ID: 1167874192

View in Genome Browser
Species Human (GRCh38)
Location 19:52398008-52398030
Sequence CTGAATTTACTCGGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167874192_1167874201 27 Left 1167874192 19:52398008-52398030 CCCTCCACCCCGAGTAAATTCAG 0: 1
1: 1
2: 1
3: 8
4: 105
Right 1167874201 19:52398058-52398080 TTCTGCGTGTTAAAATCGCTTGG 0: 1
1: 0
2: 1
3: 5
4: 70
1167874192_1167874198 -4 Left 1167874192 19:52398008-52398030 CCCTCCACCCCGAGTAAATTCAG 0: 1
1: 1
2: 1
3: 8
4: 105
Right 1167874198 19:52398027-52398049 TCAGACATCCTTTGAGAGTCTGG 0: 1
1: 0
2: 1
3: 12
4: 133
1167874192_1167874202 30 Left 1167874192 19:52398008-52398030 CCCTCCACCCCGAGTAAATTCAG 0: 1
1: 1
2: 1
3: 8
4: 105
Right 1167874202 19:52398061-52398083 TGCGTGTTAAAATCGCTTGGAGG 0: 1
1: 1
2: 1
3: 4
4: 63
1167874192_1167874199 -3 Left 1167874192 19:52398008-52398030 CCCTCCACCCCGAGTAAATTCAG 0: 1
1: 1
2: 1
3: 8
4: 105
Right 1167874199 19:52398028-52398050 CAGACATCCTTTGAGAGTCTGGG 0: 1
1: 1
2: 2
3: 42
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167874192 Original CRISPR CTGAATTTACTCGGGGTGGA GGG (reversed) Intronic
905471002 1:38191587-38191609 CTTAATTTATAAGGGGTGGAAGG + Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1076831606 10:132997375-132997397 CTGTATTCACTCGGGCTCGAAGG + Intergenic
1076987470 11:249296-249318 CTGCATCTACGCTGGGTGGAGGG + Intronic
1077000346 11:319227-319249 CTTTAGTTCCTCGGGGTGGAGGG - Intergenic
1078290525 11:10006160-10006182 CTGACTTGCCTCGAGGTGGACGG - Intronic
1083309891 11:61778741-61778763 CTCATTTTACCGGGGGTGGAAGG - Intronic
1086330539 11:85749577-85749599 AAGAGTTTACTCTGGGTGGAAGG - Intronic
1101638609 12:106568435-106568457 AAGATTTTACTCAGGGTGGAAGG - Intronic
1102466909 12:113135422-113135444 CTGAATGTTCGCGTGGTGGAGGG - Exonic
1104469438 12:129017934-129017956 CTGTTTTTACTCAGGGTGGAGGG - Intergenic
1105903120 13:24775165-24775187 CTAAAGTTACTCGTGCTGGATGG + Intronic
1107964278 13:45585564-45585586 CTGCAGTTACTTGGGGTGGGGGG - Intronic
1109803080 13:67402553-67402575 ATGTACTTACTCTGGGTGGATGG + Intergenic
1110325239 13:74206533-74206555 CCCAATTTCCTGGGGGTGGATGG - Intergenic
1110525640 13:76533406-76533428 GTGAATTTACTCAGGGAGGTAGG + Intergenic
1114624061 14:24117157-24117179 CTGAATATACTGGGGCTGTAAGG - Intronic
1118857134 14:69632367-69632389 CTGCATTTACTGAGGGAGGAGGG - Intronic
1120858466 14:89233603-89233625 CTGTGTTTACTGGGAGTGGAGGG - Intronic
1123962604 15:25421261-25421283 GTGAGTTTACTCATGGTGGAAGG - Intronic
1128997222 15:72306099-72306121 ATGAATTCACTCAGGGTGGTTGG - Intronic
1129105954 15:73307406-73307428 CTGAAATAATTAGGGGTGGAGGG + Intergenic
1132579095 16:677023-677045 CTTCATGTACTCGGGGTGGTAGG - Exonic
1132673870 16:1113807-1113829 CTGGATCTTCTCGGGGTGGGGGG - Intergenic
1134515056 16:14880236-14880258 CTGATTTTACTTGGGAGGGAAGG + Intronic
1134702733 16:16278883-16278905 CTGATTTTACTTGGGAGGGAAGG + Intronic
1134964810 16:18433232-18433254 CTGATTTTACTTGGGAGGGAAGG - Intronic
1134969097 16:18515767-18515789 CTGATTTTACTTGGGAGGGAAGG - Intronic
1135072797 16:19367177-19367199 ATGCATTTACTCATGGTGGAAGG + Intergenic
1136566848 16:31075659-31075681 CTGAAATGACTCGGGGTGGTGGG + Intronic
1138223927 16:55276477-55276499 CAGGATCTACTCGGTGTGGAGGG + Intergenic
1142906837 17:3049179-3049201 CTGGGTTTTCTGGGGGTGGAGGG + Intergenic
1151513962 17:74580294-74580316 CTGAGTTTACTGGAGGTGTAGGG - Intronic
1159026056 18:63183142-63183164 CTGATCTTACTTCGGGTGGAAGG - Intronic
1166855175 19:45779733-45779755 CTGACTTGACTCGTGGTGGGCGG - Intronic
1167862586 19:52297327-52297349 CTGAATTTGGTCGGGGTAGAGGG - Intronic
1167866925 19:52336394-52336416 CTGAATTTACACGGGGTGGAGGG - Exonic
1167870990 19:52370082-52370104 CTGAGTTTAGTCGGGGTGGAGGG - Intronic
1167874192 19:52398008-52398030 CTGAATTTACTCGGGGTGGAGGG - Intronic
1167921516 19:52786603-52786625 CTCAATTTGCTCTGGGTGAAGGG + Exonic
1167971940 19:53193186-53193208 CTGAATTTACATGGAATGGAGGG + Intronic
1167972503 19:53197250-53197272 CAGAATTTACCTGGGGTGGAGGG - Intergenic
1168165337 19:54543255-54543277 CTGAATTTAGTGGGGGAGGCTGG + Intronic
925674532 2:6346954-6346976 CTGAATTACCTGGAGGTGGAAGG + Intergenic
926671122 2:15577784-15577806 TTGAATTTAATGGGGGTAGAGGG - Intergenic
928100920 2:28437006-28437028 CTGGATTTTCTGGGGGTGGGTGG + Intergenic
929826214 2:45311096-45311118 CTGAGGTTACTCGCGGAGGATGG - Intergenic
934936162 2:98467054-98467076 CTGCTTCTACTCGTGGTGGAAGG + Intronic
936144888 2:109974295-109974317 TTAAATTGACTCGGGGAGGAGGG - Intergenic
936181574 2:110272258-110272280 TTAAATTGACTCGGGGAGGAGGG - Intergenic
936199798 2:110397172-110397194 TTAAATTGACTCGGGGAGGAGGG + Intergenic
936230992 2:110699422-110699444 TTAAATTGACTCGGGGAGGAGGG + Intergenic
938883778 2:135621483-135621505 CTGAATTTTCTCCTGTTGGAAGG - Exonic
940193184 2:151064234-151064256 CTGAATTTTCCCTGGGTGGGAGG + Intergenic
942428234 2:175881747-175881769 CTGGGTCTACTTGGGGTGGAGGG + Intergenic
942846661 2:180434737-180434759 CTGAATTAACTAGGGATTGAGGG - Intergenic
943771802 2:191725653-191725675 CTGAATTAACTCTGTGTGTAAGG - Intergenic
946702784 2:222429280-222429302 CTGAATATACTAAGGGTGGTGGG - Intronic
1170398879 20:15958680-15958702 ATGAATTTGTTGGGGGTGGAGGG - Intronic
1174110981 20:48197629-48197651 CTGAATTTAATCATGGTGGCAGG - Intergenic
1175599805 20:60263993-60264015 CTGAATTTAATGGGGGAGGTTGG + Intergenic
1176179610 20:63743106-63743128 CTGCTTTTACTTGGGGTGGGGGG + Exonic
1178815055 21:35921803-35921825 CTGAGTTGGCACGGGGTGGAGGG - Intronic
1183023255 22:35044188-35044210 ATGAATTTGCTGGGGTTGGAGGG - Intergenic
1184349120 22:43931995-43932017 CTGAAATTCCTCCGTGTGGAAGG + Intronic
952835930 3:37601906-37601928 CTGATTCTACTCATGGTGGAAGG + Intronic
953253773 3:41269244-41269266 GTGAAGTTAATGGGGGTGGATGG - Intronic
953503473 3:43460430-43460452 GTGAACTTTCTTGGGGTGGAAGG + Intronic
960719330 3:120610432-120610454 CTGAATTTCCTGGAGCTGGATGG + Intergenic
961459067 3:127038882-127038904 CTGGATCTGCTCTGGGTGGAGGG - Intergenic
961666949 3:128498466-128498488 CAGAATGCATTCGGGGTGGAGGG - Intergenic
967863714 3:194173067-194173089 CTGACATTCCTGGGGGTGGAGGG + Intergenic
969258933 4:6021675-6021697 TTGAATTTACTTGGGAAGGATGG + Intergenic
975078801 4:70249266-70249288 CTGAATTTTCTTTGGGGGGATGG - Exonic
978860000 4:113437530-113437552 CTGATTTTGCTTGGGTTGGATGG + Intergenic
979029153 4:115618384-115618406 CTGCTTCTACTCAGGGTGGAAGG + Intergenic
980876682 4:138668618-138668640 CAGAAATTAATGGGGGTGGAGGG + Intergenic
985850895 5:2388400-2388422 CTGAATGAATTGGGGGTGGAGGG - Intergenic
985941880 5:3142703-3142725 CTGAAAATCCTTGGGGTGGACGG + Intergenic
987552635 5:19403635-19403657 CTGATGTTCCTGGGGGTGGAAGG + Intergenic
989125433 5:38048184-38048206 CTGAAGTCACTCGAGGAGGAAGG + Intergenic
990565745 5:57026804-57026826 CTGCATTTAATCAGCGTGGAAGG + Intergenic
992367829 5:76111480-76111502 CTGAAAATATTCAGGGTGGAGGG - Intronic
996552229 5:124743196-124743218 CTGCATTTAAACGGTGTGGATGG - Intronic
998200907 5:140119482-140119504 CTGAATTAAATTTGGGTGGAAGG + Exonic
998582603 5:143394922-143394944 ATGAATTAATTGGGGGTGGAGGG - Intronic
1001862496 5:175069752-175069774 CTGATTTTACTCTGTGTGGCAGG - Intergenic
1005029174 6:21493436-21493458 CTGCAATTATGCGGGGTGGAGGG - Intergenic
1005164895 6:22908528-22908550 CAGAATTGACTATGGGTGGAGGG + Intergenic
1009025081 6:57989693-57989715 CTGAATTTATTGGCAGTGGAGGG + Intergenic
1011508004 6:88068592-88068614 CTGAATTGACCCGTGGTGGAAGG - Intergenic
1013338437 6:109189189-109189211 CTGAACTTACTCTGGTTGGGGGG + Intergenic
1015375955 6:132511041-132511063 CAGAACTTACTTGGGGTAGAGGG - Intronic
1020276102 7:6625514-6625536 CTGAATTTTTGGGGGGTGGAGGG - Intergenic
1024945352 7:54802458-54802480 CCAAACTTACTCGGGGTTGAGGG - Intergenic
1026765751 7:73158507-73158529 AGGAATTTACTAGGGGTGGGTGG - Intergenic
1027042225 7:74968204-74968226 AGGAATTTACTAGGGGTGGGTGG - Intronic
1027081417 7:75234154-75234176 AGGAATTTACTAGGGGTGGGTGG + Intergenic
1028747998 7:94349364-94349386 CTGAATTTTTTCGGGGGGTAGGG + Intergenic
1029390004 7:100268743-100268765 AGGAATTTACTAGGGGTGGATGG + Intronic
1031627216 7:124004961-124004983 CTGAGTTAACCTGGGGTGGAAGG - Intergenic
1037440663 8:18912993-18913015 TTGAAATTACTCAGGGTAGATGG - Intronic
1043161441 8:76852606-76852628 CTGAAGCTATTCGGGGTGGTGGG - Exonic
1046201316 8:110931766-110931788 CTGCTTTTACTCATGGTGGAAGG + Intergenic
1053587089 9:39470256-39470278 ATGATTTTTCTCAGGGTGGAGGG - Intergenic
1054579220 9:66894977-66894999 ATGATTTTTCTCAGGGTGGAGGG + Intronic
1055891347 9:81127369-81127391 CTGAACTTACTCTGGTTTGAAGG - Intergenic
1059529886 9:115026160-115026182 CTCAATTTACTCTGGGTGTATGG - Intronic
1062309449 9:135928269-135928291 ATGATTTTACTCGGGCTGGGGGG - Intergenic
1185488493 X:500727-500749 CTGAATAAACTCGGGGTGGGCGG + Intergenic
1192496886 X:71622143-71622165 CTGCCTTAACTGGGGGTGGAGGG + Intergenic
1193533817 X:82688278-82688300 AAGCCTTTACTCGGGGTGGAAGG - Intergenic
1194635717 X:96343062-96343084 CTGAACTGACCTGGGGTGGAAGG - Intergenic
1199693607 X:150328002-150328024 CTGAGGTTACTCGGGGAAGAAGG - Intergenic
1201440483 Y:14003003-14003025 CTGAATTTTCTGTGGGTGGTAGG + Intergenic
1201444088 Y:14039705-14039727 CTGAATTTTCTGTGGGTGGTAGG - Intergenic