ID: 1167877490

View in Genome Browser
Species Human (GRCh38)
Location 19:52426512-52426534
Sequence TTCCTCCCGCATCACAGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167877485_1167877490 26 Left 1167877485 19:52426463-52426485 CCCGAAGGCTCAGGAAAACCACC No data
Right 1167877490 19:52426512-52426534 TTCCTCCCGCATCACAGCTGAGG No data
1167877489_1167877490 4 Left 1167877489 19:52426485-52426507 CCAGTTCAGATGCAGTCTGCGTG No data
Right 1167877490 19:52426512-52426534 TTCCTCCCGCATCACAGCTGAGG No data
1167877486_1167877490 25 Left 1167877486 19:52426464-52426486 CCGAAGGCTCAGGAAAACCACCC No data
Right 1167877490 19:52426512-52426534 TTCCTCCCGCATCACAGCTGAGG No data
1167877488_1167877490 5 Left 1167877488 19:52426484-52426506 CCCAGTTCAGATGCAGTCTGCGT No data
Right 1167877490 19:52426512-52426534 TTCCTCCCGCATCACAGCTGAGG No data
1167877487_1167877490 8 Left 1167877487 19:52426481-52426503 CCACCCAGTTCAGATGCAGTCTG No data
Right 1167877490 19:52426512-52426534 TTCCTCCCGCATCACAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167877490 Original CRISPR TTCCTCCCGCATCACAGCTG AGG Intergenic
No off target data available for this crispr