ID: 1167882569

View in Genome Browser
Species Human (GRCh38)
Location 19:52472632-52472654
Sequence CCATGGCATGCTCTATTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 128}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167882566_1167882569 -8 Left 1167882566 19:52472617-52472639 CCTATTTTCCTAAGGCCATGGCA 0: 1
1: 0
2: 0
3: 18
4: 160
Right 1167882569 19:52472632-52472654 CCATGGCATGCTCTATTTTGAGG 0: 1
1: 0
2: 1
3: 6
4: 128
1167882561_1167882569 16 Left 1167882561 19:52472593-52472615 CCCATTACTCTTTTCCATAAAAA 0: 1
1: 0
2: 3
3: 47
4: 528
Right 1167882569 19:52472632-52472654 CCATGGCATGCTCTATTTTGAGG 0: 1
1: 0
2: 1
3: 6
4: 128
1167882560_1167882569 24 Left 1167882560 19:52472585-52472607 CCTAAGAACCCATTACTCTTTTC 0: 1
1: 0
2: 0
3: 20
4: 255
Right 1167882569 19:52472632-52472654 CCATGGCATGCTCTATTTTGAGG 0: 1
1: 0
2: 1
3: 6
4: 128
1167882562_1167882569 15 Left 1167882562 19:52472594-52472616 CCATTACTCTTTTCCATAAAAAT 0: 1
1: 0
2: 2
3: 68
4: 705
Right 1167882569 19:52472632-52472654 CCATGGCATGCTCTATTTTGAGG 0: 1
1: 0
2: 1
3: 6
4: 128
1167882559_1167882569 25 Left 1167882559 19:52472584-52472606 CCCTAAGAACCCATTACTCTTTT 0: 1
1: 0
2: 0
3: 18
4: 280
Right 1167882569 19:52472632-52472654 CCATGGCATGCTCTATTTTGAGG 0: 1
1: 0
2: 1
3: 6
4: 128
1167882563_1167882569 2 Left 1167882563 19:52472607-52472629 CCATAAAAATCCTATTTTCCTAA 0: 1
1: 1
2: 4
3: 54
4: 491
Right 1167882569 19:52472632-52472654 CCATGGCATGCTCTATTTTGAGG 0: 1
1: 0
2: 1
3: 6
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167882569 Original CRISPR CCATGGCATGCTCTATTTTG AGG Intronic
905628837 1:39507402-39507424 GCATTGCATGCTGTATATTGAGG + Intronic
906658106 1:47563434-47563456 CCATGGCATGCTCCAAATGGGGG + Intergenic
908870156 1:68601285-68601307 GCATGGTATGCAATATTTTGAGG + Intergenic
912623703 1:111190777-111190799 ACAGTGCATGCTCTATTTTTTGG - Intronic
917626585 1:176852674-176852696 CCATGCCATGTTCCAATTTGAGG + Intergenic
918117356 1:181508669-181508691 CCTTGGCAGGCTGTATGTTGGGG + Intronic
919879079 1:201890341-201890363 CCATGGCATGCTGAGATTTGGGG - Intronic
923933900 1:238738243-238738265 CCAAGACATATTCTATTTTGTGG - Intergenic
1064235647 10:13571823-13571845 CCATGGCACAAGCTATTTTGGGG + Intergenic
1064876845 10:20004245-20004267 CCATGGCATTAGCTATTATGTGG + Intronic
1066068027 10:31776647-31776669 CCATGGTAGGCTCTATTTGTTGG - Intergenic
1067200819 10:44170473-44170495 CCATTTCATGCTCTTTTCTGGGG - Intergenic
1072732229 10:97853884-97853906 CCATGGGATTCTTTATTTAGAGG + Intronic
1073613133 10:104964560-104964582 CCATGCCAGGCTCTATTCTAAGG - Intronic
1073883521 10:108010338-108010360 TCATGGCATTCACCATTTTGGGG + Intergenic
1075302752 10:121340245-121340267 CCATTGTTTGCTCTAATTTGGGG + Intergenic
1076272647 10:129167915-129167937 ACATGGCAAGCTATATTTTACGG + Intergenic
1076538432 10:131198151-131198173 TCCTGGTATGTTCTATTTTGTGG + Intronic
1076734226 10:132451617-132451639 CCCTGGAATGCTGTGTTTTGGGG - Intergenic
1077669058 11:4141062-4141084 CCATGCCTGGCTATATTTTGTGG + Intergenic
1082772884 11:57222236-57222258 CCATGTCATGGTCTATGGTGTGG - Intergenic
1082959133 11:58902260-58902282 CCATTGCAAGCTCCATTATGTGG + Intronic
1083432301 11:62620381-62620403 CTTTGGCATGCTCTAGTTTGAGG + Intronic
1087153757 11:94881644-94881666 CCATGGCATTCTGTATTATCTGG - Intergenic
1090413859 11:126527448-126527470 AGATGCCATGCTCTGTTTTGAGG + Intronic
1090601090 11:128372219-128372241 CGATGGCATCCTCTAGTTTCTGG - Intergenic
1093101363 12:15033714-15033736 AAATGGCATCCTCAATTTTGGGG - Intergenic
1093934983 12:24990784-24990806 CCATAACATGCTATATTTTTTGG + Intergenic
1099884037 12:88504950-88504972 CCATGACAGGCTCCATTGTGTGG - Intronic
1103788649 12:123453424-123453446 CCTAGGCATGCTCTACTTTCTGG + Intergenic
1106012702 13:25840604-25840626 CACTGGAATGCTCTTTTTTGGGG - Intronic
1107015492 13:35705456-35705478 CCATGTCAGCCTCTATCTTGGGG - Intergenic
1107974278 13:45674725-45674747 CCTTGGCAATCTCTCTTTTGGGG + Intergenic
1108417023 13:50208547-50208569 CCATGACATGTTCTCCTTTGTGG + Intronic
1109260924 13:60144255-60144277 CCATGGCAGGCTCCATCTTTGGG - Intronic
1110252745 13:73398958-73398980 ACATGGCATGCACTGTTTTTCGG - Intergenic
1110676537 13:78252976-78252998 CAATGGAGTGCTCTGTTTTGGGG + Intergenic
1113692673 13:112322769-112322791 CCATGGCATGCCCTGTGCTGGGG + Intergenic
1118786838 14:69053066-69053088 CCATGACTAGCTCTATTTTATGG + Exonic
1121158047 14:91705602-91705624 CCATTACAGGCTCTAGTTTGTGG + Intronic
1124583599 15:30985098-30985120 CCAGGGCATGCTCTTTTTTAAGG - Intronic
1126534112 15:49742116-49742138 CCATTGCAGGCTCTATCTTCTGG + Intergenic
1129537546 15:76326562-76326584 CCATGCCAGGCTATTTTTTGTGG + Intergenic
1135399430 16:22155966-22155988 AAGTGGCATGCTCTATTTTGTGG + Intronic
1139480617 16:67228605-67228627 CCATGCCCTGCTCCATGTTGAGG - Exonic
1140587818 16:76314803-76314825 TGATGGAATGCTCTAATTTGGGG - Intronic
1141855710 16:86680124-86680146 CTGTGGCAGGCACTATTTTGGGG - Intergenic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1143390673 17:6557363-6557385 CCATCTCCTGCTCTCTTTTGGGG - Intergenic
1146131971 17:30285547-30285569 CCAACGCAAGTTCTATTTTGAGG + Intronic
1149554489 17:57563561-57563583 CAATGTCATTCACTATTTTGGGG - Intronic
1157208311 18:45719308-45719330 CCTTGCCATGCTCTTTGTTGAGG - Intergenic
1158568922 18:58580061-58580083 CCATGGAATGCACTGTCTTGTGG + Exonic
1159868629 18:73735520-73735542 CCCAGGCATGCTCTTTTTTCAGG - Intergenic
1161630428 19:5352210-5352232 CCATGGTGTGCTCTCTTCTGTGG - Intergenic
1164703561 19:30303318-30303340 CCATGGCAGGCTCTATGTGATGG + Intronic
1167861990 19:52292392-52292414 TCATGGCGTGCTCTATTTCATGG - Exonic
1167882569 19:52472632-52472654 CCATGGCATGCTCTATTTTGAGG + Intronic
926352228 2:12006451-12006473 GCATGGCTAGCTCCATTTTGTGG + Intergenic
936989310 2:118345712-118345734 CCATAGCAGGCTTTACTTTGGGG + Intergenic
937442737 2:121930792-121930814 CCATGTCAGGCTCTATTTTGGGG + Intergenic
939835291 2:147123002-147123024 CCATAGCATACTCGATTTTCTGG - Intergenic
945736888 2:213611602-213611624 CCATTAAATGCTCTATTTTTAGG + Intronic
945747881 2:213740956-213740978 CTATGGCATGATATATTTTAAGG - Intronic
945829311 2:214764006-214764028 CCATGGCATGTTACTTTTTGTGG - Intronic
947240116 2:227985252-227985274 TCAGAGCATGCTCTATTTAGTGG - Intronic
1171942507 20:31345041-31345063 CCATGACAGGCTCCATTTTCTGG - Intergenic
1174480437 20:50827619-50827641 CCATCTCATCCTTTATTTTGTGG + Intronic
1174719703 20:52798827-52798849 CCAGGGCAAGCTGTCTTTTGGGG + Intergenic
949927157 3:9050475-9050497 TGATGGCATTCTTTATTTTGCGG - Intronic
951230170 3:20169370-20169392 CCTTGGTATTCTCTTTTTTGAGG - Intronic
952563548 3:34626622-34626644 CCATGCCATTCTCTAATTAGTGG - Intergenic
953891300 3:46753535-46753557 CCCTGCCATGCTCTATTGTACGG + Intronic
953896783 3:46809203-46809225 CCCTGCCATGCTCTATTGTACGG + Intronic
954775833 3:53017675-53017697 GCATGGGATGCTTTATTTCGTGG - Intronic
955139005 3:56250265-56250287 CCATGCCATGCTGTATATTATGG + Intronic
962372084 3:134828983-134829005 CCAGGTCATACCCTATTTTGGGG + Intronic
963563636 3:146899982-146900004 CTATGGCATGCTTTCTTTTTAGG + Intergenic
965015543 3:163152709-163152731 CTATCATATGCTCTATTTTGGGG + Intergenic
971601146 4:28593585-28593607 CCAAGGGATGCTCTATTTCTGGG + Intergenic
975986285 4:80203403-80203425 CCATCGCATACTCCTTTTTGTGG - Exonic
978069970 4:104454847-104454869 CCATGGAATGAGCTATCTTGCGG + Intergenic
978959307 4:114656742-114656764 CCAAGGCAGGCTGTATTTGGGGG + Intronic
982823238 4:159970517-159970539 CCAGGGCTTGCTCTAGGTTGTGG + Intergenic
987264787 5:16241935-16241957 CCATGGCAGTCTCCTTTTTGTGG + Intergenic
989126162 5:38054362-38054384 CCATGGCTTGGTCTATCTGGTGG - Intergenic
991531236 5:67617128-67617150 CCTTGGCATGCTCAACTGTGAGG - Intergenic
992201708 5:74391076-74391098 ACATGGGTTGCTGTATTTTGTGG + Intergenic
994832100 5:104797246-104797268 CCATGGCAGGCTGATTTTTGTGG - Intergenic
997594053 5:135094666-135094688 CCATGGAAAGCTCCCTTTTGGGG + Intronic
998823737 5:146080576-146080598 CCCTGGAACGCTCTATTTTTTGG - Exonic
999598738 5:153236124-153236146 CCTTGTCATGCTCTACTTTCAGG - Intergenic
999620658 5:153469627-153469649 CCATAGCATGCTGTCATTTGTGG + Intergenic
1007372580 6:41436248-41436270 CCATGAATTGCTCTATGTTGAGG + Intergenic
1007398099 6:41588647-41588669 CCAGGGCGTGCTCTGTGTTGAGG - Exonic
1007754440 6:44089868-44089890 CCAAGTCATGCGCTCTTTTGGGG + Intergenic
1013419267 6:109951281-109951303 CTTTGCCATGCTCTATGTTGGGG + Intergenic
1014029798 6:116687248-116687270 CCTTGGCTGGCTATATTTTGAGG + Intronic
1014526865 6:122511349-122511371 CCATGGCAAGCTCAAATATGTGG + Intronic
1014596803 6:123353807-123353829 ACATGGTTTGCTCTATTTTGGGG - Intronic
1016280793 6:142416170-142416192 CCATGCCATTCACAATTTTGAGG - Intronic
1016996200 6:149963908-149963930 CCTAGGCATGCACTTTTTTGGGG - Intergenic
1018264173 6:162003720-162003742 CCATGGTAGGCTATATTATGAGG - Intronic
1023542209 7:41277696-41277718 CAATGCCATGATCTATTTTCAGG + Intergenic
1027378003 7:77573591-77573613 CCATGTCATCCCCTATTCTGAGG - Intronic
1029090404 7:98043698-98043720 CCTTCTCATGCTCTGTTTTGGGG - Intergenic
1031978125 7:128106649-128106671 CCATGGCTTGTTCTACCTTGGGG - Intergenic
1032266824 7:130375259-130375281 CCATGGCTTGATTTGTTTTGGGG + Intergenic
1038714303 8:29978150-29978172 CCTTGGTAGGCTCTATGTTGAGG - Intergenic
1041494689 8:58472382-58472404 CTATGCCATACCCTATTTTGGGG + Intergenic
1041791741 8:61703733-61703755 CCCTAGCATGCTTTATTCTGTGG + Intronic
1042954232 8:74231384-74231406 CCATGGCAGGCTATATTTGGGGG - Intergenic
1043417139 8:80062945-80062967 CAAGGTCTTGCTCTATTTTGTGG - Intronic
1043553237 8:81399431-81399453 GCTTGGCCTGCTCTAATTTGTGG - Intergenic
1043648741 8:82559851-82559873 CCATGGCATGCTAAATTGTTAGG - Intergenic
1044151729 8:88785958-88785980 CAATCGCAAGTTCTATTTTGAGG - Intergenic
1048609095 8:136002472-136002494 ACATAGCATGTACTATTTTGGGG + Intergenic
1050551584 9:6753380-6753402 TCATGTCTTGGTCTATTTTGTGG + Intronic
1051402090 9:16694032-16694054 CTATTGAATGCTTTATTTTGGGG + Intronic
1051621900 9:19059039-19059061 TCATTGCATGCTCTATGTTTGGG - Intronic
1052510502 9:29412993-29413015 CTATGGCATACTTTATTCTGTGG + Intergenic
1055422303 9:76157197-76157219 GACTGGCTTGCTCTATTTTGGGG - Intronic
1057353592 9:94318806-94318828 CCCTGGCATGGTCTATGTCGTGG - Exonic
1057654159 9:96938786-96938808 CCCTGGCATGGTCTATGTCGTGG + Exonic
1186678348 X:11844547-11844569 CCCTAACATGCACTATTTTGTGG + Intergenic
1186979330 X:14942126-14942148 AACTGGCATGCTTTATTTTGTGG + Intergenic
1187104359 X:16224697-16224719 CTATAGCATGCCATATTTTGAGG + Intergenic
1187795285 X:22997187-22997209 CCTTTCCATACTCTATTTTGTGG - Intergenic
1188925159 X:36032258-36032280 CAATAGCATTCTCTCTTTTGAGG + Intergenic
1191169674 X:57430343-57430365 CCATGCCATAATTTATTTTGGGG + Intronic
1191989105 X:67013395-67013417 CCTAGGAATGCTATATTTTGTGG - Intergenic
1196570287 X:117258841-117258863 CCTTGGCATGTCCTAGTTTGGGG + Intergenic
1198654965 X:138903818-138903840 GCATAGAATACTCTATTTTGGGG - Intronic
1199680865 X:150223735-150223757 CCATGGCCAGCTCTATTATGAGG + Intergenic
1199915649 X:152337410-152337432 CCATGGGATCCACTATTTTAAGG + Intronic
1201907346 Y:19099363-19099385 CCATGCCATACTCAAGTTTGAGG + Intergenic