ID: 1167874654

View in Genome Browser
Species Human (GRCh38)
Location 19:52401683-52401705
Sequence AGGTTCACAAATTTTAAGAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 376}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167874652_1167874654 13 Left 1167874652 19:52401647-52401669 CCACATGAAGAATTGCTTTTTTT 0: 1
1: 0
2: 5
3: 63
4: 663
Right 1167874654 19:52401683-52401705 AGGTTCACAAATTTTAAGAAAGG 0: 1
1: 0
2: 1
3: 35
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167874654 Original CRISPR AGGTTCACAAATTTTAAGAA AGG Exonic
900723322 1:4194969-4194991 AGGTACACCAATTTTAAAATGGG - Intergenic
900731200 1:4261845-4261867 AGTTTCTCAAGTTTTAAGATAGG + Intergenic
900823611 1:4909117-4909139 AGGCTCACAGAGGTTAAGAAGGG + Intergenic
902069155 1:13718624-13718646 AGGTTAAGAGATATTAAGAAAGG - Intronic
904551372 1:31321928-31321950 TGGTTCACAAGGATTAAGAAGGG + Intronic
906896181 1:49774591-49774613 AGAATCACAAATTTTAAAACTGG - Intronic
907369245 1:53989279-53989301 TGGTTCACTCGTTTTAAGAAGGG + Intergenic
908438563 1:64130972-64130994 CGATTCACAAGTTTTAAAAAGGG + Intronic
908574477 1:65444552-65444574 AGATTAACAAACTTTCAGAAGGG + Intronic
909394210 1:75151338-75151360 AGAGTGCCAAATTTTAAGAAGGG + Intronic
910147608 1:84100962-84100984 AACTTCACAAATTTTTAGAAAGG - Intronic
910806293 1:91192374-91192396 AGGTTCAGAAGGTTTAAGACAGG - Intergenic
911678418 1:100685574-100685596 AGGTTCATCAATTGTAACAAAGG - Intergenic
912024370 1:105148634-105148656 ATGTTCACATATTTTCATAAGGG + Intergenic
912073717 1:105846232-105846254 AGGATGAAAAATTTAAAGAAGGG + Intergenic
912119966 1:106458956-106458978 AGGTTTATAATTTATAAGAATGG - Intergenic
912868033 1:113276669-113276691 AGATTCACAGATTCTGAGAATGG - Intergenic
913307668 1:117449919-117449941 TGGTTCACAAGGTTTAAGGAAGG + Intronic
914510075 1:148324484-148324506 ATGTTAAAAAATTTCAAGAAAGG - Intergenic
916680171 1:167096523-167096545 AGGTTCACCACTTTAAAGCATGG + Intronic
916766367 1:167864290-167864312 ATGTTGAAAAATTTCAAGAAAGG + Intronic
916812808 1:168320286-168320308 AAGTTCACAAATGTGATGAAAGG + Intergenic
916888428 1:169093176-169093198 AGGATCACAGATTTCAAGAAGGG + Intergenic
917476919 1:175376769-175376791 AGCTTAACATAATTTAAGAAGGG - Intronic
918418296 1:184335614-184335636 ATTTTCACAAATTTTTAAAAAGG + Intergenic
918874965 1:190028843-190028865 GGGTTCAGCAATTTTAAGTAGGG - Intergenic
919197830 1:194311701-194311723 AGGTTCACCAACATTATGAATGG - Intergenic
923121209 1:230993394-230993416 ATCTTTAGAAATTTTAAGAAGGG - Intronic
923256191 1:232223558-232223580 AGGTTCATAAATTTAGAAAAGGG - Intergenic
924763510 1:247010333-247010355 AGCTTCACCCCTTTTAAGAATGG + Intergenic
1062785765 10:263409-263431 AGTTTCTCAAGTTTTAAGACTGG + Intergenic
1063307300 10:4916596-4916618 AGGTTCTCACATTTCAGGAAGGG - Intergenic
1063510684 10:6642588-6642610 AGGTTGACAAAGTTTAATTACGG - Intergenic
1063683491 10:8212906-8212928 AGATGCAGAAATTTTAAAAATGG - Intergenic
1065388033 10:25153093-25153115 AACTTAACAAATTTTATGAAAGG - Intergenic
1065457705 10:25924644-25924666 AAGTTCAGAAATGTTAAGGACGG - Intergenic
1067722467 10:48739341-48739363 GGGTTGACACATTTCAAGAAAGG - Intronic
1068249242 10:54415504-54415526 AGATTCTCAAATTTTAGCAATGG + Intronic
1071377727 10:85026368-85026390 ATGTTCACAGACTTTAAAAATGG + Intergenic
1071409764 10:85377657-85377679 AGGTTCACACATTTTCGGTAAGG + Intergenic
1073954573 10:108855080-108855102 AATTTAACAAATTTTAAGAAAGG - Intergenic
1074471086 10:113727529-113727551 AACTTCACAAGTTTTAAGGATGG + Intronic
1077589573 11:3481105-3481127 ATGTTGAAAAATTTTAAGAGAGG - Intergenic
1078033442 11:7777891-7777913 AGATGCACAAATTTTAATGAAGG - Intergenic
1079330455 11:19528624-19528646 TGGTTCCCATTTTTTAAGAATGG + Intronic
1079570731 11:21940607-21940629 AGTTTCTCAAGTTTTAAGACTGG - Intergenic
1079641229 11:22807982-22808004 ACTTTCTCAAATTTTAAGACTGG + Intronic
1079641474 11:22810410-22810432 ATTTTCCCAAATTTTAAGACTGG + Intronic
1080277387 11:30517869-30517891 AGGAACTTAAATTTTAAGAAGGG - Intronic
1081173383 11:39894920-39894942 AGGTTCAGAAATTATAAAATTGG + Intergenic
1081466661 11:43325384-43325406 TGGATCACTCATTTTAAGAAGGG + Intronic
1081792383 11:45797360-45797382 AGGGTCACACAGTTTATGAAAGG - Intergenic
1081800876 11:45858544-45858566 AGGTTCAGAAAGTTTGAGGAGGG - Intronic
1081943406 11:46965022-46965044 GAGTGCACAAATTTTAAGACTGG + Intronic
1082961566 11:58923017-58923039 ACGTTAAAAAATTTTAAGAAAGG - Intronic
1083089648 11:60186476-60186498 ATGTTGAAAAATTTCAAGAAAGG + Intergenic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1084245295 11:67852879-67852901 ATGTTGAAAAATTTTAAGAAAGG - Intergenic
1084827392 11:71741699-71741721 ATGTTGAAAAATTTTAAGAAAGG + Intergenic
1085166761 11:74408260-74408282 AGGTTCAAAATTTTCAAGATTGG + Intergenic
1086213367 11:84347931-84347953 AAGATCACAAATTGTCAGAATGG - Intronic
1086789185 11:91014315-91014337 AGGTTCACAAATGTTTATAATGG + Intergenic
1086973685 11:93109810-93109832 ATGTTGAAAAATTTCAAGAAAGG - Intergenic
1087070383 11:94073967-94073989 AGGTTCTCTAAATGTAAGAAAGG + Intronic
1087857401 11:103109078-103109100 AGGTACACATCTGTTAAGAAGGG - Intergenic
1087894561 11:103573079-103573101 ATGTTGAAAAATTTCAAGAAAGG + Intergenic
1087994436 11:104786047-104786069 GGGTTAACAAATGATAAGAAGGG + Intergenic
1088457274 11:110045951-110045973 AGGTTCATAAGTTGTAACAAAGG + Intergenic
1091814776 12:3429366-3429388 ATGTTGAAAAATTTCAAGAAAGG - Intronic
1092415864 12:8290011-8290033 ATGTTGAAAAATTTTAAGAAAGG - Intergenic
1093367993 12:18327721-18327743 AATTTCAGAAATATTAAGAATGG + Intronic
1093368563 12:18335416-18335438 CATTACACAAATTTTAAGAAAGG - Intronic
1094117721 12:26935708-26935730 ATGCACACAAATTTTAAGAAGGG + Intronic
1094133593 12:27100796-27100818 TGGTATAGAAATTTTAAGAATGG + Intergenic
1094675303 12:32613963-32613985 TGGGTAACTAATTTTAAGAAGGG + Intronic
1095248694 12:39953417-39953439 AGGTTCATAATTTTAATGAAAGG - Intronic
1095636502 12:44440525-44440547 AGGTTCATAAGTTTGAACAAAGG + Intergenic
1095699711 12:45178403-45178425 AGCTTCTCAAATCTTAGGAAGGG + Intergenic
1097539849 12:60927134-60927156 AGCTTCACAAATAGAAAGAAGGG + Intergenic
1097958137 12:65507122-65507144 AGGCTCTCAAATCCTAAGAAGGG - Intergenic
1098639603 12:72823574-72823596 ATGTTGAAAAATTTCAAGAAAGG - Intergenic
1099066016 12:77980205-77980227 AGTTTCTCAAGTTTTAAGACTGG + Intronic
1099467978 12:83010273-83010295 AGATAAACAAGTTTTAAGAATGG - Intronic
1099785715 12:87260827-87260849 AGGTTCATCAATTTTAAATATGG - Intergenic
1100188760 12:92167407-92167429 AGTTTGTCAAATTTTAAGATAGG + Intergenic
1100846532 12:98664395-98664417 AGTTTCACACATTTTCAAAATGG - Intronic
1101017226 12:100514272-100514294 AGATTCACAGAATTTAAGGAAGG - Intronic
1103502067 12:121410611-121410633 AAGTTCAGAAATTTGAAGCAGGG - Intronic
1103992473 12:124808349-124808371 AGGGTCACAGATTTTCAGCAGGG - Intronic
1107491082 13:40880301-40880323 ATGTTAAAAAATTTTAAGTAGGG - Intergenic
1108050264 13:46428052-46428074 AGGTTCATCAATTATAACAAAGG - Intronic
1109108891 13:58291291-58291313 AGATTCAAAAAATTAAAGAAGGG - Intergenic
1109386040 13:61630023-61630045 AGATTAACAAAATTTCAGAAGGG - Intergenic
1109531045 13:63648136-63648158 GGGATCACAAATTTGAAGGATGG - Intergenic
1109542788 13:63801371-63801393 AGGTTCATCAATTATAACAAAGG - Intergenic
1110036851 13:70698063-70698085 AGGGTCATTAATTGTAAGAAAGG + Intergenic
1110098870 13:71570291-71570313 AAGTAAACACATTTTAAGAAAGG - Intronic
1110903141 13:80849462-80849484 AAGTTCCCAATTTTTAAAAATGG - Intergenic
1110929523 13:81197146-81197168 AGGTAGAAAAATTTTTAGAATGG + Intergenic
1111007171 13:82263037-82263059 ATGCTGAAAAATTTTAAGAAGGG - Intergenic
1111201613 13:84945234-84945256 AGCTTCTCAAATTTTAAGACTGG + Intergenic
1111270835 13:85882579-85882601 AGGTTCTCAAATTTTTATTAAGG + Intergenic
1111272250 13:85902001-85902023 AGCATTACAAATTTTAAAAATGG - Intergenic
1111642809 13:90992526-90992548 AGGTTCACTAAATATAAGCATGG + Intergenic
1114819372 14:25998563-25998585 AGGATAACACATTTTAAGAAGGG + Intergenic
1114938220 14:27572272-27572294 AGTGTCATAAATTTTAAGGAAGG - Intergenic
1115571959 14:34675121-34675143 AGGTTCATCAATTGTAACAAAGG + Intergenic
1116240984 14:42342161-42342183 AAGTTGACAAATTTTAAGGCTGG + Intergenic
1116746458 14:48825289-48825311 AGGTTTTAAAATTTTATGAATGG - Intergenic
1116926271 14:50641195-50641217 AGGTTGACAGTTTCTAAGAAAGG + Intronic
1117100612 14:52342722-52342744 AAGTTTAAAAATTTTAATAAAGG - Intergenic
1117400506 14:55354887-55354909 AGGATCACAGAATTCAAGAAAGG + Intronic
1117767657 14:59099760-59099782 ACTTTCACAAATATCAAGAATGG - Intergenic
1118509914 14:66460586-66460608 AGGTTCACATACTTTAATGAAGG + Intergenic
1123771358 15:23532928-23532950 ATGTTCACAAGCTTTAAAAATGG - Intergenic
1124017620 15:25890844-25890866 AGGCTCATAAATTTGAAGAGTGG + Intergenic
1125532285 15:40421566-40421588 AGGTTGCCAAATTTTGATAAGGG - Intronic
1125596452 15:40890039-40890061 TGGTTCATTAATTTTAACAATGG + Intergenic
1127334618 15:57971429-57971451 ATGTACACAGATTTTAAGACAGG + Intronic
1127876910 15:63119575-63119597 AGTTTCTCAAGTTTTAAGACTGG - Intergenic
1128925630 15:71652637-71652659 ATGTTTACAAATCTGAAGAAAGG - Intronic
1129577407 15:76764961-76764983 AGCTTCAGAAATTGTTAGAAAGG - Exonic
1129931513 15:79414972-79414994 ACAGTCACAAATTTTAACAATGG + Intronic
1130142496 15:81240056-81240078 ATGTTCACAAATAAGAAGAACGG - Intronic
1130239478 15:82173655-82173677 AAGTACACACATTTTAAGAGAGG - Intronic
1130750573 15:86708064-86708086 AGGATGAAAAATATTAAGAATGG - Intronic
1132200103 15:99946103-99946125 AAGTTGACAAATTTTTAGAAAGG - Intergenic
1132358461 15:101191593-101191615 AGGTTCACCAATTGTAACAAAGG + Intronic
1133726843 16:8545788-8545810 AGGTTTGAGAATTTTAAGAAGGG - Intergenic
1134772456 16:16821549-16821571 AGTTTCTCAAGTTTTAAGACTGG + Intergenic
1138888412 16:61109896-61109918 AGTTTCTCAAGTTTTAAGACTGG - Intergenic
1138977227 16:62222172-62222194 AGGCTCACAAAATTTAAGTTTGG - Intergenic
1140755080 16:78059541-78059563 ATGTAGAAAAATTTTAAGAAGGG - Intronic
1140845503 16:78883219-78883241 AAGTTCACAAAGCTTAAGAGGGG - Intronic
1141937524 16:87251412-87251434 AGGTTCTCAAAGCTTATGAAAGG - Intronic
1143827588 17:9624169-9624191 AGTTTAACAAATGCTAAGAAAGG - Intronic
1145060631 17:19731117-19731139 AGATTCAAAAAGTTTAAAAAAGG - Intergenic
1145723313 17:27091661-27091683 AGTTACTCAAATTTTATGAATGG + Intergenic
1145865433 17:28238231-28238253 GTGTTGAAAAATTTTAAGAAGGG - Intergenic
1149363649 17:55919260-55919282 GGTTTCACAAACATTAAGAATGG + Intergenic
1153830145 18:8914695-8914717 ATGTTGAAAAATTTCAAGAAAGG + Intergenic
1155575947 18:27247045-27247067 AGGTTGTCAACTTTTAAAAATGG - Intergenic
1155576139 18:27249006-27249028 AGCTTCAGAAATTTGAGGAAAGG - Intergenic
1156330227 18:36114666-36114688 ATGGTCTCAAATATTAAGAATGG + Intronic
1156531255 18:37818597-37818619 AGGTTCACCAATTGTAACAAAGG + Intergenic
1157751562 18:50183360-50183382 TGTTTCAGAAATTCTAAGAATGG + Intronic
1158139103 18:54238139-54238161 TGGTTCAAAAAGTTAAAGAATGG - Intergenic
1159604275 18:70458630-70458652 AGGAGCACAGATTTTAAAAAAGG - Intergenic
1159845684 18:73457009-73457031 TGGTTCATTAATTTTAAGAAAGG + Intergenic
1163966927 19:20754529-20754551 ATGTTGAAAAATTTTAAGAAGGG - Intronic
1164121806 19:22272541-22272563 ATGTTGAAAAATTTCAAGAAAGG - Intergenic
1164130961 19:22361511-22361533 ATGTTGAAAAATTTCAAGAAAGG - Intergenic
1164217571 19:23163212-23163234 ATGTTGAAAAATTTAAAGAAAGG - Intergenic
1164687284 19:30175645-30175667 ATGATCAGAAATGTTAAGAATGG - Intergenic
1167872871 19:52388173-52388195 TGGCCCATAAATTTTAAGAATGG + Intergenic
1167874654 19:52401683-52401705 AGGTTCACAAATTTTAAGAAAGG + Exonic
1167929956 19:52856005-52856027 TGCTTCTCTAATTTTAAGAATGG - Intronic
924976616 2:182037-182059 ATGTTCACAGGTTTTAAAAATGG + Intergenic
925792228 2:7502239-7502261 AACTTCACAGATTTTGAGAATGG - Intergenic
926850330 2:17190126-17190148 AGTTTCACAGAGTTTAAAAAGGG + Intergenic
927626010 2:24719379-24719401 AGTTCAACAAATTTTGAGAAAGG - Intronic
928241922 2:29593919-29593941 AAGTTCGCATATTTTAATAATGG - Intronic
928709919 2:33992428-33992450 ATGTTTACAAACTTTAATAAGGG + Intergenic
928840110 2:35595763-35595785 ACTTTCATAAATTTTAAGATTGG + Intergenic
929373547 2:41256239-41256261 TGGTTAACAATTTTTCAGAAGGG + Intergenic
929478156 2:42274572-42274594 TCGTTCACAAATTGTAACAAAGG - Intronic
930000567 2:46858934-46858956 AGGTTCACAATGCTTAAGGAGGG - Intronic
931938558 2:67226233-67226255 ATGTTGACAAAATTTAAGATTGG - Intergenic
932542986 2:72676156-72676178 AGGTTTTCAACTTTTGAGAAGGG + Intronic
933228091 2:79774053-79774075 AGGTTCACAGATTCTGAGAGAGG - Intronic
933751583 2:85605677-85605699 AGGCTCACAAATTTAAATGAGGG - Intronic
933936046 2:87204556-87204578 ATGTTGAAAAATTTCAAGAAAGG - Intergenic
935721678 2:105985280-105985302 ATGTTGAAAAATTTCAAGAAAGG - Intergenic
935744964 2:106182502-106182524 AGCTTAAAAAATTTTAATAATGG + Intronic
936357102 2:111761273-111761295 ATGTTGAAAAATTTCAAGAAAGG + Intergenic
937114391 2:119394112-119394134 AGGCACCCAAATTGTAAGAAAGG + Intergenic
937819218 2:126288990-126289012 AGATACGGAAATTTTAAGAAAGG + Intergenic
939303093 2:140372886-140372908 ATGTTTACCATTTTTAAGAAAGG - Intronic
940065312 2:149621145-149621167 AAGTTCATATATTTTAAGGAAGG + Intergenic
940563144 2:155327066-155327088 ATGTTCAAAAAGTTTAACAAGGG - Intergenic
941106234 2:161357203-161357225 AGGTTTACAAATTTTAAATGTGG - Intronic
941631095 2:167885039-167885061 AAATTCACATATTTTAAAAATGG - Intergenic
941644040 2:168020781-168020803 AAGTTTACAAATTTAATGAATGG + Intronic
941868069 2:170355219-170355241 AGGTGCACACATTTTATGCAAGG - Intronic
942077423 2:172368893-172368915 GGGCTCAAAAATTTTCAGAATGG - Intergenic
943257937 2:185620314-185620336 AGTTTCTCAAGTTTTAAGACTGG - Intergenic
943407858 2:187511525-187511547 ATGTTGAAAAATTTCAAGAAAGG + Intronic
943419038 2:187644825-187644847 AGGCTCAGAAAAATTAAGAAAGG + Intergenic
944027208 2:195184781-195184803 AGGGTCATCAATTTTAGGAAGGG + Intergenic
945139844 2:206673201-206673223 ATGTTCAGAAATTTTAAAAAGGG - Intronic
945438082 2:209842705-209842727 AAGTTCTCAGATTTTAATAAAGG - Intronic
946711994 2:222516068-222516090 AAGTTCACACATTTTAACATAGG + Intronic
947594406 2:231401789-231401811 ATGTTGAAAAATTTTAAGAAGGG + Intergenic
1168961294 20:1871691-1871713 AGGTTCAGAGATTCTAAGTAGGG - Intergenic
1170928701 20:20748870-20748892 ACTTTCTCAAATTTTAAGACTGG - Intergenic
1171055863 20:21905448-21905470 AAGTTCCCAAATTTGAAGACAGG + Intergenic
1171407325 20:24920314-24920336 ATGTTGAAAAATTTTAAGAAGGG + Intergenic
1172861516 20:38057414-38057436 AGGGGCACACATTTTCAGAATGG - Intronic
1173943039 20:46928329-46928351 AGGTTCACGAAGCTTAAGAGTGG - Intronic
1174652525 20:52139773-52139795 AGTTTCACAAATTGTAATACAGG + Intronic
1175473578 20:59252345-59252367 AGGATCACAAAATTTCAGAGAGG - Intronic
1176694830 21:9962746-9962768 TGGCTCTCAAATATTAAGAAAGG + Intergenic
1177546995 21:22571572-22571594 AGGATTACAAATCTTAAAAATGG + Intergenic
1181335847 22:22127696-22127718 AGGTTCAGTAATATTAAGATTGG + Intergenic
1184702015 22:46181537-46181559 ATGTTAAAGAATTTTAAGAAAGG + Intronic
949234557 3:1792837-1792859 GGGTTCACAATATGTAAGAACGG + Intergenic
949386235 3:3505355-3505377 GGTTTCACAAATTTTGAAAAAGG + Intergenic
949477269 3:4460113-4460135 AGGTGCACAAATGCTAAGTATGG + Intronic
950598593 3:14009599-14009621 TGGATAACTAATTTTAAGAAGGG - Intronic
951053126 3:18117292-18117314 TGGTTAAGAGATTTTAAGAAAGG - Intronic
951697392 3:25459988-25460010 GAGTTCACAAAATATAAGAACGG - Intronic
951875658 3:27421919-27421941 ATTTTCACAAATATAAAGAATGG + Intronic
952045345 3:29312142-29312164 ATGTTCACAAAGTTTAGGAAAGG - Intronic
953089723 3:39712993-39713015 ACTTTCTCAAGTTTTAAGAATGG + Intergenic
954428479 3:50456338-50456360 AGGCTCACACATTTCAAGGATGG + Intronic
957617107 3:82543960-82543982 AGTTTTACATATTCTAAGAAAGG + Intergenic
959930410 3:111975865-111975887 AGGCTGACAAAGTTTAATAAAGG - Exonic
960348296 3:116562175-116562197 AGTTTCACACATCTAAAGAAAGG + Intronic
960686639 3:120301130-120301152 AGCTACACAAATTTTATCAATGG - Intergenic
961716149 3:128858825-128858847 ATGTTAAAGAATTTTAAGAAAGG - Intergenic
961893414 3:130148624-130148646 ATGTTGAAAAATTTTAAGAAAGG - Intergenic
962096943 3:132302368-132302390 ATGTTGAAAAATTTCAAGAAAGG - Intergenic
962224201 3:133591574-133591596 ATGTTCAAGAATTTTAAGAGTGG - Intergenic
962383452 3:134914713-134914735 AGGTTCACAGAGTTAAAGACAGG + Intronic
963094251 3:141518669-141518691 ATGTTGGCAAATTTCAAGAAAGG - Intronic
963491402 3:146006214-146006236 AGGATCAAAAATTTTAATGAAGG - Intergenic
963845842 3:150157212-150157234 AGGTTTACCAATTGTAACAAAGG + Intergenic
964132180 3:153301911-153301933 ACATTCATAAATTTTAAGATTGG + Intergenic
964248772 3:154685327-154685349 AGGTACAGAAATTTGGAGAAGGG + Intergenic
964329749 3:155589367-155589389 GGGTTCTGAAATTTTAATAAAGG - Intronic
964542509 3:157795256-157795278 AGATCCACAAATTTTAATTAAGG - Intergenic
965379795 3:167974254-167974276 GTGATCCCAAATTTTAAGAAGGG - Intergenic
965398774 3:168193439-168193461 GTGTTAACAAATTTTAAAAATGG - Intergenic
967680830 3:192361987-192362009 AGGTTCACAAATTTAAAAAACGG - Intronic
969749350 4:9098501-9098523 ATGTTGAAAAATTTTAAGAAAGG + Intergenic
969856471 4:10003703-10003725 AGGTTCACAAATCTCAAGCTTGG - Intronic
970138912 4:12958455-12958477 AGGCTTACACATTGTAAGAAAGG - Intergenic
970504492 4:16713667-16713689 AGGTTAAGAAATTTTCTGAAGGG + Intronic
970803395 4:20003344-20003366 AGGTGCAAGAATTTTAAGAAAGG - Intergenic
971384023 4:26126630-26126652 AGGTTCTCAAAATCAAAGAAAGG - Intergenic
971780705 4:31030781-31030803 ATGTTCACCAATCTGAAGAATGG - Intronic
971943440 4:33244530-33244552 AGCTTCAAACATTTTACGAAGGG + Intergenic
972030191 4:34446166-34446188 AATTTCTTAAATTTTAAGAATGG + Intergenic
972274864 4:37547468-37547490 ATGTTGAAAAATTTCAAGAAAGG + Intronic
973216002 4:47670104-47670126 AGGTTCAGAAATAGAAAGAATGG - Intronic
974928806 4:68336834-68336856 AGATTTACATATTTTAGGAAAGG - Intronic
975574508 4:75849485-75849507 GAGTTCACAAATATTAATAAGGG - Intergenic
975606726 4:76162428-76162450 AGCTGCAGAAAATTTAAGAAGGG + Intronic
975773574 4:77758210-77758232 AGTTTCACTAATTTTGACAAAGG - Intronic
976112927 4:81696048-81696070 GGGTTCCCAAATTATAGGAATGG + Intronic
976157891 4:82167280-82167302 AGATGCACATATTTTATGAAGGG + Intergenic
976507897 4:85870793-85870815 ATGTTCAGAAATATCAAGAAGGG + Intronic
976532517 4:86171259-86171281 AGGTTCATTAATTTTTTGAAGGG - Intronic
976994587 4:91414459-91414481 AAATTCACAAATTTAAAGGAAGG + Intronic
977322718 4:95539158-95539180 GGGTTCATAAATGTGAAGAAAGG + Intronic
977535077 4:98248222-98248244 GTGTTCACAAATTTTAGTAAGGG + Intergenic
977972127 4:103224670-103224692 ATGTTGAAAAATTTCAAGAAAGG + Intergenic
978737607 4:112101915-112101937 AGAGTCTAAAATTTTAAGAAAGG + Intergenic
979089171 4:116457112-116457134 AGATTTAAAAATTTTAAAAAAGG - Intergenic
979326902 4:119390843-119390865 AGTTTCTCAAATTTTCAGTATGG - Intergenic
980233783 4:130077879-130077901 AGGTTTACAAATTATAAAATAGG - Intergenic
982196571 4:152922042-152922064 GGGTTCACTAATTTTTTGAAGGG - Intergenic
983244774 4:165275534-165275556 AGTTTCTCAAATTTTCAGTATGG - Intronic
983604103 4:169566093-169566115 TAGTTCACAAATTTTGAGAATGG - Intronic
983936504 4:173506512-173506534 ATCTTCACAAACTGTAAGAAGGG - Intergenic
984480755 4:180298355-180298377 AGGTTCCCAAATTTTGACATTGG + Intergenic
985060864 4:186076914-186076936 AGGTTCAAAACTTTTAACATGGG - Exonic
986045469 5:4032986-4033008 ATGTTCACAGATCTTAAGTATGG + Intergenic
987159711 5:15129319-15129341 ACGTACACAAATTAGAAGAAAGG - Intergenic
987432368 5:17851578-17851600 AGATTCATAAATTTTAGCAAAGG - Intergenic
988104159 5:26722020-26722042 AGGTTTACAAATCTTGTGAATGG - Intergenic
988729744 5:33960027-33960049 CGGTTTACAAAATTTAAAAACGG - Intronic
988851174 5:35182729-35182751 AAGTTCACAGAATCTAAGAAGGG + Intronic
989578632 5:43011608-43011630 AGGTTCAAAAATTTTATGATTGG + Intergenic
990906501 5:60809073-60809095 ATGTTGACAATTTTTGAGAATGG + Intronic
991460041 5:66848511-66848533 AGGTTAAAAAATTATAATAACGG - Intronic
991563305 5:67977980-67978002 AGTTTCACCAATTATTAGAAGGG - Intergenic
991936441 5:71806257-71806279 ATGTCCACAACATTTAAGAAAGG + Intergenic
992058482 5:73017726-73017748 AAGTTATTAAATTTTAAGAAAGG - Intronic
992161670 5:74010127-74010149 AGTTTCACAAGTTTTCAGTAGGG - Intergenic
992852787 5:80828029-80828051 AGGTTCATCAATTGTAAGAAAGG - Intronic
993136550 5:83974045-83974067 CGATTTACAAATTGTAAGAATGG - Intronic
993342691 5:86743559-86743581 AGGTTATCAGATTTTAACAATGG - Intergenic
993617407 5:90130631-90130653 AGCTTCACAGATTTTTAGATGGG + Intergenic
993640984 5:90405188-90405210 AGGTTGACAAAGTTTATGAGAGG - Intronic
994201573 5:96982819-96982841 AAGTACACAAATTTTAAGTGTGG + Intronic
994940273 5:106314773-106314795 TGGATCACTCATTTTAAGAAGGG - Intergenic
994976177 5:106810049-106810071 AGTTTCCCAGATTTTAACAAAGG - Intergenic
995356821 5:111247448-111247470 AATTTCATAAAATTTAAGAATGG + Intronic
996430804 5:123374432-123374454 AGTTTCAAAAATTTTTAAAAAGG + Intronic
996880455 5:128290845-128290867 TGCTTCACAAATTTTGAAAATGG - Exonic
997150807 5:131492896-131492918 AGGTAAACAAAATTGAAGAAGGG + Intronic
1000236598 5:159367228-159367250 ATGTTGAAAAATTTCAAGAAAGG + Intergenic
1002874124 6:1196279-1196301 AGTCTGAAAAATTTTAAGAAAGG + Intergenic
1002980659 6:2133543-2133565 ACCTGCACATATTTTAAGAACGG - Intronic
1002999356 6:2317041-2317063 ATGTTCAGAAATTTCAAGAAAGG - Intergenic
1005686350 6:28256481-28256503 ATTTTGAGAAATTTTAAGAAAGG + Intergenic
1005727210 6:28661320-28661342 TGGTTCAAAAATTATAAAAAAGG + Intergenic
1006453114 6:34116703-34116725 ACGTACACAAATGTTAAGAGTGG + Intronic
1006570537 6:34999533-34999555 ATGTTGAAAAATTTCAAGAAAGG + Intronic
1007189082 6:39998193-39998215 ATGTTAAATAATTTTAAGAAAGG - Intergenic
1007744138 6:44032467-44032489 AGGATCAAAGATTTAAAGAAAGG + Intergenic
1008338562 6:50336534-50336556 AGGTTGAGAGATTTTGAGAAAGG + Intergenic
1008706115 6:54161608-54161630 AGTGTCCCATATTTTAAGAAAGG - Intronic
1009358115 6:62777527-62777549 AAGTTCACTCATTTTCAGAATGG + Intergenic
1009494021 6:64327380-64327402 ATGCTGAAAAATTTTAAGAAAGG + Intronic
1009552685 6:65119601-65119623 AGGCTAAGAAATTTTAAAAATGG - Intronic
1010107220 6:72183598-72183620 CTGTTCACAAATTGTGAGAAAGG - Intronic
1010381720 6:75232972-75232994 AAGTTCAAAAATTTCAAGGAAGG - Intergenic
1010739926 6:79489240-79489262 AAGTTCACAAATTATAGAAAAGG + Intronic
1011490065 6:87882516-87882538 ACTTTCTCAAATTTTAAGACTGG + Intergenic
1011583022 6:88892627-88892649 AGGTTTAAAAATTTCCAGAAGGG - Intronic
1011869608 6:91876314-91876336 AGATTCTGAAATTATAAGAAAGG + Intergenic
1012044719 6:94257660-94257682 AGGCCAAAAAATTTTAAGAATGG - Intergenic
1012071712 6:94628235-94628257 ATGTTAAGAAATTTTAATAAAGG + Intergenic
1012339561 6:98103167-98103189 AGATTCACAAATATTAATAGTGG - Intergenic
1012866277 6:104622250-104622272 AGGTTCACATATATTCAGGAGGG + Intergenic
1012931239 6:105319292-105319314 AAGTACTCATATTTTAAGAAGGG - Intronic
1013068407 6:106705647-106705669 AGTTTCTCAAGTTTTAAGATTGG + Intergenic
1013089767 6:106889619-106889641 AGGTTCACAATTGTGATGAAAGG - Intergenic
1013294931 6:108750657-108750679 AGCTTCACATATTTTTATAAGGG + Intergenic
1016492074 6:144616796-144616818 AGGCTCACAATTTATAAGAGCGG - Intronic
1017934509 6:158993070-158993092 AGGTTTAGAAATGTTTAGAATGG + Intronic
1019939462 7:4277725-4277747 AGGGTTATGAATTTTAAGAAGGG - Intergenic
1020323643 7:6958139-6958161 ATGTTGAAAAATTTTAAGAAAGG - Intergenic
1020436473 7:8167845-8167867 AGGTTCAGAAATCCTAAGGAAGG - Intronic
1020602670 7:10295334-10295356 AGGGTCACTACTCTTAAGAAAGG - Intergenic
1020991627 7:15204053-15204075 AGAGTCACATATTTTTAGAAGGG - Intronic
1022738865 7:33102149-33102171 GGTTTCACAAGTTTAAAGAAGGG + Intronic
1023558934 7:41452224-41452246 AGGTTAACAAATAATAATAATGG - Intergenic
1024862714 7:53864177-53864199 AAGATGACAAATTTTAAGACTGG + Intergenic
1025270854 7:57513614-57513636 AAGTTCTTAAATTTTAGGAATGG - Intergenic
1026107382 7:67432018-67432040 AGGCTCACATATTCTGAGAAGGG - Intergenic
1026713874 7:72768850-72768872 TGATTCACAAACTCTAAGAATGG + Intronic
1027602797 7:80260158-80260180 AGGCTCACAAAATTTACGATGGG + Intergenic
1028103696 7:86852065-86852087 AGGGTCACACACTTTAAAAATGG + Intronic
1028153770 7:87406505-87406527 AAGTCCACAAACTATAAGAAGGG + Exonic
1028608565 7:92682436-92682458 AGGTTCACAGGAATTAAGAATGG - Intronic
1030275714 7:107719513-107719535 AGGTTAACATAATTTGAGAATGG + Intergenic
1030879757 7:114863192-114863214 AGATACATAGATTTTAAGAAAGG - Intergenic
1031322124 7:120344068-120344090 AGGTTCAAAATTGTTAAGAAAGG + Intronic
1031416387 7:121501512-121501534 ATGTTCACACATTTTCAGAACGG - Intergenic
1031487069 7:122339913-122339935 GGACTCCCAAATTTTAAGAAAGG - Intronic
1031518423 7:122731206-122731228 TTGTTCACAACTTTTCAGAAAGG - Intronic
1031607369 7:123785566-123785588 AGTTTCACCATCTTTAAGAATGG + Intergenic
1032359630 7:131243373-131243395 AGGTTCACACATTATTACAAAGG - Intronic
1033109950 7:138564828-138564850 ATGTTAAAGAATTTTAAGAAAGG - Intronic
1033184346 7:139213139-139213161 AGGTTGACACATTGTAAAAATGG - Intergenic
1036372421 8:8172844-8172866 ATGATGAAAAATTTTAAGAAAGG + Intergenic
1036512021 8:9409414-9409436 AGGCTCAGAAAATTTAAGCAAGG + Intergenic
1036539498 8:9691057-9691079 AGGGTGTCACATTTTAAGAAGGG + Intronic
1036798918 8:11775243-11775265 AGGTGCACAGAAGTTAAGAATGG - Intronic
1036817203 8:11911021-11911043 ATGTTGAAAAATTTTAAGAAGGG - Intergenic
1036878482 8:12492797-12492819 ATGATGAAAAATTTTAAGAAAGG - Intergenic
1037122493 8:15305631-15305653 GGGTTTAAAAGTTTTAAGAATGG + Intergenic
1038053561 8:23836537-23836559 ATGTACACAAATTTAAAAAAAGG + Intergenic
1038798536 8:30729666-30729688 ATGTTGAAAAATTTTAAGAAGGG + Intergenic
1039714159 8:40090274-40090296 TGTTTCAGAAAGTTTAAGAATGG + Intergenic
1039723856 8:40193962-40193984 AGTTGAACAAATTTTAAGAGTGG + Intergenic
1040036822 8:42878518-42878540 AGCTTCACAAAATTGAAGAGAGG - Intronic
1040320135 8:46289197-46289219 CCCTTCACAAATTTTACGAAAGG + Intergenic
1041799019 8:61778126-61778148 ATGTTCACAAATTATAAGGCAGG + Intergenic
1041854826 8:62439298-62439320 CAGTTTACAAATTTTAAGAGAGG + Intronic
1041870976 8:62634129-62634151 AGTTTCTCAAGTTTTAAGATGGG - Intronic
1044883375 8:96747393-96747415 ATGTGAACAAATTTTGAGAAAGG + Intronic
1045890231 8:107147244-107147266 AGTTTCTCAAATTCTTAGAAGGG - Intergenic
1045970733 8:108077063-108077085 AGGTACAGAGATTTTTAGAAAGG - Intronic
1046064930 8:109185175-109185197 TTGTTCACATATTTTAGGAATGG - Intergenic
1046090623 8:109499088-109499110 AGGTTCTTCAATTTTAAAAAGGG - Intronic
1046672946 8:117077579-117077601 AGTTTCAGAGATTTTAAGATAGG - Intronic
1047173827 8:122521619-122521641 AGAGTCAGAAAGTTTAAGAAAGG + Intergenic
1047365275 8:124205574-124205596 AGGAGCACAAATTTTCAGTAAGG - Intergenic
1048068254 8:130994275-130994297 TGGATCACTCATTTTAAGAAAGG - Intronic
1048148261 8:131867103-131867125 ATGTACATAAATTTTAACAATGG + Intergenic
1049195215 8:141311977-141311999 TGCTTCACAGCTTTTAAGAAGGG + Intergenic
1050384155 9:5067847-5067869 AGGTTTACAATTATTAAGAAAGG + Intronic
1051621621 9:19055813-19055835 AAGATGACAAATTTTAAGACTGG - Exonic
1052332936 9:27289036-27289058 TGGTTCATAAATTGTAACAAAGG + Intronic
1052456199 9:28701312-28701334 AGCTTCACAAAGATTAAAAATGG - Intergenic
1052522736 9:29570265-29570287 AGGTTTAGAAATTTGAAGGAAGG - Intergenic
1052531986 9:29697544-29697566 AGATTTAGAAATTTTAAAAATGG + Intergenic
1053631801 9:39948687-39948709 TGGCTCTCAAATATTAAGAAAGG + Intergenic
1053773959 9:41514842-41514864 TGGCTCTCAAATATTAAGAAAGG - Intergenic
1054212086 9:62302011-62302033 TGGCTCTCAAATATTAAGAAAGG - Intergenic
1054312898 9:63546819-63546841 TGGCTCTCAAATATTAAGAAAGG + Intergenic
1055658043 9:78471979-78472001 AAGTTCACAAACATTGAGAAAGG + Intergenic
1056735030 9:89202021-89202043 AGGTTTAAAAATTTTCACAATGG - Intergenic
1058092540 9:100821726-100821748 AGGTTAACAAATTTGGTGAAGGG - Intergenic
1203372206 Un_KI270442v1:318414-318436 AGATTAACAAATTTTAACAGAGG + Intergenic
1185949844 X:4420819-4420841 AGCTGAGCAAATTTTAAGAATGG - Intergenic
1186059947 X:5693993-5694015 ACTTGCACAAATTTTAAAAAAGG - Intergenic
1186387686 X:9126634-9126656 AGGAGCACAAACTTGAAGAAAGG - Intronic
1186558799 X:10588964-10588986 ATGTTGAAAAATTTCAAGAAAGG - Intronic
1186719053 X:12282859-12282881 AGGTCCAGAAATTTCCAGAAAGG + Intronic
1188858885 X:35232356-35232378 AGTTTCTCAAGTTTTAAGACCGG + Intergenic
1189502400 X:41575344-41575366 AAGTTCACAAATTCTAGGGAAGG + Intronic
1190153359 X:47966962-47966984 AGGTGCACAAAATCCAAGAATGG + Intronic
1190770963 X:53513712-53513734 ATGTTGAAAAATTTCAAGAAAGG + Intergenic
1191918218 X:66225230-66225252 ATGTTGAAAAATTTCAAGAAAGG - Intronic
1192172738 X:68867093-68867115 AGTTTCACAAACTGTAAAAAGGG + Intergenic
1193717095 X:84945724-84945746 ATGTTGAAAAATTTCAAGAAAGG + Intergenic
1193842948 X:86431228-86431250 AGGCTCACAAAATTTATGTAAGG - Intronic
1194399955 X:93430751-93430773 ATGTTGAAAAATTTTAAGAAGGG + Intergenic
1196460341 X:115923172-115923194 ATGTTGAAAAATTTCAAGAAAGG - Intergenic
1197992795 X:132335931-132335953 TGGATCACTCATTTTAAGAAGGG + Intergenic
1198054668 X:132981807-132981829 AGGTTCAATAATTTTAACAGGGG + Intergenic
1198501825 X:137257260-137257282 GGGTTCACAAATTTGAAAAAGGG - Intergenic
1199651717 X:149951545-149951567 AGGTTCAGAAATTTTCTGACTGG + Intergenic
1199876240 X:151930675-151930697 AGTTACACAAAGTTTAATAAAGG + Intergenic
1200925090 Y:8647180-8647202 ATGTTGAAAAATTTCAAGAAGGG + Intergenic
1201308050 Y:12568067-12568089 ATGTTCAAAATTTTCAAGAAAGG + Intergenic
1201726292 Y:17155526-17155548 AGGTTGCCAAATTTTACTAAAGG - Intergenic
1202052793 Y:20798173-20798195 ATGTTGAAAAATTTCAAGAAAGG - Intergenic