ID: 1167887006

View in Genome Browser
Species Human (GRCh38)
Location 19:52508463-52508485
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 6, 1: 3, 2: 3, 3: 19, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167887006_1167887013 19 Left 1167887006 19:52508463-52508485 CCATCTGCAGGAACATCCTATTG 0: 6
1: 3
2: 3
3: 19
4: 200
Right 1167887013 19:52508505-52508527 AGATGATAGTGGACCGAGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 59
1167887006_1167887014 22 Left 1167887006 19:52508463-52508485 CCATCTGCAGGAACATCCTATTG 0: 6
1: 3
2: 3
3: 19
4: 200
Right 1167887014 19:52508508-52508530 TGATAGTGGACCGAGCGCGGTGG 0: 1
1: 0
2: 1
3: 25
4: 271
1167887006_1167887011 8 Left 1167887006 19:52508463-52508485 CCATCTGCAGGAACATCCTATTG 0: 6
1: 3
2: 3
3: 19
4: 200
Right 1167887011 19:52508494-52508516 GGTCCACTATCAGATGATAGTGG 0: 1
1: 0
2: 1
3: 5
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167887006 Original CRISPR CAATAGGATGTTCCTGCAGA TGG (reversed) Intronic
905380193 1:37556467-37556489 CAGAAGGATGTTCCTTCAGGAGG + Intergenic
908732557 1:67241297-67241319 AAACAGGATGTTCCAGCATAAGG - Intronic
910422398 1:87080547-87080569 CAATTTGATGTTCCTGCTGGGGG - Intronic
913973127 1:143431765-143431787 CTATAGGGTAATCCTGCAGAAGG + Intergenic
914067511 1:144257372-144257394 CTATAGGGTAATCCTGCAGAAGG + Intergenic
914111642 1:144708982-144709004 CTATAGGGTAATCCTGCAGAAGG - Intergenic
914904006 1:151729200-151729222 CAATATGATGTTCCTGCTGGTGG + Intronic
917739075 1:177945888-177945910 CATTAGGCTTTTCCTGCAGGAGG - Intronic
917840682 1:178975038-178975060 CAATTTGATGTTCCTGCAGAGGG - Intergenic
919455743 1:197818048-197818070 CAATTTGGTGTTCCTGCAGCAGG - Intergenic
919961256 1:202471875-202471897 CAGAAGGATGTTCCTTCAGGAGG - Intronic
922044160 1:221927657-221927679 CAATTTGGTGTTCCTGCAGTGGG - Intergenic
922482738 1:225950501-225950523 CAGGAGCAGGTTCCTGCAGATGG - Intergenic
922994729 1:229946454-229946476 AAATAGCATGTTCTTCCAGAGGG - Intergenic
1063619456 10:7632300-7632322 CAACAGGATGTGACTGCAAATGG + Intronic
1065241683 10:23711589-23711611 CAATAGGAAATTACTGTAGAAGG + Intronic
1065504066 10:26411545-26411567 CACCAGGATGTCACTGCAGAAGG + Intergenic
1066153847 10:32653574-32653596 CAATTTGATGTTCCTGTGGATGG + Intronic
1068124872 10:52827315-52827337 CAATTTGATGTTCCTGCAGGAGG - Intergenic
1068479632 10:57574211-57574233 CAAAAGAATGTTGCTGTAGATGG - Intergenic
1068818638 10:61347128-61347150 CAATGGCATCTTCATGCAGATGG + Intergenic
1068921323 10:62487727-62487749 TAAAAGGATGTTACTGCAGTTGG + Intronic
1070851180 10:79562614-79562636 GAAGAGGATGTCCCCGCAGAGGG - Intergenic
1070856021 10:79608619-79608641 GAAGAGGATATCCCTGCAGAGGG + Intergenic
1071808563 10:89152414-89152436 CAATAGGATTTTCCTCCTGTGGG - Intergenic
1072623127 10:97093801-97093823 CAAGACGGTGTTTCTGCAGATGG - Intronic
1073732586 10:106307691-106307713 CCATAGGATGTTAGTGCAAAAGG + Intergenic
1074408334 10:113200772-113200794 AAATTTGATGTTCCTGGAGAGGG - Intergenic
1077324964 11:1959696-1959718 AAACAGGCTGTTCCTGCAGAAGG + Intronic
1077711176 11:4538618-4538640 CATAGGGTTGTTCCTGCAGAAGG + Intergenic
1078311891 11:10252108-10252130 AAACAGGATGTTCCAGCATAAGG + Intronic
1078791628 11:14548551-14548573 CAATATGATGTCCCTGAATATGG - Intronic
1080350976 11:31385793-31385815 CAATTTGATGTTCCTGCAGAGGG - Intronic
1082689391 11:56281326-56281348 AAAAAGGATGTTCCAGCATAAGG + Intergenic
1082698293 11:56397881-56397903 AAATAAGATGTTCCAGCACAAGG - Intergenic
1083559202 11:63658836-63658858 TAACAGGATTTTCCTGGAGAGGG - Exonic
1083878070 11:65535156-65535178 CAGGAGGCTGTTCCTGCACAAGG + Intronic
1084448277 11:69217034-69217056 CAATAGCATTTTTCTGCCGACGG + Intergenic
1085450941 11:76632158-76632180 AAATATGATGTTCCTTCTGAGGG - Intergenic
1085625928 11:78072997-78073019 CCAGAGGATTTTCCTGAAGAAGG - Exonic
1085718009 11:78890008-78890030 GAAGAGGAAGTGCCTGCAGATGG + Exonic
1086032964 11:82383007-82383029 AAATTTGATGTTCCTGCAGAAGG - Intergenic
1086277396 11:85147235-85147257 CAATTTGGTGTTCCTGCAGGGGG + Intronic
1086881187 11:92155531-92155553 CATTAGGAAGCTCCTGAAGAAGG + Intergenic
1087226783 11:95610267-95610289 AAACAGGATGTTCCAGCATAAGG - Intergenic
1087473116 11:98601860-98601882 CAATTTGGTGTTCCTGCAGAGGG + Intergenic
1087887445 11:103496929-103496951 AAATTTGATGTTCCAGCAGAGGG - Intergenic
1087956495 11:104294680-104294702 GAGTAAGATGTTTCTGCAGATGG - Intergenic
1088507672 11:110542145-110542167 CCACAGGAAGTTCCTGGAGAAGG + Intergenic
1089236813 11:117035809-117035831 CAGAAGGATGTTCCTTCAGGAGG - Intronic
1089977874 11:122748070-122748092 CAAAAGGAGGATCCTGCAAAAGG + Intronic
1202807946 11_KI270721v1_random:14875-14897 AAACAGGCTGTTCCTGCAGAAGG + Intergenic
1091780518 12:3211675-3211697 CAGAAGGATGTTCCTTCAGGAGG - Intronic
1092989038 12:13877184-13877206 CTATAGGATGGTTCTGCTGATGG + Intronic
1093804202 12:23411863-23411885 CAAATGGGTGCTCCTGCAGAGGG + Intergenic
1095485353 12:42678882-42678904 CAGAAGGATGTTCCTTCAGGAGG - Intergenic
1095879837 12:47121643-47121665 CCTTAGGAAGTTCCTGCTGATGG + Intronic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1097786048 12:63760370-63760392 CAGAAGAATGTTCCTTCAGATGG - Intergenic
1098405551 12:70122677-70122699 AAATTTGATGTTCCTGCAGAGGG - Intergenic
1099101035 12:78440315-78440337 CAATTTGGTGTTCCTGCAGGCGG + Intergenic
1099757810 12:86877119-86877141 CAATTTGATGTTCCTGCAGGAGG + Intergenic
1100293791 12:93241885-93241907 CAACAGGAAGTACCAGCAGACGG + Intergenic
1101510691 12:105389879-105389901 CATTGGGGAGTTCCTGCAGAGGG - Intronic
1103364541 12:120371604-120371626 CAGAAGGATGTTCCTTCAGGAGG + Intergenic
1104452317 12:128880294-128880316 CAATAGGTTGGTTTTGCAGAGGG - Intronic
1106573436 13:30951427-30951449 CAATAGAATGATCATCCAGATGG + Intronic
1108576910 13:51798789-51798811 AAAATGGATGTTCCAGCAGAAGG - Intronic
1109036448 13:57267879-57267901 CAATAAGATCTTCCTGAGGAGGG - Intergenic
1109045761 13:57409076-57409098 CAATTTGGTGTTTCTGCAGAGGG - Intergenic
1110899493 13:80802913-80802935 CAAATGGATATTTCTGCAGAAGG + Intergenic
1111179714 13:84647801-84647823 CAGTAGGTTGAGCCTGCAGATGG + Intergenic
1111300491 13:86342813-86342835 CAATTTGGTGTTCCTGCAGGGGG + Intergenic
1112944528 13:104910971-104910993 AAATTTGATGTTTCTGCAGAGGG + Intergenic
1113307435 13:109093785-109093807 CTATAGGAAGGTCCTCCAGATGG + Intronic
1115744242 14:36419567-36419589 AAATAGGATGTTTATCCAGAGGG + Intergenic
1117449035 14:55833016-55833038 TAATTTGATGTTCCTTCAGAGGG + Intergenic
1119774972 14:77242667-77242689 AAAAAGGCTTTTCCTGCAGAGGG + Intronic
1122456529 14:101857268-101857290 CATTAGAATTTTCCTGCACATGG - Intronic
1122492831 14:102131301-102131323 CGATAGGATTTCCCAGCAGATGG - Intronic
1122759155 14:104008253-104008275 AAATTGGATGTACCTGGAGAGGG + Intronic
1124351002 15:28955693-28955715 CACTCATATGTTCCTGCAGATGG - Intronic
1125887734 15:43241089-43241111 CTCCAGCATGTTCCTGCAGATGG - Intronic
1127096476 15:55516221-55516243 CCATGGCATGTTCCAGCAGAAGG + Intergenic
1127178166 15:56383417-56383439 AAATTTGGTGTTCCTGCAGAGGG + Intronic
1128711025 15:69872112-69872134 CAAGTGGCTGTTCCTGCAGAGGG - Intergenic
1129071994 15:72959475-72959497 CAGGAGGATGTTGCTGCAGCTGG - Intergenic
1130063139 15:80583862-80583884 GAATTGGATGTCCCAGCAGATGG + Intronic
1131298291 15:91171913-91171935 CAGAAGGATGATTCTGCAGATGG - Intronic
1131605338 15:93897797-93897819 GAATAGGAAGGTCCTGGAGACGG + Intergenic
1131984079 15:98023862-98023884 CACTAGGATTTTCCAGAAGATGG - Intergenic
1133008728 16:2898474-2898496 CACCAGGAGGTCCCTGCAGAGGG + Intronic
1136090464 16:27916032-27916054 CAAGGGCATGTTTCTGCAGAAGG - Intronic
1138407983 16:56814107-56814129 AAATATGATGATACTGCAGACGG - Intronic
1139736736 16:68996568-68996590 CAACAAGATGTTTCTGCTGAGGG + Intronic
1140171932 16:72614298-72614320 CAATAGGATGTCCTTACAAAAGG - Intergenic
1143748857 17:9013787-9013809 GAAAAGGATGTTGCTCCAGATGG - Intergenic
1145040149 17:19571818-19571840 AAATTGGATTTTCCTGCACAAGG - Intronic
1148786972 17:50150321-50150343 CAAAAGTATGTTCCTGCAGATGG - Exonic
1149602238 17:57900361-57900383 CAGCAGGCTGTTTCTGCAGAGGG - Intronic
1153060526 18:990388-990410 CAAAATGCTGTTCCTGCAGCAGG + Intergenic
1153328873 18:3851504-3851526 CAAAAGAATGTTCCTGTAGAGGG - Intronic
1156035132 18:32757936-32757958 GTATAACATGTTCCTGCAGAAGG + Intronic
1157786491 18:50488061-50488083 AAACAGGATGTTCCAGCACAAGG + Intergenic
1161941231 19:7405558-7405580 AAATAGGAGGTTCCTGAAGTGGG - Intronic
1164264245 19:23597558-23597580 CAGAAGGATGTTCCTTCAGGAGG + Intronic
1165173900 19:33913365-33913387 CAATAGGCGGTTCCTTCTGAGGG - Intergenic
1167883725 19:52483503-52483525 CAATAGGATGTTCCTGCAGATGG - Intronic
1167884625 19:52489983-52490005 CAATAGGATGTTTCTGCAGATGG - Intronic
1167887006 19:52508463-52508485 CAATAGGATGTTCCTGCAGATGG - Intronic
1167889986 19:52531572-52531594 CAATAGGATGTTCCTGCAGATGG - Intronic
1167893592 19:52562473-52562495 CAATTGGATGTTCCTGCAGATGG - Intronic
1167911724 19:52709144-52709166 CAATAGGATGTTCCTGCAGTTGG + Intronic
1167914599 19:52730488-52730510 CAATAGGATGTTCCTGCAGATGG + Intronic
1167919431 19:52770738-52770760 AATAAGGATGTTCCTGCAGTTGG + Intronic
1167989778 19:53348545-53348567 CAATAGGATGTTCCTGCAGATGG - Intronic
1167993272 19:53378809-53378831 CAATAGGATGTTCCTGCAGATGG - Intronic
929665784 2:43832732-43832754 CACTAGGAAGTTCCCACAGAGGG + Intronic
929817775 2:45249187-45249209 CACTACAATGTTCCTGCATACGG + Intergenic
931298083 2:60949580-60949602 AAATAAGATGCTCCTGAAGAGGG + Intronic
932766268 2:74472454-74472476 CCGTAGGACCTTCCTGCAGACGG - Exonic
934177824 2:89592722-89592744 CTATAGGGTAATCCTGCAGAAGG + Intergenic
934288121 2:91667023-91667045 CTATAGGGTAATCCTGCAGAAGG + Intergenic
936513825 2:113169147-113169169 CAAGAGGAGGTTACTTCAGACGG - Intronic
941432307 2:165427133-165427155 CACTAGGCTGTTCATGCTGAGGG - Intergenic
943108827 2:183581208-183581230 CAATAGGATGCTAATACAGATGG - Intergenic
943639405 2:190342952-190342974 GAAGAGGCTGCTCCTGCAGAAGG - Intronic
945557622 2:211298947-211298969 CAGAAGGATGTTCCTTCAGGAGG - Intergenic
947964508 2:234267973-234267995 CAATAGGCTGCCCCTGCTGACGG - Intergenic
948742050 2:240054572-240054594 CATTAGGGTTTCCCTGCAGAGGG + Intergenic
1170171765 20:13421765-13421787 TAAGAGAATGTTCTTGCAGATGG - Intronic
1174465688 20:50715569-50715591 AAATAGGATGTTTGTGCATATGG - Intergenic
1175479775 20:59302535-59302557 CAAGATGATGTGCCTGCAGGAGG - Intronic
1180668843 22:17536932-17536954 AATTAGGATGTTTCTACAGATGG - Intronic
1181960016 22:26616219-26616241 CTAGGGGATGTTCCTGCAGGTGG + Exonic
1184378013 22:44126988-44127010 CAAAAGGATGTGCCTTGAGAGGG - Intronic
1185136313 22:49075172-49075194 CAATAGGATGTACATATAGAAGG - Intergenic
949882873 3:8675423-8675445 CAATGGGGTGTCCCAGCAGAAGG - Intronic
949962482 3:9324467-9324489 AAACAGGATGTTCCAGCATAGGG - Intronic
950258942 3:11529920-11529942 CAAGAGGATGGTGGTGCAGATGG - Intronic
951187283 3:19728493-19728515 AAACAGGATGTTCCCGCATAAGG + Intergenic
951897500 3:27624214-27624236 CAGAAGGATGTTCCTTCAGAAGG - Intergenic
952491451 3:33877965-33877987 CAATTTGGTGTTCCTGCAGAGGG + Intergenic
952627132 3:35419255-35419277 CAATAGGAGATTCCTGGAAAAGG - Intergenic
952688522 3:36176450-36176472 CAATTTGATGTTCCTGGGGAGGG + Intergenic
953199099 3:40761765-40761787 CAGAAGGATGTTCCTTCAGGAGG + Intergenic
955048250 3:55381472-55381494 CATTGGGATGTTACTTCAGATGG + Intergenic
957810613 3:85216097-85216119 CAATATGGTGTTCCTTCAGTGGG + Intronic
958096313 3:88950032-88950054 CAATTGTCTGTTCCTTCAGATGG + Intergenic
960471983 3:118076596-118076618 CAACTTGGTGTTCCTGCAGAGGG + Intergenic
960607253 3:119519411-119519433 GAAAAGGATGTTCATGCAAATGG + Intronic
962977625 3:140459511-140459533 CCAGAGGAGGCTCCTGCAGAGGG - Exonic
964140917 3:153397676-153397698 CAATTTGGTATTCCTGCAGAGGG + Intergenic
965845502 3:172956327-172956349 TTATAGTATTTTCCTGCAGATGG - Intronic
966068450 3:175844997-175845019 CAATCAGATATTCCTGCAAAGGG - Intergenic
967047629 3:185752263-185752285 CAATGGCCTGTTCCTGCACATGG - Intronic
968218429 3:196914717-196914739 CAATTTGGTGTTCCTGCAGGAGG - Intronic
969042417 4:4309665-4309687 CTATAGGGTAATCCTGCAGAAGG - Intronic
969856948 4:10007634-10007656 CAAAAGAATGTTCCAGCAGGAGG - Intronic
971721069 4:30245793-30245815 GAATAAGATGTTCCTGAGGAGGG - Intergenic
971781594 4:31042023-31042045 CACTAGTATCTTGCTGCAGAGGG - Intronic
972819262 4:42680848-42680870 AAACAGGATGTTCCAGCATAAGG + Intergenic
973749554 4:54000388-54000410 CAGTAGGTTTTTCCTGCAAAGGG - Intronic
973813795 4:54599401-54599423 AAACAGGATGTTCCAGCATACGG - Intergenic
974512562 4:62863695-62863717 CAATAGTATGCTTCTCCAGATGG + Intergenic
977564754 4:98569450-98569472 TAATAGGACGTCCCTGCAGATGG - Intronic
979230683 4:118346058-118346080 CAAAAGGACATTCCTGCAGAGGG + Intronic
980474485 4:133294646-133294668 CAATAGAATGTTCTTGAAGGAGG - Intergenic
981201379 4:141983646-141983668 AAATAGGATGTTCCAGCATAAGG + Intergenic
982258631 4:153473839-153473861 CAATAGGGTGATTCTGAAGAGGG + Exonic
985901487 5:2798736-2798758 CAACAGTTTGTTCCTGCAGCAGG + Intergenic
987873907 5:23655418-23655440 CAATTTGGTGTTCCTGCAGAGGG - Intergenic
988136724 5:27181710-27181732 CAATATTATGTTCCTGCTGCTGG - Intergenic
991297040 5:65092717-65092739 GAATTTGATGTTCCTGCAGGGGG - Intergenic
991718047 5:69470102-69470124 CAGAAGGATGTTCCTTCAGGAGG + Intergenic
992299075 5:75359127-75359149 CATTTAGATGTTCCTCCAGAAGG - Intronic
992761895 5:79957757-79957779 CAATTGGATGTTCCTGAAAAGGG + Intergenic
992945250 5:81803301-81803323 CAATAGGATTCTACTGCAGTAGG - Intergenic
993804776 5:92392013-92392035 GAATACTATGTTCCTGCACATGG + Intergenic
993806974 5:92423131-92423153 AAACAGGATGTTCCGGCATAAGG - Intergenic
994229630 5:97298543-97298565 CAATTTGGTGTTCCTGCAGGGGG + Intergenic
994881216 5:105498774-105498796 AAATTTGATGTTCCTGCAGTGGG + Intergenic
995326483 5:110894589-110894611 AAATAAGATGTTCCAGCATAGGG + Intergenic
995983312 5:118135419-118135441 CAATAGTATGCTCTAGCAGATGG - Intergenic
996075925 5:119193935-119193957 AATTAGAATGTTCCTGGAGATGG - Exonic
996459390 5:123724505-123724527 AAATTTGATGTTCCTGCGGAAGG - Intergenic
996659930 5:125989471-125989493 CAATTTGGTGTTGCTGCAGAAGG + Intergenic
1002280419 5:178126681-178126703 CTAAGGGAAGTTCCTGCAGAAGG + Intergenic
1006586881 6:35120954-35120976 GAATGGAATGTTCCTGCAGGTGG + Exonic
1009375403 6:62961944-62961966 AAATTTGGTGTTCCTGCAGAAGG + Intergenic
1012321662 6:97855113-97855135 CAACAGGATGTGCCTGGGGATGG + Intergenic
1018995076 6:168704315-168704337 CAATAGTCTGTGCCTGCGGAGGG - Intergenic
1022488719 7:30800389-30800411 TAATATGATGCTCTTGCAGAGGG - Intronic
1024806100 7:53142386-53142408 CAATAGTATTTTTCAGCAGATGG + Intergenic
1024997278 7:55281614-55281636 CTACAGGATGTTCCAGCATAAGG - Intergenic
1026238058 7:68545948-68545970 TAAACGTATGTTCCTGCAGAAGG - Intergenic
1027339143 7:77187266-77187288 AAACAGGATGTTCCAGCATAAGG - Intronic
1027508737 7:79052453-79052475 CATGAGGCTGTCCCTGCAGAAGG + Intronic
1029947630 7:104549955-104549977 CAATAGGATGTGTGTACAGAGGG + Intronic
1031305459 7:120120482-120120504 AAACAGGATGTTCCCGCATAAGG + Intergenic
1032744731 7:134774202-134774224 CAATTGGAAGTTGCTGCAAATGG + Intronic
1033088462 7:138363819-138363841 AAACAGGATGTTCCAGCATAAGG - Intergenic
1034411425 7:150944339-150944361 CAAGAGGAGCTTCCTGAAGAGGG - Intergenic
1039612230 8:38929063-38929085 GAAAAGAATGTGCCTGCAGAGGG - Intronic
1040402787 8:47069346-47069368 AAAAAGGATGTTCCAGCATAAGG + Intergenic
1040508359 8:48071848-48071870 CCAGAGGAAGTTCCAGCAGAGGG - Intergenic
1041083901 8:54239212-54239234 AAATAAGATATTCCTGCAGTTGG - Intergenic
1041705792 8:60844935-60844957 CACCAGGATGGTTCTGCAGATGG - Exonic
1043307747 8:78818152-78818174 CAAATTGATGTTTCTGCAGAGGG + Intergenic
1044339727 8:91033102-91033124 CAGTAGCATTTTCCTGGAGAGGG - Intronic
1045588941 8:103571400-103571422 TAATAGGATGTTAATGGAGATGG + Intronic
1046202507 8:110946016-110946038 AAACAGGATGTTCCAGCATAAGG - Intergenic
1046821512 8:118638663-118638685 CAGTAGGATGTTCCAGGAAAGGG - Intergenic
1047714603 8:127584062-127584084 CCACAGGGTGTTCCTGCAAAAGG - Intergenic
1047730712 8:127725847-127725869 AGATAGGATTTTCCTCCAGAGGG + Intergenic
1048162144 8:132031468-132031490 CACTTGGTTTTTCCTGCAGAAGG - Intronic
1050759459 9:9049162-9049184 CAGTAGAATGTTCCTTGAGAAGG - Intronic
1051484455 9:17593044-17593066 AAAGAGGATGTGCCTGGAGAGGG + Intronic
1051663899 9:19450440-19450462 GATGAGGATGTGCCTGCAGAGGG - Exonic
1055342209 9:75296102-75296124 CAATTTGTTGTTCCTGCAGGAGG + Intergenic
1059886546 9:118750858-118750880 CAATTTGGTGTTCCAGCAGAGGG - Intergenic
1187132561 X:16516936-16516958 CAATTTGGTGTTCCTGCAGGGGG - Intergenic
1188078662 X:25808787-25808809 AAATATGATGTTCCTGCAGGGGG + Intergenic
1188651441 X:32635368-32635390 CAATTTGATGTTCCTGCAACAGG + Intronic
1192120358 X:68449430-68449452 AAATAGGATGTGACTGCAAATGG - Intergenic
1192304589 X:69945195-69945217 CAATTTGATGTTCCTGCAAGGGG + Intronic
1193335554 X:80284790-80284812 CAATTTGATGTTCCTGCAGGGGG - Intergenic
1195165238 X:102213458-102213480 CAATTTGGTGTTCCTGCAGGGGG + Intergenic
1195193620 X:102473633-102473655 CAATTTGGTGTTCCTGCAGGGGG - Intergenic
1198231486 X:134693802-134693824 GAATCTGATGTTCCTTCAGATGG + Intronic
1198940851 X:141953440-141953462 CAAATGGATGTTTCTGCAGCAGG + Intergenic