ID: 1167887726

View in Genome Browser
Species Human (GRCh38)
Location 19:52515970-52515992
Sequence GGGCTGTGGAGCCACAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167887726_1167887737 16 Left 1167887726 19:52515970-52515992 CCCTCACTGTGGCTCCACAGCCC No data
Right 1167887737 19:52516009-52516031 GCCAGTGTCCAGCCTCCTCCTGG 0: 13
1: 2
2: 2
3: 27
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167887726 Original CRISPR GGGCTGTGGAGCCACAGTGA GGG (reversed) Intergenic
No off target data available for this crispr