGAGAGAGAGAGAGGGAGG + Intronic
1166239566 19:41480699-41480721 ATACTGAGACAGAGGGAGGGGGG - Intergenic
1166329093 19:42068567-42068589 GCTCAGAGGCAGAGAGAGGGAGG + Intronic
1166394474 19:42428781-42428803 GTACAGTGGGAGAGTGAGGTGGG + Exonic
1166411567 19:42558817-42558839 ATACAGGGACAGACGGAGGGGGG - Intronic
1166557060 19:43707285-43707307 GTTCAGAGAGAGAGGGTGGGAGG - Intergenic
1166799112 19:45444855-45444877 ATACAGAAACAGAGTCAGAGAGG - Intronic
1166880925 19:45929484-45929506 GCAGAGGGACAGAGGGAGGGAGG + Intergenic
1167205439 19:48098272-48098294 GTGCCAAGACAGTGTGAGGGAGG + Intronic
1167315830 19:48762245-48762267 GGACAGAGACACAGAGAGAGAGG + Intergenic
1167320874 19:48796568-48796590 GTACAAAGACAGGGTGAGGCGGG - Exonic
1167348897 19:48963053-48963075 GTACAGAGACCCAGAGAGAGGGG - Intergenic
1167384676 19:49156767-49156789 GTACAGAGACCCAGGGAGAGGGG - Intergenic
1167384706 19:49156854-49156876 GGACAGAGACCCAGAGAGGGGGG - Intergenic
1167384799 19:49157208-49157230 GGACAGAGACCCAGGGAGGGGGG - Intergenic
1167384809 19:49157230-49157252 GGACAGAGACCCAGAGAGGGGGG - Intergenic
1167384817 19:49157252-49157274 GGACAGAGACCCAGAGAGGGGGG - Intergenic
1167413905 19:49360735-49360757 GGACAGAGACCCAGAGAGGGAGG + Intronic
1167413956 19:49360922-49360944 GGACAGAGACCCAGTGAAGGGGG + Intronic
1167443803 19:49525647-49525669 GGACAGAGACCCAGAGAGGGGGG + Intronic
1167549136 19:50147647-50147669 GTACAGAGACCCAGCGAGAGGGG + Intergenic
1167606336 19:50482703-50482725 GTCCAGTGTCAAAGTGAGGGGGG - Exonic
1167607818 19:50490904-50490926 GTACTGAGAGAGAGAGAGAGAGG + Intergenic
1167609282 19:50499037-50499059 GGAGAGAGACAGAGGGAGAGAGG + Intergenic
1167609373 19:50499765-50499787 GGAGAGAGACAGAGGGAGAGAGG + Intergenic
1167690448 19:50981515-50981537 GGACAGAGACACAGAGAGAGGGG + Intronic
1167706361 19:51083362-51083384 AGACAGAGACAGGGTGACGGGGG + Intronic
1167740589 19:51322799-51322821 GTACAGAGACCCAGAGAGAGAGG - Intronic
1167870247 19:52363059-52363081 GTACAGAGACAGAGTGAGGGGGG + Intronic
1167900900 19:52621584-52621606 GTAGAGACACAGAGAGAGTGGGG - Intronic
1168208246 19:54868772-54868794 CTACAGGGACAGTGTGGGGGAGG + Intergenic
1168308610 19:55450058-55450080 GTACAGAGACCCAGAGAGAGGGG + Intergenic
1168308766 19:55450705-55450727 GTACAGAGACCCAGAGAGAGAGG + Intergenic
925074130 2:997949-997971 TTGCAGAGACAGAGTGGCGGAGG - Intronic
925166678 2:1719895-1719917 ATTCAGAGAGAGAGGGAGGGAGG + Intronic
925166699 2:1720012-1720034 GTAGAGAGAGAGAGAGAGAGAGG + Intronic
925166705 2:1720040-1720062 ATGCAGAGAGAGAGAGAGGGAGG + Intronic
925166713 2:1720068-1720090 ATGCAGAGAGAGAGGGAGGGAGG + Intronic
925166719 2:1720092-1720114 ATGCAGAGAGAGAGGGAGGGAGG + Intronic
925166727 2:1720140-1720162 ATGCAGAGAGAGAGAGAGGGAGG + Intronic
925166741 2:1720222-1720244 ATGCAGAGAGAGAGAGAGGGAGG + Intronic
925166751 2:1720278-1720300 ATGCAGAGAGAGAGAGAGGGAGG + Intronic
925217544 2:2110533-2110555 GGACAGGGACAGAGGGAGGCAGG - Intronic
925444829 2:3918878-3918900 GATCAGAGACAGAGTGGCGGAGG - Intergenic
925653892 2:6123776-6123798 GAAGAGAGAGAGAGGGAGGGAGG - Intergenic
926537159 2:14127571-14127593 GGAGAGAGACGGAGAGAGGGAGG + Intergenic
926919819 2:17929388-17929410 GGAGAGAGAGAGAGTGAAGGGGG + Intronic
926930317 2:18031532-18031554 GTGCAGAGAGGGAGAGAGGGAGG - Intronic
927158186 2:20234185-20234207 GGAGAGAGAGAGAGGGAGGGAGG - Intergenic
927865766 2:26586254-26586276 GCAAGGAGGCAGAGTGAGGGCGG - Intronic
928096639 2:28409039-28409061 GAAAAGAGAGAGAGAGAGGGAGG + Intronic
928308513 2:30191079-30191101 TTACAGAGACAGAGGGAGGGGGG - Intergenic
928654484 2:33435754-33435776 GTAGAATGACAGAGTAAGGGAGG + Intergenic
929336657 2:40756382-40756404 AAAAAGAGACAGAGAGAGGGAGG - Intergenic
929685147 2:44027000-44027022 AGAGAGAGACAGAGGGAGGGAGG + Intergenic
929715544 2:44305789-44305811 GTAGAGATACAGAGAGATGGAGG - Intronic
930099285 2:47590566-47590588 GGATAGAGACACAGAGAGGGGGG + Intergenic
930621315 2:53646782-53646804 GTACAAAGACAGAGGGAGAGGGG + Intronic
931091904 2:58895295-58895317 GTACAGAGACAGAGGGAGGGGGG + Intergenic
931822942 2:65970824-65970846 GGAGAGAGAGAAAGTGAGGGAGG + Intergenic
931969142 2:67566677-67566699 CCCCAGAGACAGAGTGAGAGAGG + Intergenic
932411183 2:71548949-71548971 GTACAGACACAACGGGAGGGTGG - Intronic
932894174 2:75622636-75622658 AAGAAGAGACAGAGTGAGGGAGG + Intergenic
934028952 2:88024498-88024520 GTACAGAGATAAAGGGAGGAGGG + Intergenic
934135787 2:88995209-88995231 GTACAAAGACAGAGGGACAGGGG - Intergenic
934147038 2:89105058-89105080 ACACAGAGACAGAGGGAGGAGGG - Intergenic
934166100 2:89295864-89295886 GTACAAAGACAGAGGGAGGGGGG + Intergenic
934201176 2:89886592-89886614 GTACAAAGACAGAGGGAGGGGGG - Intergenic
934222228 2:90095537-90095559 ACACAGAGACAGAGGGAGGAGGG + Intergenic
934233158 2:90205305-90205327 ATACAGAGACAGAGGGACAGGGG + Intergenic
934234528 2:90218566-90218588 GTACAGAGACAGAGGGACAGGGG + Intergenic
934563462 2:95325069-95325091 GGACAGGGACAGCGTGAGGAGGG + Intronic
934720278 2:96569876-96569898 GGAGAGAGAGAGAGTGATGGGGG + Intergenic
934982293 2:98852974-98852996 GGAGAGAGAGAGAGAGAGGGAGG + Intronic
934994498 2:98944869-98944891 ATACATAGAGAGAGGGAGGGAGG + Intergenic
935193234 2:100794764-100794786 GTAGAGAGAGATGGTGAGGGTGG - Intergenic
935223977 2:101037723-101037745 AGACAGAGACAGAGAGAGAGAGG + Intronic
935333184 2:101992313-101992335 AGACAGAGACAGAGAGAGGCAGG + Intronic
935529574 2:104216038-104216060 GTACAGAGACAGAGAGAGGGGGG - Intergenic
935712224 2:105909386-105909408 GAAGAGAGAGAGAGGGAGGGAGG + Intergenic
935798224 2:106666316-106666338 GGAAAGAGAGAGAGGGAGGGAGG - Intergenic
936182070 2:110275632-110275654 GTTCAGATAAAGAATGAGGGTGG + Intergenic
936229643 2:110688846-110688868 ATAGAGAGACAGAGGGAGAGGGG - Intergenic
936230499 2:110696041-110696063 GTTCAGATAAAGAATGAGGGTGG - Intergenic
936643709 2:114345322-114345344 AGACAGAGAAAGAGAGAGGGAGG + Intergenic
936655074 2:114475484-114475506 GAACAGAGACAGAGAGAGAGGGG - Intronic
936836012 2:116710269-116710291 GGAAAGAGAGAGAGGGAGGGAGG + Intergenic
936905614 2:117532843-117532865 TGAGAGAGACAGAGTGAGGGAGG - Intergenic
937169722 2:119853967-119853989 ATAGAGAGACAGAGGGAGCGGGG + Intronic
937235067 2:120426189-120426211 GGACAGAGACAGAGAGAGCCAGG - Intergenic
937270852 2:120651382-120651404 AAAAAGAGAGAGAGTGAGGGAGG + Intergenic
937495252 2:122412334-122412356 GAAGAGAGAGAGAGAGAGGGAGG + Intergenic
937752734 2:125497474-125497496 GTACAGAGACAGAGGGAGGAGGG - Intergenic
938249928 2:129806638-129806660 GTGCAGAGATAGCCTGAGGGAGG - Intergenic
939046343 2:137254911-137254933 AGACAGAGAAAGAGTGAGGGGGG + Intronic
939265924 2:139872415-139872437 GTACAGAGACAGAGGGAGGGTGG - Intergenic
939962160 2:148574842-148574864 AGACAGAGAGAGAGGGAGGGAGG + Intergenic
940115490 2:150204102-150204124 GAAGAGAGAGAGAGGGAGGGAGG + Intergenic
940115499 2:150204136-150204158 GAAGAGAGAGAGAGGGAGGGAGG + Intergenic
940726591 2:157342646-157342668 GGATAGAGACACAGTGTGGGGGG + Intergenic
940809013 2:158221885-158221907 GGAGAGAGAGAGAGAGAGGGTGG + Intronic
941099043 2:161277205-161277227 GGAAAGAGAGAGAGGGAGGGAGG - Intergenic
941281404 2:163556153-163556175 GTAAAGAGAAAGAGAGAGGTAGG + Intergenic
941714780 2:168752317-168752339 GTATAGAGAGAGAGAGAGAGAGG + Intronic
942509106 2:176677024-176677046 GTTCAGAGACAGAGGGAGCGGGG + Intergenic
943361611 2:186925647-186925669 GTACAGAGACAGAAGGAAGTGGG + Intergenic
943446757 2:187995877-187995899 GTACAGAGACATAAGGAGGAGGG - Intergenic
943618342 2:190119260-190119282 ATACAGAGATAGAGCGAGGCGGG + Intronic
944107619 2:196095939-196095961 AGACAGAGACAGAGTCAGGCTGG - Intergenic
944477853 2:200125545-200125567 ATACAGAGACAGAGGAGGGGGGG + Intergenic
944748053 2:202678246-202678268 ATACAGAGACGGAGGGAGTGGGG + Intronic
944956194 2:204812346-204812368 GCAGAGTGACAGAGTGAGGCAGG + Intronic
945020582 2:205567188-205567210 GTATAGAGAGAGAAAGAGGGAGG + Intronic
945318776 2:208397560-208397582 GTACAGAGATAGAGGTGGGGGGG + Intronic
945471261 2:210230036-210230058 AGACAGAGAGAGAGTGAGGAAGG + Intergenic
945502067 2:210588690-210588712 AGACAGAGACAGACTGAGAGAGG - Intronic
946531396 2:220574233-220574255 GGAGAGAGAGAGAGTGAAGGAGG + Intergenic
946641832 2:221792327-221792349 GGAGAGAGAGAGAGTGAAGGGGG - Intergenic
946696988 2:222369539-222369561 GGAGGAAGACAGAGTGAGGGGGG + Intergenic
946699537 2:222397788-222397810 GGAGAAAGAGAGAGTGAGGGAGG - Intergenic
947328225 2:229000625-229000647 GGAAAGAGAGAGAATGAGGGGGG - Intronic
947452883 2:230224512-230224534 GGACAGAGAGAGAGAGAGAGAGG + Intronic
947524077 2:230868059-230868081 GTCCAGGCCCAGAGTGAGGGCGG + Intronic
947598441 2:231429138-231429160 ATACAGAGACAGAAGGAGGGGGG + Intergenic
947741183 2:232485703-232485725 GCACAGAGGCAGAGCGCGGGAGG - Intronic
947914252 2:233821554-233821576 GTACAGAGGCACAGAGAGCGGGG - Intronic
947926326 2:233925544-233925566 GTCCAGAGAGAGAGGGAGGTGGG + Intronic
948381942 2:237556881-237556903 GAACAGAGAGAGAGGGAGGGAGG - Intergenic
948381957 2:237556939-237556961 GAACAGAGAGAGAGGGAGGGAGG - Intergenic
948381970 2:237556997-237557019 GAACAGAGAGAGAGGGAGGGAGG - Intergenic
948381992 2:237557097-237557119 GAACAGAGAGAGAGGGAGGGAGG - Intergenic
948493432 2:238329172-238329194 ACAGAGAGAAAGAGTGAGGGGGG + Exonic
948677632 2:239608139-239608161 GAGGAGAGACAGAGAGAGGGAGG - Intergenic
1168853430 20:992340-992362 GAACAGAGACTCAGAGAGGGTGG + Intronic
1169247896 20:4038252-4038274 GCAGAGAGGCAGGGTGAGGGTGG + Intergenic
1169523005 20:6393234-6393256 GTACACAGCCAGATTAAGGGTGG + Intergenic
1169726296 20:8736673-8736695 GAGAAGAGAGAGAGTGAGGGGGG + Intronic
1170421920 20:16201482-16201504 GCACAGAGACAGAGGGAGAGGGG - Intergenic
1170490154 20:16864279-16864301 GTGACAAGACAGAGTGAGGGAGG - Intergenic
1170962252 20:21035846-21035868 GAACAGAGATACAGTGAGGCAGG - Intergenic
1171002025 20:21424402-21424424 GAAGAGAGAGAGAGTGAAGGGGG + Intergenic
1171147219 20:22795463-22795485 GTATAGAGACAGAGCAAGGCTGG + Intergenic
1171437778 20:25136483-25136505 GGAGAGAGACAGAGAGAGGGAGG - Intergenic
1172296084 20:33811932-33811954 AGAAAGGGACAGAGTGAGGGCGG - Intronic
1172428394 20:34871778-34871800 GTGCAGGGACAGAGGGATGGGGG + Intronic
1172536928 20:35681048-35681070 CTACTGAGACACAGAGAGGGAGG - Intronic
1173443175 20:43095868-43095890 GAAGAGAGAGAGAGGGAGGGTGG - Intronic
1173443204 20:43095988-43096010 GAAGAGAGAGAGAGGGAGGGTGG - Intronic
1173464549 20:43270668-43270690 ATAGAGGGAAAGAGTGAGGGAGG + Intergenic
1173660866 20:44732704-44732726 GAACAGAGAGAGAGGGAGAGAGG - Intergenic
1173765164 20:45600691-45600713 GTAGAGAGAGAGGGAGAGGGGGG - Intergenic
1173822415 20:46028276-46028298 GGCCAGGGACAGAGTGGGGGAGG - Intronic
1174020008 20:47522487-47522509 ATACAGAGACAGAAGGAGGGGGG + Intronic
1174056972 20:47804632-47804654 GTACAGAGGCAGAGGAATGGGGG - Intergenic
1174123839 20:48288164-48288186 GCACACAGACACAGTGAGAGTGG - Intergenic
1174159385 20:48540088-48540110 GTACCCAGCCAGATTGAGGGTGG - Intergenic
1174395905 20:50246822-50246844 GGAGAGAGAGAGAGAGAGGGAGG - Intergenic
1174660549 20:52209185-52209207 GTACAGAGACAGAGGGAGGGGGG + Intergenic
1175015385 20:55784568-55784590 GTTCACAGACAGAGAGAGAGTGG - Intergenic
1175051052 20:56155845-56155867 AGACAGAGACAGAGAGAGAGAGG - Intergenic
1175283143 20:57818941-57818963 CCACAGTGACAGAGAGAGGGTGG + Intergenic
1175356768 20:58375022-58375044 AGACAGAGATAGAGGGAGGGAGG - Intergenic
1175356807 20:58375169-58375191 GAAGAGAGAGAGAGAGAGGGAGG - Intergenic
1175433051 20:58920703-58920725 ATACAGAGACAGAAGGAGGGGGG + Intergenic
1175467937 20:59205230-59205252 GTGCAGAGACAAAGGGAGGAAGG - Intronic
1175950148 20:62579093-62579115 AGACAGAGACAGAGGGAGGCAGG - Intergenic
1176367736 21:6044046-6044068 GTCCTGGGTCAGAGTGAGGGGGG - Intergenic
1176805418 21:13476590-13476612 CTACATAAACAGAGTGAGGATGG + Intergenic
1177188506 21:17824006-17824028 GGAGAGAGACAGAGCAAGGGAGG + Intergenic
1177293009 21:19139727-19139749 GGAGAGAGAGAGAGTGAAGGGGG + Intergenic
1177295010 21:19162576-19162598 AGACAGAGAAAGAGTGAAGGGGG + Intergenic
1177328885 21:19629946-19629968 AGAGAGAGACAGTGTGAGGGAGG - Intergenic
1177783705 21:25646591-25646613 GGAGAGAGAGAGAGAGAGGGAGG + Intronic
1177825055 21:26073559-26073581 GTGAAGAGACAGAGCGAGGGTGG + Intronic
1177972297 21:27805516-27805538 GGAGAGAGAGAGAGAGAGGGAGG + Intergenic
1177987730 21:27998579-27998601 ACACAGAGAGAGAGAGAGGGAGG - Intergenic
1178791573 21:35705108-35705130 AGACAGAGACAGAGAGAGGAAGG + Intronic
1178919666 21:36730230-36730252 GTCCACAGACAGAGGGATGGAGG + Intronic
1179377846 21:40867464-40867486 GCACAGAGCCAGAGGAAGGGTGG - Intergenic
1179551480 21:42146571-42146593 GGACAGAGACACAGTGCGGGGGG - Intergenic
1179551531 21:42146733-42146755 GGACAGAGACAGGGTGCGGGGGG - Intergenic
1179709690 21:43206189-43206211 GAAGAGAGAGAGAGCGAGGGGGG + Intergenic
1179755783 21:43494496-43494518 GTCCTGGGTCAGAGTGAGGGGGG + Intergenic
1179825030 21:43959599-43959621 GGACAGGGACAGCGTCAGGGTGG - Intronic
1180818927 22:18811692-18811714 GTACAGAGACAGAGGGAAGGGGG - Intergenic
1181205151 22:21246147-21246169 GTACAGAGACAGAGGGAAGGGGG - Intergenic
1181753520 22:25006771-25006793 GGACAGAAACAGAGTGATGTGGG - Intronic
1182171127 22:28230632-28230654 ATACAGAGAGAGACTGGGGGAGG + Intronic
1182590656 22:31377147-31377169 ATACAGAAACAGAAGGAGGGGGG + Intergenic
1182733167 22:32511585-32511607 GCATGGAGACAGAGTAAGGGTGG + Intergenic
1182788919 22:32932520-32932542 GGAGAGAGACAGAGAGAGGGAGG + Intronic
1182922172 22:34090083-34090105 GTCCTGAGGCAGAGGGAGGGAGG + Intergenic
1183149906 22:36028942-36028964 GGAGAGAGAAAGAGGGAGGGAGG + Intergenic
1183174807 22:36215305-36215327 TTACAGTGTCAGGGTGAGGGCGG - Intergenic
1183282663 22:36940662-36940684 GTACAGAGACAGAGGGAGGGGGG + Intergenic
1183353595 22:37346914-37346936 GGACAGAGACAGAGAGCTGGGGG - Intergenic
1183425374 22:37736281-37736303 TTACAGAGAGAGAGAGAGGCTGG - Intronic
1183680431 22:39325547-39325569 GAAAAGAGAGAGAGGGAGGGAGG + Intergenic
1183782047 22:40005221-40005243 GTACATGGACAGAGCGAGGCAGG - Intronic
1184187885 22:42876835-42876857 GAAGAGAGACAGAGTGAGCGCGG + Intronic
1184293848 22:43511761-43511783 GGACAGGGAAAGAGTGAGGTTGG + Intergenic
1184605041 22:45567937-45567959 GCACAGAGCCAGTGGGAGGGAGG + Intronic
1185163914 22:49246073-49246095 GTTCAGAGACAGAGAGAGGATGG + Intergenic
1185302642 22:50090426-50090448 GTAAACACACAAAGTGAGGGCGG - Intronic
1203221774 22_KI270731v1_random:49268-49290 GTACAGAGACAGAGGGAAGGGGG + Intergenic
1203269052 22_KI270734v1_random:37545-37567 GTACAGAGACAGAGGGAAGGGGG - Intergenic
949109129 3:237261-237283 GCAGAGAGACAGAGTGAGTGGGG - Intronic
949288883 3:2439603-2439625 ATACAGAGACAGAAAGAGAGAGG - Intronic
949536199 3:4997961-4997983 GGAGAGAGAGAGAGAGAGGGAGG + Intergenic
949684580 3:6553519-6553541 GTACAGACACAGAGGGAAGGGGG - Intergenic
950676172 3:14555668-14555690 AGACAGAGACAGAGAGATGGAGG + Intergenic
950681494 3:14588359-14588381 GTCCAGAGAAGGAGAGAGGGTGG - Intergenic
950968327 3:17162172-17162194 GTAGGCAGACAGGGTGAGGGAGG - Intronic
951331699 3:21377257-21377279 GTACACACCCAGATTGAGGGTGG + Intergenic
951535301 3:23735290-23735312 GTAGAGAGACAGAGAGATGGCGG + Intergenic
951799179 3:26576103-26576125 GGAGAGAGACAGAGTGAAGTGGG + Intergenic
951844029 3:27066173-27066195 GGAGAGAGACAGAGAGAAGGGGG + Intergenic
952006505 3:28847582-28847604 ATACAGAGAGAGAGAGAGGGAGG - Intergenic
952090906 3:29884486-29884508 AGACAGAGAAAGAGGGAGGGAGG - Intronic
953076595 3:39577511-39577533 GTACAGAGACACAGGAAGAGGGG + Intergenic
953177036 3:40562185-40562207 GTAGAGACACAGAGAAAGGGTGG - Intronic
953302722 3:41794931-41794953 GTTTGGAGACAGAGTGAAGGAGG + Intronic
953449919 3:42997421-42997443 AGAGAGAGACAGAGAGAGGGGGG + Intronic
953622510 3:44545393-44545415 ACAGAGAGACAGAGAGAGGGAGG - Intergenic
954085378 3:48240099-48240121 ATACAGAGACAGAGGGAGCGGGG + Intergenic
954226995 3:49188529-49188551 GTACAGAGACATAGCCAGGTGGG - Intronic
954792487 3:53143544-53143566 GCAGAGAGCCAGGGTGAGGGAGG - Intergenic
955496592 3:59540041-59540063 GGAGAGAGACAGAGAGAGGAAGG - Intergenic
956145768 3:66189251-66189273 GTACAGGGTCAGAGTGAGAGTGG - Intronic
956255826 3:67282426-67282448 GGAGAGAGAGAGAGTGAAGGGGG - Intergenic
956654343 3:71534656-71534678 GGACAGAGCCAGAGTGGGGTTGG + Intronic
956850954 3:73227917-73227939 GTACAGAAAGAGAGAGAGGGAGG - Intergenic
957235104 3:77577500-77577522 GTACAGTGACAGACTGTGGTGGG - Exonic
957274111 3:78068206-78068228 ATACAGAGACAGAGAGAGGAGGG + Intergenic
957495882 3:80990937-80990959 GGAGAGAAAGAGAGTGAGGGGGG + Intergenic
957756740 3:84498627-84498649 GGAGAGAGAGAGAGAGAGGGAGG + Intergenic
957772732 3:84715381-84715403 GAAGAGAGAGAGAGTGAAGGGGG - Intergenic
957813170 3:85254858-85254880 GGAGAGAGACAGAAGGAGGGAGG - Intronic
958574244 3:95927060-95927082 CTACAGAAACAGAGGGAGGGGGG + Intergenic
958630172 3:96673896-96673918 GGACAGAGACAGAGAGACAGAGG - Intergenic
958636192 3:96750319-96750341 CTGCAAAGGCAGAGTGAGGGAGG - Intergenic
959145304 3:102537238-102537260 GTACAAAAACAGAATCAGGGTGG - Intergenic
959175431 3:102904029-102904051 GTACAGAGACAGAGGGAGGGTGG + Intergenic
959312887 3:104763137-104763159 CTACAGAGAGAGAGTTTGGGTGG - Intergenic
959314080 3:104779751-104779773 GTACAGAGCCAAAGAGTGGGCGG - Intergenic
960275211 3:115721227-115721249 GAACAGAGAGAGAGAGAGAGAGG - Exonic
960376012 3:116902375-116902397 ATAGAGAGAGAGAGAGAGGGAGG + Intronic
960433414 3:117597651-117597673 GTACACAGAGAGAGAGAGAGAGG + Intergenic
960597328 3:119418021-119418043 ATAGAGAGACAGAGAGAGAGAGG - Exonic
960719956 3:120616184-120616206 GTACAGAGACAGAGGGAGGGGGG + Intergenic
961484250 3:127206484-127206506 GCACAGAGATAGAGTGTGAGTGG - Intergenic
962201510 3:133404289-133404311 GTAGGGAGACAGAGGGAGGTAGG - Intronic
962458906 3:135591058-135591080 CTACAGAGACAGAGGGAGGGTGG - Intergenic
962950357 3:140212951-140212973 GTAAAGAGACAGGGTGTGGTGGG - Intronic
962978598 3:140467760-140467782 GAACAGAGAGAGGGTGGGGGTGG - Intronic
963731120 3:148973622-148973644 AGGCAGAGAAAGAGTGAGGGTGG + Intergenic
964124022 3:153217312-153217334 GTACTGAGAGAAAGGGAGGGAGG - Intergenic
964195798 3:154062873-154062895 GCGCAGAGACAGAGGGAGGGAGG - Intergenic
964389550 3:156183250-156183272 GTGCAGAGCCAAATTGAGGGAGG + Intronic
965099398 3:164277427-164277449 ATACAGAGACAGAAGGAGGAGGG + Intergenic
965197376 3:165618834-165618856 GGAGAAAGAGAGAGTGAGGGGGG + Intergenic
965270448 3:166611031-166611053 ATACAGAGACAGAGAGAGACAGG + Intergenic
965474990 3:169146398-169146420 GGACAGAGACACACGGAGGGAGG + Intronic
965819072 3:172666479-172666501 ATACAGAGACAGAGGGAGGGGGG - Intronic
965820114 3:172676609-172676631 GTACAGAGACAAAGGGAGGGGGG - Intronic
967155955 3:186692416-186692438 ATTCAGAGGCAGATTGAGGGAGG - Intergenic
967214444 3:187198692-187198714 ATGCTGAGACAGAGTGAGAGAGG - Intronic
968123419 3:196142085-196142107 GAAAAGAGAGAGAGAGAGGGAGG + Intergenic
968985547 4:3872563-3872585 GCAGAGAGACAGAGGGAGGATGG + Intergenic
969493137 4:7511274-7511296 GTGCAGAGAGAGAGAGAAGGAGG + Intronic
969519594 4:7668243-7668265 GGAGAGACACAGAGTGATGGAGG + Intronic
969520767 4:7676640-7676662 GTAGAGAGAGAGAGGGAGAGAGG - Intronic
969578816 4:8051999-8052021 GTAGAGAGAAAGAGGGAGGGGGG - Intronic
970525374 4:16926881-16926903 GGAGAGAGAGAGAGGGAGGGAGG - Intergenic
970570196 4:17373178-17373200 AGAGAGAGACAGAGAGAGGGAGG - Intergenic
970592280 4:17569968-17569990 GAACAGAGACAGAGGGAGGGGGG + Intergenic
971417353 4:26444324-26444346 GGACAGAGACTGAGAGATGGGGG + Intergenic
971826075 4:31624485-31624507 GGAGAGAGAGAGAGGGAGGGTGG - Intergenic
972099403 4:35394158-35394180 GGACAGAGAGAGAGAGATGGAGG - Intergenic
972216342 4:36900888-36900910 GTACTGAGACAGAGGGAGGGGGG - Intergenic
972848266 4:43016350-43016372 GCACACAGAGAGAATGAGGGAGG - Intronic
972924764 4:43990196-43990218 GAACAGACACAGAGGGAAGGTGG + Intergenic
973260743 4:48160816-48160838 AGAGAGAGACAGAGGGAGGGAGG + Intronic
973319701 4:48797475-48797497 GGAGAGAGAGAGAGGGAGGGAGG + Intergenic
973609748 4:52624284-52624306 ATACAGAGACAGTGGCAGGGAGG + Intronic
973870517 4:55161364-55161386 GGAAAGAGAGAGAGAGAGGGCGG + Intergenic
973926980 4:55748739-55748761 GTAAAGAAACAGAGAGAGAGAGG + Intergenic
974155755 4:58070043-58070065 CCACAGAGACAGAAGGAGGGAGG + Intergenic
974230097 4:59100882-59100904 GTACAGTGACACCGTGAGGTGGG - Intergenic
974933755 4:68389468-68389490 GTACAGAGACAGAGGGAGGGGGG + Intergenic
975193418 4:71493682-71493704 GGAGAGAGAGAGAGGGAGGGAGG - Intronic
975436146 4:74354089-74354111 ATACATAGTCAGGGTGAGGGAGG + Intergenic
976194928 4:82523211-82523233 GTACACAGCCAGAGGGATGGGGG + Intronic
976267244 4:83195719-83195741 GTACAGAGACAGAGGGGGGGGGG - Intergenic
976697036 4:87927744-87927766 AAAAAGAGACAGAGGGAGGGAGG - Intergenic
976954750 4:90881314-90881336 AGACAGAGAGAGAGAGAGGGGGG + Intronic
977499167 4:97816721-97816743 GTAGAGAAAGAGAGGGAGGGAGG - Intronic
977531570 4:98206791-98206813 GAGAAGAGACAGAATGAGGGAGG + Intergenic
977604144 4:98965011-98965033 GGGCAGAGACACAGTGAGAGAGG - Intergenic
977751935 4:100620354-100620376 GTACAGAGACAGAGGGAGCAGGG + Intronic
977836111 4:101647779-101647801 GGACAGAGAGGGAGTGAGGAGGG + Intronic
978498789 4:109386820-109386842 GTACAGAGACAGAGGGAGGGGGG + Intergenic
978577241 4:110199254-110199276 GAACAGAGGCAGAGTGGGGAAGG + Intergenic
978900816 4:113947545-113947567 GGAGAGAGGGAGAGTGAGGGAGG + Intronic
979181641 4:117736048-117736070 GGAGAGAGACAGAGTGAGTGGGG + Intergenic
979240279 4:118441655-118441677 GTACAGAGACAGAGGGAGAGGGG + Intergenic
979280934 4:118866734-118866756 GGAGAGAGAAAGAGTGAAGGGGG - Intronic
979287299 4:118940753-118940775 GGACACTGACAGAGTGAGGCTGG + Intronic
979506481 4:121502806-121502828 GGAAAGAGAAAGAGGGAGGGAGG - Intergenic
979536567 4:121827641-121827663 GTATTGAAACAGAGTAAGGGAGG - Intronic
979640436 4:123007458-123007480 GTACAGAGACAGAGGGAGTGGGG - Intronic
979672172 4:123371467-123371489 GTCAAGAGAGAGAGTGAGAGAGG - Intergenic
979764587 4:124448433-124448455 GTACAGGGAAAGAGTAAGTGAGG - Intergenic
980277745 4:130677013-130677035 GGAGAGAGAGAGAGTGAAGGGGG - Intergenic
980318719 4:131239910-131239932 GGAGAGAGAGAGAGTGAAGGGGG - Intergenic
980480076 4:133376832-133376854 GTACAGGGACAGAGGGAGGGGGG + Intergenic
980707896 4:136523438-136523460 GGAGAGAGAGAGAGGGAGGGAGG + Intergenic
980753432 4:137123609-137123631 ATAGAGAGACAGAGAGAGAGAGG - Intergenic
981136053 4:141212886-141212908 GGAGAGAGAGAGAGTGAAGGAGG + Intergenic
981606419 4:146545823-146545845 CTACAGAGGCAGTGTGAGAGGGG + Intergenic
981980383 4:150784674-150784696 GTACAGAGACAGAGGGAGCGGGG - Intronic
982318640 4:154057449-154057471 GTAGAGACACGGAGGGAGGGAGG - Intergenic
982429412 4:155305593-155305615 TTACAGAGACAGAAGGAAGGGGG + Intergenic
982877913 4:160671149-160671171 GGATAGAGAGAGAGAGAGGGCGG - Intergenic
982882087 4:160731944-160731966 AGAAAGAGACAGAGGGAGGGAGG - Intergenic
983043135 4:162954316-162954338 TGACAGAGACAGAGGGAGGGGGG + Intergenic
983442509 4:167804620-167804642 GAACAGAGAGAGAGGGAGGGAGG + Intergenic
983689565 4:170451796-170451818 ATACAGAGAGAGAGAGAGAGGGG + Intergenic
983928888 4:173432198-173432220 GTAGATAGAAAGAGGGAGGGAGG - Intergenic
984050117 4:174855462-174855484 GTACAAAGACAGAGGGAGGGGGG - Intronic
984571781 4:181403846-181403868 GGACAGAGAGAGAGAGAGAGAGG + Intergenic
984587751 4:181582346-181582368 TTCCAGAGACAGAGTGGGAGAGG - Intergenic
984922455 4:184777794-184777816 AGACAGAGACAGAGGGAGGCAGG + Intronic
984941545 4:184936471-184936493 ATACAGAGACAGAGGGAGGGGGG - Intergenic
985009309 4:185566327-185566349 ATACAGAGACAGAGGGAGGGGGG + Intergenic
985031222 4:185792516-185792538 GAAGAGAGAGAGAGGGAGGGAGG + Intronic
985044311 4:185924792-185924814 GTATAGAGACGGAGGGAGTGGGG - Intronic
985102368 4:186471124-186471146 TTACATGGTCAGAGTGAGGGAGG + Intronic
985216810 4:187662197-187662219 GTATAGACACAGAGTGTGGGGGG - Intergenic
985349368 4:189040901-189040923 GTAAAGAGACAGAGGGAGAGTGG - Intergenic
985356632 4:189126766-189126788 GGAGAGAGAGAGAGTGAAGGGGG + Intergenic
985645076 5:1081018-1081040 AGACAGAGAGAGAGAGAGGGAGG + Intronic
985661652 5:1160274-1160296 AGACAGAGACAGAGAGAGGGAGG + Intergenic
986032423 5:3906599-3906621 ATAAAGAGACAGATTGAGGAGGG + Intergenic
986042722 5:4009214-4009236 GTAGAGAGAGAGAGAGAGGGAGG + Intergenic
986536053 5:8788672-8788694 GGAGAGAGAGAGAGAGAGGGAGG - Intergenic
986666385 5:10108383-10108405 GAACAGAGACACAGCGATGGGGG - Intergenic
986784185 5:11096766-11096788 AGAGAGAGACAGAGGGAGGGAGG + Intronic
986840794 5:11694760-11694782 GAACAGAGACAGAAGGAGAGAGG - Intronic
986892958 5:12331410-12331432 GTACAGAGATAGAGGGAGAAAGG - Intergenic
986931965 5:12836259-12836281 GGACAGAGAGAGAGAGAGTGAGG - Intergenic
986971134 5:13338108-13338130 GGAGAGAGACAAAGTCAGGGGGG + Intergenic
987028750 5:13955203-13955225 GGAGAGAGAGAGAGTGAGGGGGG - Intergenic
987224013 5:15820878-15820900 GGACAGAGCCAGAGCAAGGGTGG - Intronic
987429968 5:17820818-17820840 AGACAGAGAGAGAGGGAGGGAGG + Intergenic
987498809 5:18679892-18679914 GTAGAGAGAAAGAGAAAGGGAGG + Intergenic
987507978 5:18798071-18798093 ATACAGAGACAGACGGAGGGAGG + Intergenic
987668363 5:20975311-20975333 GTACAGAGAGAGTGGGAGAGGGG + Intergenic
987841319 5:23225792-23225814 GCACAAAGACAGAGGGAGGGGGG - Intergenic
987842074 5:23234626-23234648 GTACAGAGACAGAGGGAGAGAGG - Intergenic
987906982 5:24089821-24089843 GAAAAGAGAGAGAGTGAGAGGGG + Intronic
988016890 5:25570570-25570592 GTACAGAAACAAAGGGAGGGTGG - Intergenic
988216289 5:28277792-28277814 GAAAAGAGAGAGAGGGAGGGAGG - Intergenic
988529932 5:32018415-32018437 GTTCAGGGACAGAGGGAGTGAGG + Intronic
988585007 5:32500541-32500563 ATACAGAGACAGGGGGAGGGGGG - Intergenic
988856620 5:35233609-35233631 GTACAGAGACAGAGGGAGGGGGG + Intergenic
988921768 5:35948954-35948976 GGAGAGAGAAAGAGTGAAGGGGG + Intergenic
989278122 5:39611669-39611691 GAAGAGAGAGAGAGAGAGGGAGG - Intergenic
989315746 5:40076500-40076522 GGAAAGAGACAGAGTGAAGAAGG - Intergenic
989644149 5:43611103-43611125 GTAAAGAAAAAGAGGGAGGGAGG - Intronic
990736577 5:58870053-58870075 AGACAGAGACAGAGAGAGGCAGG + Intergenic
990996730 5:61739607-61739629 GTTGAGAGATAGAGTGAGGCAGG + Intronic
991026961 5:62040178-62040200 GTACACAGAAAAAGTGAGGAAGG + Intergenic
991173520 5:63657509-63657531 AGACAGAGACAGAGAGAGGATGG + Intergenic
991415873 5:66392432-66392454 TTACATTGTCAGAGTGAGGGAGG - Intergenic
992452896 5:76889171-76889193 GTACAGAGACAGAGGGAAGGGGG - Intronic
992856245 5:80864322-80864344 GTACAGGAATAGAGTGTGGGTGG - Intronic
993125160 5:83825486-83825508 GTGTAGAGAGAGAGAGAGGGGGG + Intergenic
993174814 5:84470225-84470247 GTACAGAGAGAGAGAGAGAGAGG - Intergenic
993200639 5:84811604-84811626 GGAGAGAGACAGAGTTTGGGGGG - Intergenic
993836090 5:92822202-92822224 CTATAGAGACAGAGGGAGTGGGG + Intergenic
993956366 5:94238727-94238749 GCAGAGAGAGAGAGAGAGGGAGG - Intronic
994019953 5:95011605-95011627 GGAGAGAGAGAGAGTGAGGGAGG - Intronic
994089992 5:95801256-95801278 GTACAGACACAGAGGGAGGGCGG - Intronic
994346247 5:98690492-98690514 ATAGAGAGAGAGAGGGAGGGGGG + Intergenic
994455712 5:100004786-100004808 GGAGAGAACCAGAGTGAGGGAGG - Intergenic
994797414 5:104320743-104320765 ATATATAGACAGAGTGAGAGAGG + Intergenic
994815121 5:104576227-104576249 GGACAGAGAGAGAGGGAGGAGGG - Intergenic
995738568 5:115329789-115329811 GTACAGAGACAGAGGGAGCGGGG - Intergenic
995896808 5:117022674-117022696 GTAGAGAGAGAAAGGGAGGGAGG - Intergenic
995952257 5:117730301-117730323 GGAGAGAGACAGAGTGAAGAAGG - Intergenic
996251638 5:121342356-121342378 GGACAAAGAGAGAGAGAGGGAGG + Intergenic
996310283 5:122096606-122096628 CTGCAGAGACAGAGGGATGGGGG - Intergenic
996498758 5:124192508-124192530 GGAGAGAGAGAAAGTGAGGGGGG + Intergenic
996836604 5:127800783-127800805 GGACAGAGGCAGAGAGAGGTAGG - Intergenic
997020575 5:129995950-129995972 GGAGAGAGACAGAGAGAGAGAGG - Intronic
997147988 5:131458320-131458342 AGAGAGAGAGAGAGTGAGGGGGG - Intronic
997188147 5:131902059-131902081 GAAGAGAGACAGGGAGAGGGAGG - Intronic
997222459 5:132180961-132180983 GGACAGAGTCAGAGAGAGGCTGG - Intergenic
997238917 5:132293397-132293419 GTCCAGGAACAGAGGGAGGGAGG - Intronic
997552411 5:134764890-134764912 AAAGAGAGAAAGAGTGAGGGAGG - Intronic
997689069 5:135813350-135813372 GTCCACAGTCAGAGTGAGGGTGG + Intergenic
998345097 5:141455397-141455419 TTACAGAGACAGAGGGAGCGGGG + Intronic
998558089 5:143145401-143145423 ATAAAGAGAGAGAGTGAGGACGG - Intronic
998658264 5:144206304-144206326 GGAGAGAGAGAGAGGGAGGGAGG - Intronic
998707564 5:144780956-144780978 GTATTGGGACAGAGTGAAGGAGG + Intergenic
998740537 5:145195709-145195731 AGACAGAGAGAGAGGGAGGGAGG + Intergenic
998925146 5:147114922-147114944 GGAGAGAGAGAGAGTGAAGGGGG + Intergenic
999082929 5:148861258-148861280 GGAGAGAGAGAGAGTGAAGGGGG + Intergenic
999367998 5:151035409-151035431 GTACAAAGAAAGAGTCAGAGAGG + Intronic
999591629 5:153154610-153154632 GTACAGAGATAAAGAGAGGCTGG + Intergenic
999854153 5:155575326-155575348 GTATAGAGAGAGAGGGAGTGAGG - Intergenic
1000068669 5:157719234-157719256 ATACAGAGACACAGGGATGGGGG + Intergenic
1000276559 5:159741874-159741896 GTACAGAGAGAGAGGGAGAGGGG + Intergenic
1000323106 5:160150567-160150589 GCACAGAGTGAGAGGGAGGGAGG + Intergenic
1001239239 5:170055703-170055725 GTCCACAGACAGAGTGTGGCTGG + Intronic
1001496348 5:172189961-172189983 GGAGAGAGAAAGAGGGAGGGAGG + Intergenic
1001505536 5:172276689-172276711 GTGCAGAGACAAAGAAAGGGAGG + Intronic
1001618914 5:173065596-173065618 ATAAAGAGAGAGAGGGAGGGAGG - Intronic
1002740530 5:181432238-181432260 GTACAGAGACAGAGGGAGAGGGG + Intergenic
1002795712 6:469706-469728 ACACAGAGACAGAGAGAGGAGGG - Intergenic
1003071699 6:2950069-2950091 GTACAGAGACATACCAAGGGAGG - Intronic
1003255386 6:4470746-4470768 GTACAGAGACAGAGGGAGGGGGG + Intergenic
1003374457 6:5563072-5563094 GTACAGAGACAGAGGGAGGGGGG + Intronic
1004221191 6:13747845-13747867 AAACAGAGAGAGAGGGAGGGTGG + Intergenic
1004251363 6:14025572-14025594 GAACAGAGACTAAGTGAAGGTGG - Intergenic
1004319463 6:14621319-14621341 GTGCAGACAGAGAGGGAGGGTGG - Intergenic
1004778863 6:18882342-18882364 CAAGAGAGAGAGAGTGAGGGAGG - Intergenic
1004830307 6:19469980-19470002 AGACAGAGACAGAGAGACGGGGG + Intergenic
1005047226 6:21653867-21653889 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1005120003 6:22379243-22379265 GTACAGAGACAGAGGGAGTGGGG - Intergenic
1005163749 6:22895337-22895359 ATAGAGTGAAAGAGTGAGGGTGG - Intergenic
1005184546 6:23150220-23150242 GGAGATAGACAGAGAGAGGGAGG + Intergenic
1005223978 6:23620131-23620153 GGACAGAGAGAGAGGGAGGGGGG + Intergenic
1005223985 6:23620152-23620174 GGACAGAGAGAGAGGGAGGGGGG + Intergenic
1005982215 6:30845171-30845193 GTACAGAGACAGAGGGAGGGGGG + Intergenic
1006106310 6:31719027-31719049 ATACAGAGACACAGGGAGAGAGG + Exonic
1006266821 6:32932493-32932515 GGACATAGAGAGAGGGAGGGAGG - Intergenic
1006391075 6:33759023-33759045 GTACAGAGGCAGGATGGGGGAGG + Intergenic
1006746987 6:36349872-36349894 GGAGAGAGAGAGAGGGAGGGAGG - Intergenic
1006922884 6:37638027-37638049 GTACACAGCCTGAGTGAGTGTGG + Intronic
1007059678 6:38926401-38926423 GTACAAAGAGAGGGGGAGGGAGG - Intronic
1007270192 6:40630449-40630471 GTAGAGAGACAGAGGGAATGGGG + Intergenic
1007403853 6:41621245-41621267 ATACAGAGAGAAAATGAGGGTGG - Intergenic
1007484320 6:42170348-42170370 GGACAGAGAGAGAGAGAGAGAGG + Intronic
1007704096 6:43780696-43780718 AAACAGAGACAGAGAGAGAGCGG - Intronic
1007785914 6:44279229-44279251 GGACAGCTACAGAGTGATGGGGG + Exonic
1007839982 6:44708195-44708217 GTACAGACACAGCATGAGGGTGG - Intergenic
1007905814 6:45459779-45459801 GTAAGGGGACAGAGGGAGGGAGG + Intronic
1007950313 6:45866360-45866382 GGAGAGAGAGAGAGGGAGGGAGG - Intergenic
1007981733 6:46166257-46166279 GGAAAGAGAGAGAGAGAGGGAGG - Intronic
1008083750 6:47221945-47221967 GTATAGAGACAGAGGGAGGGGGG - Intergenic
1008721853 6:54363771-54363793 TTACAGAGACAGAGTGGGAGAGG + Intronic
1008743648 6:54642078-54642100 AGACAGAGAGAGAGGGAGGGAGG - Intergenic
1008788292 6:55197365-55197387 GTTTAGAGTCAGAGTCAGGGTGG - Intronic
1008790656 6:55228024-55228046 GTACAAACAGACAGTGAGGGAGG + Intronic
1008974435 6:57408284-57408306 TTACAGAGCCAGAGGGAGAGGGG + Intronic
1009163326 6:60309803-60309825 TTACAGAGCCAGAGGGAGAGGGG + Intergenic
1009654748 6:66527253-66527275 CGAGAGAGACAGAGTGAGAGGGG + Intergenic
1010622094 6:78089463-78089485 GGAGAGAGAAAGAGGGAGGGAGG + Intergenic
1010638017 6:78283947-78283969 GTGCAGAAACAGAGTTGGGGAGG - Intergenic
1010642126 6:78341615-78341637 AGAGAGACACAGAGTGAGGGGGG - Intergenic
1010993569 6:82506964-82506986 GTAGAGAGAGAGAGAGAGGAGGG - Intergenic
1011242072 6:85283120-85283142 AGAAAGAGAGAGAGTGAGGGGGG + Intergenic
1011663268 6:89612246-89612268 GGAGAGAGGCAGAGAGAGGGAGG - Intronic
1011996851 6:93600589-93600611 AGACAGAGACAGAGAGAAGGTGG - Intergenic
1012001938 6:93664715-93664737 GGAGAGAGAGAGAGAGAGGGAGG + Intergenic
1012290358 6:97448022-97448044 GTAAAGTCACAGAGTGAGGCAGG - Intergenic
1012375941 6:98561567-98561589 GTAGAGAGATGGAGGGAGGGAGG - Intergenic
1012445184 6:99300109-99300131 GCAAAGAGACAGAGTGATGGTGG - Intronic
1012734168 6:102917973-102917995 GGAAAGAGAAAGAGGGAGGGAGG - Intergenic
1012734197 6:102918075-102918097 GGAAAGAGAAAGAGGGAGGGAGG - Intergenic
1012747890 6:103117735-103117757 ACACAGAGACAGAGAGAGAGAGG - Intergenic
1012948638 6:105494364-105494386 TTACAGAGACAGAAAGAGGGAGG + Intergenic
1013164383 6:107576597-107576619 GACCACAGTCAGAGTGAGGGTGG + Intronic
1013796737 6:113896783-113896805 GGAGAGAGAGAGAGAGAGGGAGG + Intergenic
1014038844 6:116800191-116800213 GAAAAGAGAGAGAGGGAGGGAGG - Intronic
1014526020 6:122502512-122502534 GAAGAGAGAGAGAGTGAAGGGGG + Intronic
1015609558 6:135001478-135001500 ATACAGAGAGAGAGAGAGGGGGG - Intronic
1015705827 6:136086425-136086447 GTACAGAGACAGAGGGAGGGGGG + Intronic
1016164607 6:140924900-140924922 GGAGAGAGACAGAGAGAGGGAGG + Intergenic
1016180986 6:141148474-141148496 GTACAGAGACAGAGGGAAGGGGG + Intergenic
1016665508 6:146635350-146635372 AGACAGAGACAGAGAGTGGGTGG - Intronic
1016733205 6:147448591-147448613 GTACAGAGACTTAGGAAGGGGGG - Intergenic
1016740540 6:147524020-147524042 GTAGAGAGTCAGAGTTAGGTTGG + Intronic
1016779714 6:147944123-147944145 TGAGAGAGACAGAGTGAGAGAGG - Intergenic
1017538393 6:155373173-155373195 GAAGAAAGACAGAGAGAGGGAGG - Intergenic
1018190871 6:161308143-161308165 GTTCAGAGACAGAGGGAGGTGGG + Intergenic
1019084483 6:169462445-169462467 GGAAGGAGACAGAGAGAGGGAGG + Intronic
1019095384 6:169575313-169575335 GGAGAGAGAGAGAGGGAGGGAGG - Intronic
1019095393 6:169575347-169575369 GGAGAGAGAGAGAGGGAGGGAGG - Intronic
1019245640 6:170707835-170707857 GTACAGAGACAGAGGGAGAGGGG + Intergenic
1019265604 7:115907-115929 GAACAGAGACAGAGAGGGAGAGG + Intergenic
1019362316 7:611262-611284 AGAGAGAGACAGAGAGAGGGAGG - Intronic
1019489263 7:1303803-1303825 GGAAAGAGAGAGAGAGAGGGAGG + Intergenic
1019503762 7:1380279-1380301 GTAGAGACAGAGAGTAAGGGGGG + Intergenic
1019512262 7:1423585-1423607 AGACAGAGACAGAGAGATGGAGG + Intergenic
1019570444 7:1709066-1709088 GCACAGAGACAGAGGGGAGGAGG - Intronic
1019913449 7:4115744-4115766 GTACAGGGACAGAAGCAGGGAGG - Intronic
1020011506 7:4808061-4808083 GGAGAGAGACAGAGGGAGGGAGG - Intronic
1020350145 7:7210504-7210526 GTACAGAGACAGAGGGAGGGAGG + Intronic
1020353649 7:7252835-7252857 GTAAATTGAAAGAGTGAGGGTGG + Intergenic
1020437756 7:8184242-8184264 CTACAGAGACAAAATGAGAGGGG - Intronic
1020546736 7:9541892-9541914 AGACAGAGAGAGAGTGAAGGGGG - Intergenic
1020601476 7:10279722-10279744 GGAGAGAGAGAGAGTGAAGGAGG + Intergenic
1020851926 7:13364380-13364402 ATAAAGACACAGAGGGAGGGGGG - Intergenic
1021061407 7:16117425-16117447 TTACAGAGGCTGAGTGAGGCAGG + Intronic
1021176985 7:17460634-17460656 ATACAGAGACAGAGGGAGGGAGG + Intergenic
1021593433 7:22289881-22289903 GGAGAGAGAGAGAGTGAGAGTGG - Intronic
1021946470 7:25732729-25732751 GTACAGAGACAGAGGGAGGGAGG + Intergenic
1022366008 7:29717657-29717679 GTACAGAGACAGAGGGAGGGGGG - Intergenic
1022477274 7:30719791-30719813 ATACAGAGAGGGAGGGAGGGAGG - Intronic
1022698931 7:32738445-32738467 GGACAGGGAGAGAGGGAGGGAGG + Intergenic
1022914422 7:34933583-34933605 GTACCCACACAGATTGAGGGTGG - Intronic
1022931729 7:35124384-35124406 GTACAGAGACAGAGGAAGGGGGG + Intergenic
1022979189 7:35588164-35588186 AGAGAGAGAAAGAGTGAGGGGGG - Intergenic
1023126676 7:36960940-36960962 GTACAGAGACAGAGGGAAGGGGG - Intronic
1023143949 7:37130369-37130391 GTCCAGAGACAGAGTCCTGGGGG + Intronic
1023994843 7:45153003-45153025 GCACAGTGACAGAGGGAGGGAGG - Intergenic
1024003173 7:45204460-45204482 GCAGAGAGACCGAGTCAGGGAGG - Intergenic
1024193063 7:47032282-47032304 TTACAGAGACAGAGGGAGGGGGG - Intergenic
1024281465 7:47722796-47722818 GGACAGAGACACACAGAGGGAGG - Intronic
1024472643 7:49779058-49779080 AGACAGAGACAGAGAGAGAGGGG + Intronic
1024865394 7:53900023-53900045 ATACAGAGTCAGAGGGACGGGGG - Intergenic
1025009334 7:55383263-55383285 TTACAGAGGCAGAGGGAGGGAGG + Intronic
1025117185 7:56268402-56268424 GGAAAGAGAAAGAGGGAGGGAGG - Intergenic
1025236042 7:57235546-57235568 GTACAGAGACAGAGGAATGGGGG + Intergenic
1025718698 7:63989038-63989060 AGACAGAGAGAGAGGGAGGGAGG + Intergenic
1025795143 7:64732645-64732667 GTACAGAGACAGAGGGAGGGGGG + Intergenic
1026261387 7:68758792-68758814 AAAAAGAGAGAGAGTGAGGGAGG + Intergenic
1026467436 7:70666554-70666576 GCACAGAGACAGAGAGATAGTGG - Intronic
1027416868 7:77983341-77983363 AAAGAGAGACAGAGGGAGGGAGG - Intergenic
1028567759 7:92251622-92251644 GTATGGAGACAGAGAGAGAGAGG - Intronic
1028923546 7:96332518-96332540 GTGTAGAGAGAGAGAGAGGGTGG + Intergenic
1028994473 7:97085159-97085181 GGAGAGAAAGAGAGTGAGGGGGG + Intergenic
1029335007 7:99891510-99891532 CAACATAGGCAGAGTGAGGGGGG + Exonic
1029827616 7:103216846-103216868 GTACAGAGACAGAGGAAGGGGGG + Intergenic
1029918608 7:104238322-104238344 ATAAAGAGACAGAGAGAGGTTGG + Intergenic
1030407115 7:109128864-109128886 GTACAGAGACAGAGGGAGGGGGG + Intergenic
1030468425 7:109932111-109932133 GGACAGAGAAAGAGAGAGAGAGG + Intergenic
1030584718 7:111403255-111403277 AGAGAGAGAGAGAGTGAGGGGGG - Intronic
1030622107 7:111801340-111801362 GTACAGAGACAGAGGTGGGGAGG - Intronic
1030721987 7:112881792-112881814 GTACACAGACAGCTGGAGGGTGG - Intronic
1030926254 7:115459189-115459211 GAATAGAGCCAGAGTGAAGGGGG - Intergenic
1031194689 7:118598231-118598253 GTAGAGAGAGAGAGAGAGAGGGG - Intergenic
1031220250 7:118956522-118956544 TGACAGAGACAGAGGGAGGGGGG + Intergenic
1031388951 7:121189413-121189435 GGAGAGAGAAAGAGTGAAGGAGG + Intronic
1031455799 7:121978303-121978325 GTAGAGAGACAGAGAGAGAGGGG - Intronic
1031528000 7:122844795-122844817 TTTCAGAGACAAAGTGAGTGGGG + Intronic
1031671688 7:124554786-124554808 GTACAGAGAATGAGGGAGAGGGG + Intergenic
1031677741 7:124632634-124632656 GACCAGAGCAAGAGTGAGGGAGG + Intergenic
1031750716 7:125569552-125569574 GAAAAGAAACAGAGGGAGGGAGG - Intergenic
1032491958 7:132330440-132330462 GGACAGAAACAGAGAAAGGGCGG + Intronic
1032631833 7:133661590-133661612 ATACAGAGACAAAAGGAGGGGGG - Intronic
1032718326 7:134529836-134529858 GTAAAAAGAAAGAGAGAGGGAGG - Intronic
1032725541 7:134587109-134587131 AGAGAGAGACAGAGTGGGGGGGG + Intergenic
1032934280 7:136711176-136711198 GGGGAGAGACAGAGGGAGGGAGG + Intergenic
1033620712 7:143059870-143059892 GCACTGAGACAGAGGGAGGCAGG + Intergenic
1033816984 7:145085217-145085239 ATGCACAGACAGAGAGAGGGGGG + Intergenic
1034003326 7:147441872-147441894 GAACAGAGAGAGACGGAGGGAGG - Intronic
1034003711 7:147444971-147444993 GGAGAGAGAAAGAGTGAAGGGGG + Intronic
1034020824 7:147640767-147640789 ATACAGAGACAGAGAGAGGAAGG + Intronic
1034148467 7:148893422-148893444 GAAGAGAGAGAGAGTGAGGTAGG + Intergenic
1034528634 7:151681952-151681974 GCACAGAGACGGAGTGAGCTTGG + Intronic
1034878899 7:154748983-154749005 TTACTGAGAGAGGGTGAGGGAGG + Intronic
1035502484 8:100363-100385 GTACAGAGACAGAGGGAGAGGGG - Intergenic
1035638617 8:1165163-1165185 AGACAGAGAGAGAGGGAGGGTGG + Intergenic
1035654181 8:1293154-1293176 AGACAGAGACAGAGAGAGAGGGG - Intergenic
1035833401 8:2723247-2723269 ATAGAGAGACAGAGAGAGAGAGG + Intergenic
1037410873 8:18595459-18595481 AGACAGAGACAGACGGAGGGAGG + Intronic
1037623467 8:20587592-20587614 CTACAGAGACAGGGTGGGGGGGG + Intergenic
1037656166 8:20886024-20886046 AAAGAGAGACAGAGGGAGGGAGG + Intergenic
1037952583 8:23028607-23028629 GTACACACACAGAGGGAGAGGGG + Intronic
1038645816 8:29361286-29361308 GAACAGAGACACAGGCAGGGTGG - Intergenic
1038721335 8:30038583-30038605 GAACAGAGGGAGAGGGAGGGAGG + Intergenic
1038873564 8:31522535-31522557 ATACAGAGACAGAGGAAGGGGGG + Intergenic
1038953295 8:32440108-32440130 GGAGAGAGAGAGAGTGAGAGGGG + Intronic
1038984781 8:32796598-32796620 AGAGAGAGACAGAGAGAGGGGGG + Intergenic
1039416764 8:37401858-37401880 AGACAGAGACAGAGAGAAGGAGG - Intergenic
1039428585 8:37506822-37506844 GAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1039635145 8:39156739-39156761 GTGCAGATACAGGGAGAGGGTGG - Intronic
1039820280 8:41128580-41128602 GTATAGAGACAGAGGGAGAGAGG - Intergenic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1040684323 8:49853087-49853109 GGAGAGAGACAGAGAGAGAGAGG + Intergenic
1040687034 8:49886298-49886320 GGAGAGAGAGAGAGTGAAGGGGG - Intergenic
1040988136 8:53318627-53318649 TTACAGAGACAGAGGGAGGGGGG - Intergenic
1041608946 8:59820960-59820982 TCACAGAGACATACTGAGGGAGG + Intergenic
1041741832 8:61164737-61164759 ATACAGACACAGAAAGAGGGGGG - Intronic
1041786099 8:61636366-61636388 CTATAGAGACAGAGGGAGAGAGG + Intronic
1041831808 8:62163169-62163191 GTACAGAGACAGACCGGAGGTGG + Intergenic
1042043259 8:64618607-64618629 ATAGAGAGACAGAGGGAGAGAGG - Intronic
1042171936 8:66000088-66000110 AGACACAGACAGAGGGAGGGAGG - Intergenic
1042369615 8:67976775-67976797 AGACAGAGACAGAGCGAGAGGGG + Intronic
1042463542 8:69099612-69099634 GTAGAGAGAGAGAGAGAGAGAGG - Intergenic
1042943555 8:74132002-74132024 GTACAGCGACAGAGGGAGAGGGG + Intergenic
1043349050 8:79337403-79337425 GTACAGACAGAGAGTGAGAGTGG - Intergenic
1043782701 8:84356040-84356062 GGAGAGAGACAGAGTGAAGGGGG - Intronic
1044189206 8:89294784-89294806 GTGCAGAGAAAGAGAGAGAGAGG - Intergenic
1044492425 8:92835279-92835301 GGAGAGAGAGAGAGTGAAGGGGG - Intergenic
1044542138 8:93419929-93419951 AGACAGAGACAGAGAGAGGAAGG - Intergenic
1044624753 8:94226241-94226263 AGACAGAGACAGAGGGAAGGAGG - Intergenic
1044897209 8:96905165-96905187 AGAGAGAGAGAGAGTGAGGGGGG + Intronic
1044993060 8:97813431-97813453 GTACCCATACAGATTGAGGGTGG + Intronic
1045199255 8:99962503-99962525 GAACAGAGACAGAGAGAAGCAGG + Intronic
1045400265 8:101808896-101808918 GGAGAGAGACAGAGAGAGAGAGG + Intronic
1046302681 8:112318160-112318182 GAACAGAGCTAGAGAGAGGGTGG - Intronic
1046688799 8:117258855-117258877 GCAGAGAGAGAGAGTGAGTGTGG - Intergenic
1046778005 8:118184382-118184404 GTACATACACACAGTGATGGAGG - Intergenic
1046950516 8:120015690-120015712 GTACAGAGACAGAGGGAGGGGGG + Intronic
1047284971 8:123479981-123480003 GTACAGAGACAGAGGGAGGGAGG - Intergenic
1047505923 8:125480124-125480146 AGACAGAGACAGAGAGAGGTGGG - Intergenic
1047600361 8:126420007-126420029 GTACAGAGATAGAGGGAGGGGGG + Intergenic
1048326226 8:133441523-133441545 GGAGAGAGAGAGAGAGAGGGAGG - Intergenic
1048745868 8:137614611-137614633 GGAGAGAGAAAGAGTGAAGGGGG - Intergenic
1049053475 8:140217136-140217158 GCAAAGAGGCAGAGTGAGGGAGG + Intronic
1049091982 8:140522687-140522709 AGACAGAGACAGAGAGAGGGAGG + Intergenic
1049288127 8:141787575-141787597 GAACAGAGAGGGAGGGAGGGAGG + Intergenic
1049489819 8:142889931-142889953 GGAGAGAGAGAGAGTGAAGGGGG + Intronic
1049512843 8:143038386-143038408 ACACAGAGAGAGAGAGAGGGAGG + Intergenic
1049534783 8:143173877-143173899 AAAGAGAGACAGAGAGAGGGGGG + Intergenic
1049825874 8:144667410-144667432 CTGCAGAGACAGGATGAGGGAGG - Intergenic
1049829626 8:144692193-144692215 GGAAGGAGACAGAGAGAGGGAGG - Intergenic
1050052915 9:1622111-1622133 GGAGAGAGAGAGAGTGAAGGAGG + Intergenic
1050090734 9:2015328-2015350 GTACAGAAACAGAGGGAGAGAGG - Exonic
1050579724 9:7040302-7040324 AAAGAGAGACAGAGGGAGGGAGG - Intronic
1050816787 9:9823322-9823344 CAAGAGAGAAAGAGTGAGGGCGG + Intronic
1050830244 9:10001043-10001065 CTACAGAGATAGAGGGAGCGGGG - Intronic
1051244879 9:15099922-15099944 GGAGAGAGAGAGAGAGAGGGAGG + Intergenic
1051784338 9:20725422-20725444 GAACTGAGAAAGAGAGAGGGGGG + Intronic
1051993575 9:23184689-23184711 GATCAGAGACAGAGGGAGGGGGG - Intergenic
1052012074 9:23422257-23422279 GGACAGAGAGAGAGTGAAAGGGG - Intergenic
1052161562 9:25266965-25266987 GTAGAGAGAGAGAGGGAGGGAGG + Intergenic
1052718358 9:32145696-32145718 ATACAGAGACAGCGGGAGGGGGG - Intergenic
1052762854 9:32610326-32610348 GGAGAGAGAGAGAGAGAGGGAGG - Intergenic
1052913008 9:33900908-33900930 AGACAGAGACAGAGAGAGAGAGG - Intronic
1053126059 9:35581668-35581690 GGAGAGAGAGAGAGCGAGGGAGG - Intergenic
1053141134 9:35683349-35683371 ACACAAAGACAGAGTGAGAGAGG + Intronic
1053452380 9:38203821-38203843 AAACAGAGAGAGAGGGAGGGAGG - Intergenic
1053483946 9:38438047-38438069 GTTCAGAGACAGAGTGGAGTGGG + Intergenic
1053580423 9:39398421-39398443 ACACAGAGAGAGAGAGAGGGAGG - Intergenic
1053671954 9:40375275-40375297 GAAGAGAGAGAGAGTGAAGGGGG - Intergenic
1054102010 9:60957226-60957248 ACACAGAGAGAGAGAGAGGGAGG - Intergenic
1054383067 9:64515323-64515345 GAAGAGAGAGAGAGTGAAGGGGG - Intergenic
1054512669 9:66001035-66001057 GAAGAGAGAGAGAGTGAAGGGGG + Intergenic
1055071856 9:72174804-72174826 AGACAGAGACAGAGTGGGGATGG + Intronic
1055290032 9:74772887-74772909 GTACAGAGATAGAGGGAGGGGGG - Intronic
1055352088 9:75399952-75399974 GGAGAGAGAGAGAGTGAAGGGGG + Intergenic
1055525818 9:77132760-77132782 GGAGAGAGAGAGAGCGAGGGAGG - Intergenic
1055892546 9:81138833-81138855 GAAAAGAGACAGAGGGAAGGAGG + Intergenic
1056199084 9:84257220-84257242 GTACAGAGAGAAAGTGTGGGAGG + Intergenic
1056625637 9:88250888-88250910 GGAGAGAGAGAGAGTGAAGGGGG - Intergenic
1056848697 9:90062605-90062627 GTAAGGAGACAGAGAGAGTGAGG - Intergenic
1057108743 9:92446843-92446865 AAACAGAAAGAGAGTGAGGGAGG + Intronic
1057904420 9:98973255-98973277 GGAGAGAGAGAGAGAGAGGGAGG + Intronic
1058388828 9:104471005-104471027 GAAGAAAGACACAGTGAGGGGGG + Intergenic
1058619208 9:106864630-106864652 CTACAGAGAGGGAGGGAGGGAGG + Intronic
1059019379 9:110557492-110557514 GGAGAGAGAGAGAGGGAGGGAGG - Intronic
1059723939 9:116987448-116987470 GGAGAGAGAGAGAGTGAAGGGGG - Intronic
1059779962 9:117515835-117515857 GGAGAGAGAGAGAGGGAGGGAGG + Intergenic
1059779968 9:117515857-117515879 GGAGAGAGAGAGAGGGAGGGAGG + Intergenic
1060060214 9:120453244-120453266 GAAGAGAGACAGAGGGAGTGAGG + Intronic
1060683551 9:125586935-125586957 GTAGATAGGCAGTGTGAGGGAGG - Intronic
1060757532 9:126224059-126224081 GGCCAGAGATAGAGTCAGGGTGG - Intergenic
1061216490 9:129224786-129224808 GTACAGACCCAGAATGAGGGGGG - Intergenic
1061996634 9:134189495-134189517 ATACAGAGACAGAGGGAGAGTGG + Intergenic
1062034282 9:134375943-134375965 GCAGAGAGAGAGAGGGAGGGAGG - Intronic
1062158180 9:135065664-135065686 GCACAAAGACAGAGAGAGGCAGG - Intergenic
1062348638 9:136127854-136127876 AGAAAGAGACAGAGAGAGGGAGG + Intergenic
1062465029 9:136677150-136677172 AGACAGAGACAGAGAGAGAGGGG + Intronic
1062540150 9:137038256-137038278 ATAGAGAGAGAGAGAGAGGGGGG - Intergenic
1203605839 Un_KI270748v1:57046-57068 GTACAGAGACAGAGGGAGAGGGG + Intergenic
1185451496 X:283308-283330 GGACTGAGACAGAGGGACGGGGG + Intronic
1185567469 X:1106858-1106880 GGAGAGAGACAGAGAGAGGGAGG + Intergenic
1185575363 X:1168243-1168265 GGAAAGAGAGAGACTGAGGGAGG - Intergenic
1185637178 X:1561319-1561341 GAACAGAGAGAGAGAGACGGAGG - Intergenic
1185666505 X:1769502-1769524 GGAGAGACAGAGAGTGAGGGGGG + Intergenic
1185681793 X:1894389-1894411 GGACAGAGACAGAGAGACAGAGG - Intergenic
1185700446 X:2227434-2227456 ACACAGAGAGAGAGGGAGGGAGG + Intronic
1185867549 X:3637064-3637086 GGAGAGAGAGAGAGAGAGGGAGG + Intronic
1185889562 X:3812407-3812429 CTGCAGAGAGAGAGGGAGGGAGG - Intergenic
1185918920 X:4067257-4067279 GAAGAGAGAAAGAGAGAGGGGGG - Intergenic
1185966819 X:4614907-4614929 AGACAGAGACAGAGAGAGGAGGG + Intergenic
1186021171 X:5257055-5257077 TAACAGAGACAGAGGGAGAGAGG + Intergenic
1186230552 X:7449222-7449244 CTACAGAGACTGAGAGCGGGAGG - Intergenic
1186268516 X:7858856-7858878 AGAGAGAGACAGAGTGAAGGTGG + Intergenic
1186269167 X:7866413-7866435 GGAGAGAGAGAGAGGGAGGGAGG - Intergenic
1186336422 X:8594213-8594235 TAGCAGAGACAGAGAGAGGGAGG + Intronic
1186508383 X:10111741-10111763 GTGCAGAGAGAGAGTGAGGTTGG + Intronic
1187278677 X:17839258-17839280 GGACAGAGAAAGAGAGAGGGAGG - Intronic
1187283534 X:17881315-17881337 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1187286679 X:17911825-17911847 GCACAGAGAAAGGGTGAGGGCGG - Intergenic
1188011960 X:25066312-25066334 GAAGAGAGAGAGAGAGAGGGAGG - Intergenic
1188373166 X:29393526-29393548 ATACAGAGAGAGAGAGAGAGAGG - Intronic
1188606868 X:32042004-32042026 GAACAGAGAGAGAGAGAGAGAGG - Intronic
1188613554 X:32129706-32129728 GGAGAGAGAGAGAGAGAGGGAGG + Intronic
1189590376 X:42505033-42505055 GTACAGAGACAGAGGGAAGGGGG + Intergenic
1189607002 X:42689389-42689411 GTATAGAGAGAGAGAGAGAGAGG - Intergenic
1190016155 X:46828998-46829020 GAAAAGAGAAAGAGAGAGGGAGG + Intergenic
1190439525 X:50463398-50463420 GGAGAGAGACAGAGGAAGGGAGG - Intronic
1190538813 X:51456616-51456638 ATACAGAGACAGAGGGAGGGGGG - Intergenic
1191936197 X:66429621-66429643 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1191999071 X:67128238-67128260 GTAGAAAGAGAGAGTGAAGGGGG - Intergenic
1192215454 X:69154929-69154951 AGACAGAGAAAGAGGGAGGGAGG - Intergenic
1192765189 X:74132702-74132724 GTACAGAGACAGAAGGCAGGGGG - Intergenic
1192776780 X:74253914-74253936 TTACAGAGACAGAGGGAGGGGGG - Intergenic
1192777522 X:74260347-74260369 ATACAGAGGCAGAGGGAGGGGGG - Intergenic
1193256367 X:79353917-79353939 GAAGAGAGTCAGAGTGAGCGGGG - Intergenic
1193413568 X:81195400-81195422 GTACCCAGCCAGACTGAGGGTGG + Intronic
1193731804 X:85110955-85110977 GTAAAGAAACAGATTGAGAGAGG + Intergenic
1194438726 X:93902051-93902073 GAAGAGAGAAAGAGTGAAGGGGG - Intergenic
1194538529 X:95140863-95140885 ATAGAGAGAGAGAGAGAGGGAGG + Intergenic
1194547163 X:95251480-95251502 CTACTGAGAAAGAGTGGGGGTGG - Intergenic
1194656488 X:96580301-96580323 GTAGAGAGAGAGAGAGAGGAAGG + Intergenic
1194823843 X:98537534-98537556 GTGCAGACCCAGATTGAGGGTGG - Intergenic
1194889133 X:99355575-99355597 GTACAGAGACAAAGGGAGAAGGG - Intergenic
1194903282 X:99541995-99542017 GGAGAGAGAGTGAGTGAGGGGGG - Intergenic
1194976962 X:100406130-100406152 AAACAGAGAGAGAGAGAGGGAGG - Intronic
1195430731 X:104786316-104786338 GAACAGATACAGATTGAGGAAGG - Intronic
1195640913 X:107174060-107174082 GGAGAGAGAGAGAGGGAGGGAGG - Intronic
1195652299 X:107297770-107297792 ATACAGAGAGAGAGAGATGGGGG - Intergenic
1195920425 X:109977995-109978017 GTACAGAGATGGAGGCAGGGAGG - Intergenic
1195927075 X:110037111-110037133 GTAGAGAGAGAGAGAGAGAGGGG + Intronic
1196254172 X:113496368-113496390 GGAGAGAGAGAGAGTGAGGAGGG + Intergenic
1196865622 X:120067770-120067792 GCACAGAGAGAGAGAGAGAGAGG - Intergenic
1196877471 X:120168510-120168532 GCACAGAGAGAGAGAGAGAGAGG + Intergenic
1197153745 X:123247864-123247886 GTACACAGAGAGAGAGAGAGAGG + Intronic
1197507505 X:127325188-127325210 GTAGAGAGAGAGATAGAGGGAGG - Intergenic
1197576883 X:128224576-128224598 ATACAGAGAGAGAGAGAGAGAGG - Intergenic
1197662376 X:129188174-129188196 GTACACAGACAGAGGGAGGGGGG + Intergenic
1197854715 X:130902751-130902773 GCACAGAGCCAGGGGGAGGGGGG + Intronic
1198493512 X:137167159-137167181 GTACAGAGTCAGGGTGATGAAGG + Intergenic
1198531766 X:137555083-137555105 GGAGAGAGAAAGAGGGAGGGAGG + Intergenic
1198847786 X:140931315-140931337 GTACAGAGACAGAGGGAAGGAGG - Intergenic
1199018648 X:142848787-142848809 ATACAGAGACAGAGGGAGGGGGG - Intergenic
1199201883 X:145100400-145100422 TGACAGAGAGAGAGGGAGGGAGG - Intergenic
1199386745 X:147231864-147231886 GTACAGAGTCACAGTTAGGAGGG + Intergenic
1199774185 X:150996486-150996508 GAAGAGAGAGAGAGAGAGGGAGG + Intergenic
1199970316 X:152854888-152854910 GTAGAGAGAGAGAGAGAGAGAGG + Intronic
1199995936 X:153026530-153026552 GTAGAGAGAGAGAGGGAGAGAGG - Intergenic
1200044511 X:153393971-153393993 ACACAGAGACAGAGAGAGAGAGG - Intergenic
1200046497 X:153405606-153405628 GGAGAGAGAGAGAGTGAGAGAGG - Intergenic
1200129536 X:153833483-153833505 AGATAGAGACAGGGTGAGGGCGG + Intergenic
1200136884 X:153879578-153879600 GTAGAGAGACAGACAGAGGGTGG + Intronic
1200258024 X:154595638-154595660 ATACAGAGACAGAGAGAGAGAGG + Intergenic
1200310942 X:155076553-155076575 GGAGAGAGAGAGAGTGAGGGGGG + Intronic
1200330038 X:155285912-155285934 ATACCGAGACAGAGGGAGGGGGG + Intronic
1200953670 Y:8924839-8924861 GAAGAGAGAAAGAGAGAGGGAGG - Intergenic
1201146272 Y:11067047-11067069 GTACAGAGGGAGAGGGAGGAAGG + Intergenic
1201301595 Y:12509869-12509891 GAACAGAGAGAGAGAGAGAGAGG + Intergenic
1201864017 Y:18630122-18630144 GTACAAAGAGAGAGGGAAGGAGG - Intergenic
1201869305 Y:18690256-18690278 GTACAAAGAGAGAGGGAAGGAGG + Intergenic
1201900461 Y:19042783-19042805 TTACAGAGACAGAGGGAGGAGGG - Intergenic
1202048069 Y:20753994-20754016 GTACAGACACAGAGGGAGGGAGG + Intergenic
1202231791 Y:22666290-22666312 AAACAGAGACAGAGGGATGGAGG - Intergenic
1202311367 Y:23529875-23529897 AAACAGAGACAGAGGGATGGAGG + Intergenic
1202388015 Y:24343484-24343506 GTACAGAGACAGAGGGAGAGGGG + Intergenic
1202482772 Y:25326644-25326666 GTACAGAGACAGAGGGAGAGGGG - Intergenic
1202559435 Y:26140719-26140741 AAACAGAGACAGAGGGATGGAGG - Intergenic