ID: 1167890751

View in Genome Browser
Species Human (GRCh38)
Location 19:52537237-52537259
Sequence GAGGAGTAATAGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1129
Summary {0: 1, 1: 3, 2: 7, 3: 100, 4: 1018}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167890751 Original CRISPR GAGGAGTAATAGAGGGAAGA AGG Intronic
900407794 1:2500083-2500105 GGGGGGTAGTAGAGGGGAGAGGG - Intronic
900498748 1:2989373-2989395 GAGGATGAATAGATGGAGGATGG - Intergenic
900993141 1:6107017-6107039 GAGGGATAATGGAGGGAAGATGG + Intronic
900993336 1:6107806-6107828 GAGGAATAATGGAGGGATGGAGG + Intronic
900993464 1:6108288-6108310 GAGAGATGATAGAGGGAAGATGG + Intronic
901205324 1:7491437-7491459 GAGTAGACACAGAGGGAAGATGG + Intronic
901360916 1:8699625-8699647 AAGGAATAATGGAGGGAAGTAGG - Intronic
901927460 1:12575546-12575568 GAAGAGTAGTACAAGGAAGATGG - Intronic
902653832 1:17854013-17854035 GAGGAGTAAGACAGGGAAGAGGG + Intergenic
902789403 1:18756416-18756438 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
903114469 1:21167332-21167354 GAGGAGTGATTGAAGGAAGGAGG - Intronic
903396176 1:23003417-23003439 AAGGAGGAATGGAGGGAGGAAGG + Intergenic
903587412 1:24426748-24426770 GAGGTGGAAGAGAGGGGAGAAGG - Intronic
904295393 1:29516937-29516959 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295740 1:29518748-29518770 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295752 1:29518808-29518830 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904480732 1:30791713-30791735 GAGAAGGAAGAGAGGGAAGAAGG + Intergenic
904504017 1:30936050-30936072 GAAGAGTTAGACAGGGAAGAAGG - Intronic
904505481 1:30949479-30949501 GAAGAGTTAGACAGGGAAGAAGG - Intronic
904713714 1:32450832-32450854 GAGGAGTAGGAGGAGGAAGAGGG - Intergenic
904808798 1:33150175-33150197 GATGAGGAAAAGTGGGAAGAAGG + Intronic
904986817 1:34557582-34557604 GAGGCCTAATAGAGGGTGGAGGG + Intergenic
905120215 1:35676062-35676084 GAGGAAGAAGAGAGGGAGGAAGG - Intergenic
905609277 1:39335501-39335523 GAAAAGTAAGAGAGAGAAGAGGG + Intronic
906180868 1:43817697-43817719 GAGGAGAAGGAGAAGGAAGAAGG - Intronic
906927443 1:50134000-50134022 GAGGAGTAAAAGGGAGTAGAGGG - Intronic
907293442 1:53433479-53433501 AAGGAGGAATGGAGGGCAGAAGG - Intergenic
907561872 1:55398468-55398490 GAGGAGCAAGAGAGGGAACTTGG + Intergenic
908421305 1:63961083-63961105 AAGGATGAATGGAGGGAAGAAGG - Intronic
909059386 1:70862734-70862756 GAGGAGGAAAAGAAGAAAGAAGG + Intronic
909165660 1:72221180-72221202 GAGGATACATAGAGGAAAGAAGG - Intronic
909540785 1:76789229-76789251 GAGAAGAGAAAGAGGGAAGATGG + Intergenic
909639913 1:77861568-77861590 GAGAAGGAAGAGAGGGAACAAGG - Intronic
910186494 1:84546646-84546668 GAGGAGAAGTAGATGGCAGAGGG - Intergenic
910538162 1:88323620-88323642 CAGGAGGAAGAGAGTGAAGAGGG + Intergenic
910909789 1:92221319-92221341 GGGGACTACTAGAGGGGAGAGGG + Intronic
911139980 1:94489528-94489550 GAGCAGGAATATAGGGATGAAGG - Intronic
911224547 1:95290899-95290921 GAGAAGTAACAGAGGGAGGACGG - Intergenic
911285024 1:95979899-95979921 GAGGAGAAAGAAAGGGAAGAGGG - Intergenic
911679415 1:100697609-100697631 GAGGACTACTAGAGTGAAGAGGG - Intergenic
911737503 1:101353871-101353893 AAGGAGAGATAGAGAGAAGAAGG - Intergenic
911779518 1:101858693-101858715 CAGGAGGAAGAGAGTGAAGAGGG - Intronic
911997263 1:104782104-104782126 GAGGAGGAAGAGAGAGAAGTAGG - Intergenic
912193431 1:107368225-107368247 GAGAAGGAAAAGAAGGAAGAGGG - Intronic
912635493 1:111288507-111288529 GGGGAGTGAAACAGGGAAGAAGG - Intergenic
914829830 1:151162874-151162896 GAGTAGAAATAGAGCGAGGAAGG - Intronic
915468915 1:156114375-156114397 GGGGAGAAAGAGAGGGAAGTGGG - Intronic
915690155 1:157680925-157680947 GAGGAGCCAGGGAGGGAAGAGGG - Intronic
915823444 1:159050644-159050666 GAGGAGGTATGGAGGCAAGAAGG - Intronic
916825216 1:168436100-168436122 GAGGAGTAAGATTGGGCAGAAGG - Intergenic
916829114 1:168473342-168473364 CAGGAGTAAGAGAGTGAAGGGGG - Intergenic
917201152 1:172516898-172516920 GAGGAGTAATGGAGGGAGCTGGG - Intergenic
917235230 1:172884565-172884587 GAGGAGGAAGAGAGGACAGAAGG + Intergenic
917730314 1:177868580-177868602 GGGGACTACTAGAGGGAGGAGGG - Intergenic
918029669 1:180793109-180793131 AAGGAGGGAGAGAGGGAAGAAGG + Intronic
918199368 1:182252911-182252933 GAGGGGAAATAAAGAGAAGATGG + Intergenic
918473671 1:184900679-184900701 AAGGAGGAATAGAGGGGAAAGGG + Intronic
918522954 1:185434965-185434987 GAGAGGGAAGAGAGGGAAGAGGG - Intergenic
918722818 1:187875598-187875620 CAGGAGAAATAGAGGGGAGAGGG + Intergenic
919196928 1:194298022-194298044 AAGGAGAAGAAGAGGGAAGAAGG + Intergenic
919303285 1:195797700-195797722 GAGGAGTAATGTTGGAAAGAGGG + Intergenic
919459412 1:197858412-197858434 GGGGACTACTAGAGGGAGGAGGG - Intergenic
919586021 1:199441396-199441418 AAGGAGTAAAAAAAGGAAGAAGG + Intergenic
920111605 1:203591149-203591171 GCAGAGGAACAGAGGGAAGAAGG + Intergenic
920206754 1:204297881-204297903 TGTGAGTGATAGAGGGAAGACGG + Intronic
920274682 1:204795358-204795380 GAGGAGTTCTAGAAGGAAGAAGG + Intergenic
920747918 1:208646446-208646468 GAGGAATAATGGAGGGAGGAAGG - Intergenic
920783232 1:209014769-209014791 GGGGAATACAAGAGGGAAGAGGG + Intergenic
921116889 1:212100364-212100386 TAGGAGTATTTGAAGGAAGAGGG - Exonic
921164052 1:212493571-212493593 GAGGAAGAAGAGATGGAAGAAGG + Intergenic
921294999 1:213693218-213693240 GAGGAGAGAAGGAGGGAAGAGGG - Intergenic
921417658 1:214909254-214909276 CAGGAGGAAGAGAAGGAAGAAGG + Intergenic
921519556 1:216142947-216142969 GAGGTGTTATGGAGAGAAGAGGG - Intronic
921914026 1:220586348-220586370 AAGGACTAATTAAGGGAAGAGGG - Intronic
922049684 1:221977552-221977574 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
922072050 1:222204291-222204313 GAGGAGCAGTAGAGGGAGAAAGG + Intergenic
922154218 1:223028853-223028875 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
922213268 1:223501218-223501240 GAGGAGGAGGAGAGGGAGGAGGG - Intergenic
922658515 1:227407645-227407667 GAGGAGGAAAAGAAGGAGGAGGG + Intergenic
922694165 1:227719684-227719706 GAGGAGAAAAAGAGGGACAAAGG - Intergenic
922859568 1:228804643-228804665 GAGGAAGAAAAGAGGGAGGAAGG - Intergenic
922934678 1:229413659-229413681 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
922973320 1:229761359-229761381 GATGAGAAATAAAGGGCAGAGGG - Intergenic
923221898 1:231903013-231903035 GAGGAGGAAGAGAGAGGAGAAGG - Intronic
923318086 1:232801226-232801248 GGGGACTACTAGAGGGGAGAGGG - Intergenic
923482570 1:234397715-234397737 GAGGGGGAAGAGAGGGAGGAGGG + Intronic
924167188 1:241296179-241296201 GAGGAGGAAGAAGGGGAAGAAGG + Intronic
924283081 1:242457789-242457811 GTGGAGTGACAGAGGGTAGAAGG - Intronic
924461465 1:244263356-244263378 GAGAAGGAAGAGAGGGAGGAGGG + Intergenic
1063783093 10:9349502-9349524 AAGGAGCAAGAGAGAGAAGAGGG + Intergenic
1063802229 10:9593380-9593402 GAGAAGAAATAGCGAGAAGAGGG + Intergenic
1064827782 10:19425317-19425339 GATGATGAATAAAGGGAAGAAGG - Intronic
1064968624 10:21040490-21040512 AAGGAGAAATAGAGGAGAGAAGG + Intronic
1065261369 10:23926792-23926814 GAGGAAGAAAAGAGGGAGGAAGG - Intronic
1065377463 10:25058155-25058177 GAGGACAAGTAGAGGGAGGAAGG - Intronic
1065497259 10:26341983-26342005 GGGGAGGAGTGGAGGGAAGAAGG + Intergenic
1065791232 10:29262718-29262740 GAGGAGCAATACAGGGATGCTGG + Intergenic
1065822998 10:29543660-29543682 GAGGAGGAAGAGAGGTAAGAAGG - Intronic
1066523318 10:36247745-36247767 AAGGAGGAAGAGAGGAAAGAAGG - Intergenic
1066779369 10:38927320-38927342 GGGGAGCAATAGAGAGAAAAGGG - Intergenic
1067154579 10:43767126-43767148 GTGGACTACTAGAGGGAGGAAGG + Intergenic
1067807912 10:49405909-49405931 GAGAAGGAAAAGGGGGAAGAGGG - Intergenic
1068114525 10:52722755-52722777 CAGGAGGAACAGAGGGAACAGGG + Intergenic
1068203904 10:53822460-53822482 GAGGAGAAATAGGAGGAGGAGGG + Exonic
1068613126 10:59082698-59082720 GAAGAGTGAAAGAGGGAAGCAGG - Intergenic
1069251391 10:66271574-66271596 GAAGGGTAATATGGGGAAGACGG - Intronic
1069455519 10:68550964-68550986 GAGCAGGAAGAGAGAGAAGATGG + Intergenic
1070761947 10:79029442-79029464 GAGAAGTAGTAGAAGAAAGAAGG - Intergenic
1070979077 10:80630096-80630118 GTGGAGGGAGAGAGGGAAGAAGG + Intronic
1071229785 10:83572110-83572132 GAGAGGAAAGAGAGGGAAGAAGG + Intergenic
1071235487 10:83642562-83642584 GAGGAGAAAAAGTGGGCAGAAGG - Intergenic
1071278400 10:84077206-84077228 GAGGAGTGAGATAGGGAAGGAGG + Intergenic
1071897875 10:90085490-90085512 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
1073081432 10:100863375-100863397 GACGAGTGACAGAGGGAAGGAGG + Intergenic
1073667296 10:105547868-105547890 CAGGAGAAAGAGAGAGAAGAGGG - Intergenic
1073959594 10:108911668-108911690 GCGGAGAATTAGAGGGAAGATGG - Intergenic
1074595282 10:114858730-114858752 GAGGAGGAATGGAGAGAAGTTGG + Intronic
1074740631 10:116481907-116481929 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
1074838229 10:117321476-117321498 GAGGAGTACTAGAGGAAAATGGG + Intronic
1075576118 10:123578774-123578796 CAGGAGTAACAGAGGACAGATGG + Intergenic
1075678333 10:124313409-124313431 GAGGAGGAAAAGAGGCAGGAAGG + Intergenic
1076088220 10:127654658-127654680 GAGGAGTGGTAGAGGGAAGGAGG - Intergenic
1076138932 10:128064404-128064426 GAAGAGTGACAGAGGGAAGTAGG + Intronic
1076201546 10:128562771-128562793 GAGGAGGAAGAGAGGAAGGAAGG + Intergenic
1077024570 11:433523-433545 GAGGTGGAATAGAGGGGGGAGGG - Intronic
1077024579 11:433550-433572 GAGGCGGAATAGAGGGGGGAGGG - Intronic
1077268574 11:1664624-1664646 GAGGAGGCAGGGAGGGAAGAAGG + Intergenic
1077283185 11:1754583-1754605 GAAGAGTCACAGAGGGATGAGGG + Intronic
1077531312 11:3096954-3096976 GAGGAGGAGAAGAGGAAAGAGGG + Intronic
1077531322 11:3096986-3097008 GAGGAGGAGAAGAGGAAAGAGGG + Intronic
1077531356 11:3097107-3097129 GAGGAGGAGGAGAGGAAAGAAGG + Intronic
1077738697 11:4820533-4820555 GAGGAGGAATAAGAGGAAGAAGG - Intronic
1077829653 11:5852533-5852555 GAGGACTACTAGAGGGAGGAGGG - Intronic
1077868627 11:6243096-6243118 GAGCAGGAACAGAGGGAAGGGGG - Intronic
1078308012 11:10210377-10210399 GAGGAGGAAGAGAAGGAGGAAGG + Intronic
1078314797 11:10285333-10285355 GAGAAGGAAGAGAGGGGAGAGGG + Intronic
1078593369 11:12665212-12665234 GAGGAGGAAGAGGAGGAAGAAGG + Intergenic
1078740624 11:14062994-14063016 GAGGAAAAAAAGAGGGAAGGAGG - Intronic
1079056703 11:17212345-17212367 GAGAAAAGATAGAGGGAAGATGG + Intronic
1079275971 11:19038062-19038084 CTGGAGTAATCCAGGGAAGAAGG - Intergenic
1079280214 11:19080544-19080566 GAGGAGTAATGGAGGGAGATTGG - Intergenic
1079720768 11:23810633-23810655 GAGGAGTAAGAGAGAAAAGGGGG - Intergenic
1079938104 11:26642880-26642902 AAGAAGAAATAGAGGGAAGATGG - Intronic
1080127527 11:28754454-28754476 AGGGAGGAACAGAGGGAAGAAGG + Intergenic
1081012694 11:37835005-37835027 GAGGAGTGCTAGAGTGAGGAAGG - Intergenic
1081028358 11:38044961-38044983 GAGCTGTATTAGAGTGAAGATGG - Intergenic
1081151476 11:39638398-39638420 AAGGAGTAGCAAAGGGAAGATGG + Intergenic
1081247530 11:40787273-40787295 GGGGAGGAACAGAGGGAACAAGG + Intronic
1081259846 11:40946089-40946111 GAGGACTACTAGAGGGAGGAGGG - Intronic
1081362623 11:42199126-42199148 AAGGAGTAACAGTGGGCAGAGGG + Intergenic
1082018285 11:47509383-47509405 GAGGAGTAAAAAAGCTAAGAGGG + Intronic
1083058053 11:59842250-59842272 GAGGAGTAAGTGAAGGAAGAGGG - Intronic
1083489201 11:63002648-63002670 GTGGAGTAGGAGAGGGAGGAAGG - Intronic
1083513831 11:63237179-63237201 GTGGACTACTAGAGGGAGGAAGG + Intronic
1083966418 11:66046589-66046611 CAGGAGTAAGAGAGGGGAGGAGG + Intronic
1084146470 11:67267518-67267540 GAGGAGAAATGTAGGGGAGAGGG - Intronic
1084486579 11:69451682-69451704 AAGGAAGAAAAGAGGGAAGATGG + Intergenic
1084617252 11:70244794-70244816 GAGGAGGAGGAGAGGGAAGGAGG + Intergenic
1084949727 11:72657967-72657989 GAGGAGGGGTGGAGGGAAGAGGG + Intronic
1084963815 11:72733026-72733048 GAAGAGGAAGAGAAGGAAGAGGG + Intronic
1085244115 11:75084188-75084210 GGGGACTAATAGAGGGTGGAGGG + Intergenic
1085331352 11:75654444-75654466 GAGGAGTTGTAGAGGAAAGGGGG - Intronic
1085471803 11:76763290-76763312 CAGGAGTAATGCAGGGATGACGG + Intergenic
1085542953 11:77289379-77289401 GAGGGGAAAAGGAGGGAAGACGG + Intronic
1086890025 11:92246554-92246576 GAGGAGGAGAAGAAGGAAGAAGG + Intergenic
1087147406 11:94825741-94825763 ATGGAGTAATAGAAAGAAGAAGG + Intronic
1087501621 11:98962146-98962168 AATGAGTAATACAGGAAAGAAGG + Intergenic
1087586223 11:100125324-100125346 GAGGATTACTAGAGGGAAGTAGG - Intronic
1087805271 11:102548538-102548560 GAGGAGAAATGGAGGGAGCAAGG + Intergenic
1087955564 11:104282785-104282807 CAGGGGTAATGGAGGGAATAAGG - Intergenic
1088815841 11:113420179-113420201 GAGGAGGAAGACAGGGAGGAAGG - Intronic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1089401081 11:118165083-118165105 GAGGAGGAGTGGAGGGAAGCAGG - Exonic
1089714662 11:120346763-120346785 CTGGAGTAATAAAGGGAACAAGG - Intronic
1089773715 11:120821355-120821377 GAGGAGCAAGAGAGGGAGGCAGG + Intronic
1090107743 11:123870058-123870080 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1090243336 11:125199139-125199161 GAGGAGAAAAAAAGGGAAGAAGG - Intronic
1090585336 11:128205996-128206018 GAGGAGCAAGAGAGGGAGGAGGG + Intergenic
1090743743 11:129690902-129690924 GAGGAGTATGAAAGGGAAAATGG - Intergenic
1091113810 11:132995462-132995484 AAGGAGAGACAGAGGGAAGAAGG - Intronic
1091372376 11:135071763-135071785 GATGAGAAATAAAGAGAAGAAGG + Intergenic
1091431688 12:441033-441055 GAGGTGTAAGTGAGGGAACATGG + Intronic
1091687355 12:2572826-2572848 GAGGAGGAAGAGAAGGAGGAGGG - Intronic
1091750956 12:3020943-3020965 GAGGAGGGAAAGAGGGAAGAGGG - Intronic
1091809866 12:3387997-3388019 GAGGAGTTATTGAGGAAATAAGG - Intronic
1091842061 12:3628359-3628381 GAGGAGGAATAGGAGGAGGAGGG + Intronic
1091971219 12:4788533-4788555 GAGGAGGAATAGGTTGAAGAAGG + Intronic
1091992527 12:4967476-4967498 GAGGATGAGTAGAAGGAAGAGGG - Intergenic
1092031981 12:5294019-5294041 GAGGAGTACTAGGGGAAAGGAGG + Intergenic
1092168320 12:6356843-6356865 GAGGAGGACTAAAGAGAAGAGGG + Intronic
1092233323 12:6790044-6790066 GAGGAGAAAAAGAGTGAAGAAGG + Intronic
1092245573 12:6862279-6862301 GAGGAGCAGTAGAGGCCAGAAGG - Intronic
1093569070 12:20644862-20644884 GAAGAGGAAGAGGGGGAAGAGGG - Intronic
1093718882 12:22414787-22414809 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1093791474 12:23255304-23255326 GAGGAGCAAAACATGGAAGATGG - Intergenic
1093839225 12:23875578-23875600 GAGGAGGAAGAGAGGAAAGAAGG + Intronic
1094083817 12:26566430-26566452 GAGGAGAAGGAGAGGAAAGAGGG + Intronic
1094321599 12:29189988-29190010 GAGGGGAAATAGAAGGATGAAGG + Intronic
1094356127 12:29579627-29579649 GAAGATTAGGAGAGGGAAGAGGG + Intronic
1095093268 12:38127268-38127290 GTGGAGTGACAGAGGGTAGAAGG - Intergenic
1095585295 12:43843163-43843185 GAGGGGGAAGAGGGGGAAGAGGG - Intronic
1095866679 12:46979740-46979762 GAGGAGGAAGGGAGGGAGGAAGG + Intergenic
1095903697 12:47355383-47355405 GGGGACTACTAGAGGGAGGAAGG - Intergenic
1096750905 12:53758259-53758281 GAGGAGAAATAGAGGAAGGCAGG - Intergenic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1097223188 12:57462153-57462175 GGTGAGTCATAGAGGGAAGGAGG + Intronic
1097281906 12:57850188-57850210 GAGGGGTAAATGAGGGAGGAGGG + Intergenic
1097377572 12:58858276-58858298 GAGGAGAGAGAGAGGGAAGAGGG - Intergenic
1098583326 12:72127670-72127692 GAGGAGTAAGGGAGAGAAGGGGG + Intronic
1098621024 12:72598874-72598896 GAGGGGTAAGGGAGGGACGAAGG - Intronic
1098892038 12:76019056-76019078 GAGGAGAAGGAGAGAGAAGAGGG + Intergenic
1099079426 12:78157810-78157832 GAGGAGAAAAAGAAGGAAGAGGG + Intronic
1099292238 12:80787528-80787550 AAGGAGGAATAGAGGGTGGAAGG + Intergenic
1099438614 12:82672960-82672982 GAGGAGGAAGAGCAGGAAGAGGG - Intergenic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1100054856 12:90496942-90496964 GAAGACTAATAGAGAGGAGAGGG + Intergenic
1100393674 12:94165879-94165901 GAGGAGGAAGTGAGGGAAGAGGG + Intronic
1100650350 12:96581066-96581088 GAGCAGTAATAGTAGAAAGAGGG - Exonic
1100940152 12:99716436-99716458 AAGGAGTAATGGAGGGTGGAAGG - Intronic
1101179735 12:102202252-102202274 GATGATTAATAAAGGGATGAAGG - Intergenic
1101408896 12:104453226-104453248 GAGGAAGGAGAGAGGGAAGAAGG - Intergenic
1101695724 12:107124140-107124162 GAGGGGTAATAGAGAGATGTTGG + Intergenic
1101718387 12:107331199-107331221 GAGGAGTCAGAGAGAGAAAAAGG - Intronic
1101944108 12:109122853-109122875 GGGGAATAATATAGGGAAAATGG - Intronic
1101982584 12:109420513-109420535 GAGGAGGAATAGAGTGAAGGGGG + Intronic
1102180317 12:110907608-110907630 GAGAAGTAAAAGCGGGAACAGGG + Intergenic
1102552503 12:113702082-113702104 AAGGAGAAAGGGAGGGAAGAAGG - Intergenic
1102598767 12:114012976-114012998 GAGGAGGGAGAGAGGGAGGAGGG + Intergenic
1102604274 12:114056719-114056741 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1103131954 12:118477026-118477048 GAGGAGAAAGAAAGGGAGGAAGG - Intergenic
1103145836 12:118595164-118595186 GAGGAATGAGAGAGGGAGGATGG + Intergenic
1103602661 12:122064022-122064044 GAGGAGCGATAGAGGGAAGTTGG - Intergenic
1104096596 12:125563784-125563806 AAGGAGAAATACAGAGAAGAAGG + Intronic
1104173760 12:126308748-126308770 GGGGACTATTAGAGGGGAGAGGG + Intergenic
1104374414 12:128251098-128251120 GAGGGATAATGGAGGGAAGGAGG + Intergenic
1104479920 12:129098884-129098906 GAGGATTAAGAGAGGGTAGGAGG - Intronic
1104676022 12:130713111-130713133 GGAGAGAAAGAGAGGGAAGAAGG + Intronic
1105597694 13:21854886-21854908 AAGGAGGAAGAGAAGGAAGAAGG - Intergenic
1105835543 13:24208004-24208026 TAGGAGTAATTTAGGGAAGTTGG + Intronic
1106041360 13:26096840-26096862 AAGGAGAAAGAGAAGGAAGAGGG - Intergenic
1106356391 13:28987432-28987454 GAGGAGTAAATGAGAGATGAGGG + Intronic
1106491589 13:30229165-30229187 GAGGAGCCATAGAAGGAAAAGGG - Intronic
1106583346 13:31036384-31036406 GAGGAGGAAGAGAGGGCAGTGGG - Intergenic
1106726215 13:32488396-32488418 GTGGACTACTAGAGGGTAGAGGG + Intronic
1106800213 13:33248592-33248614 GAAGAGGAATAGAGGGATGGGGG - Intronic
1107448066 13:40485714-40485736 GAGGAGGTGTAGAGAGAAGAAGG - Intergenic
1109065385 13:57682152-57682174 TAGGAGTATAAGAAGGAAGATGG - Intronic
1109181580 13:59220075-59220097 GAGGAGGAAAAGGGGGAAGGGGG + Intergenic
1109313088 13:60718313-60718335 GAAGAGTAATTGAAGGTAGAAGG - Intergenic
1110428152 13:75392601-75392623 GAGGAGGAGGAGGGGGAAGAAGG - Intronic
1110545145 13:76747585-76747607 GAGGAGGAAAAGAGGATAGAAGG - Intergenic
1110549745 13:76798874-76798896 GAGGAGTAAGAGGGAGCAGAGGG + Intergenic
1110556334 13:76863728-76863750 GAGGAGCAAGAGAGAGAGGAGGG - Intergenic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1111506152 13:89191600-89191622 AAGGAGAAATAAAGAGAAGATGG + Intergenic
1111630307 13:90840721-90840743 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1111639159 13:90946353-90946375 GAGGAGGAAGAGGAGGAAGATGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111887595 13:94042158-94042180 TAGGAGGAAGAGAGGGAAGGGGG - Intronic
1111918941 13:94390535-94390557 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1112409154 13:99147024-99147046 GAAGAGACATAGAGAGAAGATGG - Intergenic
1112616601 13:101013380-101013402 GAGGATTAATAGAGGAAATGAGG + Intergenic
1113024191 13:105922211-105922233 AAGAAGAAATGGAGGGAAGAGGG - Intergenic
1113191858 13:107758204-107758226 GAGGAATAATAGAGATAAGCAGG - Intronic
1113203215 13:107889234-107889256 AAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1113669453 13:112165765-112165787 GAGGAGGAGGAGAAGGAAGAGGG - Intergenic
1114129127 14:19769384-19769406 AAGGAGTAATAAAGGGATAAAGG - Intronic
1114281300 14:21194595-21194617 GAGAAATCATAGAGGCAAGAAGG + Intergenic
1114519674 14:23325312-23325334 GAGGAAAAAAAGAGGAAAGAAGG + Exonic
1114655741 14:24314691-24314713 GAGCAGTGAGAGAGGAAAGAGGG - Exonic
1114853113 14:26404391-26404413 GAGGAGGAATGGAGGAAGGATGG + Intergenic
1115054520 14:29106503-29106525 AAGGAGGAAGAGAGTGAAGAGGG - Intergenic
1115619423 14:35126518-35126540 GAGGAGAACCACAGGGAAGAAGG + Intronic
1116010622 14:39347410-39347432 GAGGAGGAAAAGAAGGAAGGAGG + Intronic
1116863740 14:50014922-50014944 GAGGAGAAAGAAAGAGAAGAAGG + Intergenic
1116974877 14:51105049-51105071 GAGGGGTAATTGAAGGTAGAAGG + Intergenic
1117214965 14:53541553-53541575 GAGAAGAGAAAGAGGGAAGAGGG + Intergenic
1117237381 14:53792610-53792632 GAGGAGGAACATGGGGAAGAAGG + Intergenic
1117315395 14:54567038-54567060 GAGGAGTAAGAGGAGGAGGAAGG + Intergenic
1117622473 14:57601464-57601486 GGGGACTACTAGAGGGAGGAGGG - Intronic
1117971342 14:61253959-61253981 GAGGAGGGAGGGAGGGAAGAAGG - Intronic
1118171781 14:63395727-63395749 GAGGAGGAGCAGAGGGAAAAGGG + Intronic
1119022277 14:71125555-71125577 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1119118193 14:72046637-72046659 GAGGAAGAGTAGAAGGAAGAAGG - Intronic
1119763915 14:77175998-77176020 CAGGGGTAAGAGAGGGCAGAGGG + Intronic
1120470540 14:84918273-84918295 GAGAAGAAAAAGAAGGAAGAAGG - Intergenic
1120649127 14:87109907-87109929 GAGGAGAAATAGAGAGAAAGTGG - Intergenic
1120739781 14:88095318-88095340 GGAGAGAAACAGAGGGAAGATGG - Intergenic
1120775049 14:88425328-88425350 GAGGAATAACAAGGGGAAGATGG - Intronic
1120781762 14:88491988-88492010 AATAAGTAAAAGAGGGAAGAGGG - Intronic
1121104184 14:91270131-91270153 GAGGAGGAAGAGAGGGAAGGAGG - Intergenic
1121361363 14:93263709-93263731 GAAGAGTAATAGAGCATAGATGG + Intronic
1122324784 14:100875626-100875648 GAGGGGTGAGAAAGGGAAGATGG - Intergenic
1122565670 14:102653718-102653740 GAGGAGCAAGAGAGACAAGAGGG - Intronic
1123826872 15:24091492-24091514 AAGGAGGAATAGATAGAAGAGGG + Intergenic
1123841479 15:24252356-24252378 AAGGAGGAATAGATAGAAGAAGG + Intergenic
1123856261 15:24415323-24415345 AAGGAGGAATAGATAGAAGAGGG + Intergenic
1124354016 15:28981988-28982010 AAGGACTACTAGAGGGCAGAGGG + Intronic
1125281587 15:38047549-38047571 CAGGAGGAAAAGAGGGAAGGGGG + Intergenic
1125487544 15:40122872-40122894 GAGGAGAAGTACAGGGAAAATGG + Intergenic
1125711335 15:41789380-41789402 GAAGAGAAAGAGAGGGCAGAAGG + Intronic
1125734378 15:41913401-41913423 GAGGAGTACGAAAGAGAAGAGGG + Intronic
1125843206 15:42825147-42825169 AAGGAATATGAGAGGGAAGAGGG + Intronic
1126299964 15:47184428-47184450 GAGGAGAAATGGAGAGAAAAGGG - Intronic
1126321471 15:47428926-47428948 GAGGAGGAAGAGAGGGAGGGAGG + Intronic
1126362800 15:47863577-47863599 GGGGAGGAAAAGAGGGAGGAAGG + Intergenic
1126525887 15:49653880-49653902 AAGGAAAAATAGATGGAAGATGG + Exonic
1126639227 15:50807842-50807864 GAGGAGTAAGATAGGGAAGGGGG + Intergenic
1126860701 15:52879974-52879996 GAGCAGAAAGAGAAGGAAGAGGG - Intergenic
1127249554 15:57217634-57217656 GAGGAGGAATAGGGAGAAGAGGG - Intronic
1127744791 15:61956314-61956336 GGGGACTACTAGAGGGGAGAGGG + Intronic
1128095660 15:64952740-64952762 GAGGAGGAGAAGAGGAAAGAAGG - Intronic
1128589033 15:68878090-68878112 TAGGAGTATTGGAGGGGAGAAGG + Intronic
1128783219 15:70376510-70376532 GAGGAGGAAGAGAGAGAAGGCGG + Intergenic
1128783231 15:70376554-70376576 GAGGAGGAAGAGAGAGAAGGCGG + Intergenic
1129138174 15:73572978-73573000 GAGGAGGAAGAGAGTGAAGGAGG - Intronic
1129665312 15:77576322-77576344 GAGGAGGAGGAGGGGGAAGAGGG + Intergenic
1129676080 15:77632931-77632953 GAGGAGGGATCGAGGGAGGAGGG + Intronic
1130225956 15:82058687-82058709 GAGGAGGAGAAGAGGGAGGATGG - Intergenic
1130667442 15:85881568-85881590 AAGGAGTAGTGGAAGGAAGAGGG - Intergenic
1130713299 15:86305638-86305660 GAGTAGTAATAGGAGGAATATGG - Intronic
1130883228 15:88072781-88072803 GAGGAGCAAGAGAGGGAAAGCGG + Intronic
1130890275 15:88127686-88127708 GAGGAGTAAAGAAGGAAAGAGGG - Intronic
1131164707 15:90134038-90134060 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1131770058 15:95727506-95727528 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1131950920 15:97681012-97681034 CAGGAGTAATAGAAGTAAGTGGG + Intergenic
1132226997 15:100150571-100150593 GAGGAGGGACAGAGGGAGGAAGG - Intronic
1132373104 15:101311425-101311447 CAGGAGCAAGAGAGGGAAGGAGG - Intronic
1133417353 16:5616764-5616786 GAGGAGGAAAATAGGGGAGAAGG - Intergenic
1133513707 16:6485332-6485354 GAGGGGTAAGAGAGGGAGGGAGG - Intronic
1133663052 16:7937510-7937532 GGGGAGGAAGGGAGGGAAGAAGG - Intergenic
1134288001 16:12879208-12879230 AAGGAGGAAGAGAGGGAGGAAGG - Intergenic
1134375216 16:13665897-13665919 GAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1134781830 16:16905189-16905211 CAGGAGGAAGAGAGTGAAGAGGG - Intergenic
1135263325 16:21000003-21000025 AAGGAGAAAAGGAGGGAAGAAGG + Intronic
1135276468 16:21117519-21117541 GATGAGTAATCCAGGCAAGAAGG - Intronic
1135627174 16:24006076-24006098 GATAAGTGAGAGAGGGAAGAAGG - Intronic
1135655090 16:24241409-24241431 AAGGAGCAGTAGAGGGAAAAGGG + Intergenic
1135784897 16:25340041-25340063 GAGGAGCAAGAGAGGGAGGGGGG - Intergenic
1135877756 16:26219191-26219213 GGGAAGTAATAGAGAGAAAAAGG - Intergenic
1135887707 16:26326504-26326526 AAGGAGGAAAGGAGGGAAGAAGG + Intergenic
1135891777 16:26363797-26363819 GAGGAGAAAGAGAAAGAAGAAGG - Intergenic
1136073648 16:27803995-27804017 GATGAATAATAGATGGATGATGG + Intronic
1136095982 16:27957002-27957024 GAGGAGGAAGACAGGGAAGTAGG + Intronic
1136402929 16:30028337-30028359 GAGGATTAAAGCAGGGAAGACGG + Intronic
1137055532 16:35744765-35744787 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1137219836 16:46437618-46437640 AAGGAGGAAATGAGGGAAGAAGG - Intergenic
1137465718 16:48707123-48707145 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1137758794 16:50923963-50923985 AAGGAGAAAAAGAGGGAGGATGG + Intergenic
1137924460 16:52526687-52526709 CAGGCGTAGTAGAGAGAAGAGGG + Intronic
1138128426 16:54457442-54457464 GAGGAGAAAAAGAGGAAGGAAGG - Intergenic
1138486729 16:57349938-57349960 GAGAAGGAAGAGAGGGAGGAAGG - Intergenic
1138575176 16:57903118-57903140 GAGGAGAGAGAGAGGGAAGGAGG + Intronic
1138725979 16:59139622-59139644 GAAGAGACATAGAGAGAAGATGG - Intergenic
1138788044 16:59869498-59869520 GGGGACTAATAGAGGCAGGAAGG + Intergenic
1139087024 16:63599154-63599176 GGGGAGTATTAGAGGAAAAAGGG + Intergenic
1139311644 16:66032842-66032864 GAAGAGTAATAAAGAGAGGACGG + Intergenic
1139317479 16:66086159-66086181 GAGGAGGAATAGAGGAGGGAGGG + Intergenic
1139328467 16:66169600-66169622 GAGGAGGAGGAGAGGGAGGAAGG + Intergenic
1139662436 16:68430205-68430227 GAGGGGGCATAGAGGGAAGAGGG - Intronic
1140496748 16:75396006-75396028 GAGAAGTCATGGAGGGGAGATGG - Intronic
1140798633 16:78464348-78464370 AAGGAGGAAGAGAGGGAAGGAGG + Intronic
1140806201 16:78534581-78534603 AAGGTGAAATATAGGGAAGATGG + Intronic
1141046951 16:80723895-80723917 GAGGAGAAATGGGGGGAAGGAGG + Intronic
1141059880 16:80856631-80856653 GAGTTGTAATAGATGGATGAAGG - Intergenic
1141068313 16:80931951-80931973 GAGGAGCGAGAGAGAGAAGAGGG + Intergenic
1141075318 16:81001183-81001205 GGGGACTAATAGACGGTAGAAGG + Intronic
1141211655 16:81986447-81986469 GAGGAGAAGGAGAGGGAATAGGG + Intergenic
1141224494 16:82102130-82102152 GAAGAGAAAAAGAGGGTAGATGG - Intergenic
1141675236 16:85514182-85514204 GAGGAGGAAGAGAGGGGAGGGGG - Intergenic
1141713937 16:85716355-85716377 GAGGAGGAAGGGAGGGAAGGAGG + Intronic
1141807598 16:86352146-86352168 GAGGAGTAATGGGGGGCAGGTGG - Intergenic
1142251420 16:88993706-88993728 GAGGAGGAAGGGAGGGAGGAGGG - Intergenic
1142421022 16:89970182-89970204 GGGGAGGAGGAGAGGGAAGATGG - Exonic
1142512691 17:407429-407451 GGGGACTACTAGAGGGAGGAGGG + Intergenic
1142553514 17:755961-755983 GAGCAGGAAGGGAGGGAAGAGGG - Intergenic
1142820486 17:2462628-2462650 GAGGAGGAAGAGAGGGAAGGAGG - Intronic
1143198240 17:5093478-5093500 GAAGAGTAATTTAGGAAAGATGG - Exonic
1143391328 17:6560950-6560972 GAGGAGGAAGAGGAGGAAGAGGG - Intergenic
1143590120 17:7880288-7880310 GAGAAGTAAGAGAGGGAAAGAGG + Intronic
1143671005 17:8396155-8396177 AAGGAATACTAGAGGGAAAAAGG + Intronic
1144352932 17:14416007-14416029 GAGGAGGGAGAGAGGGAAGGAGG - Intergenic
1144843039 17:18200265-18200287 GAGGAATGAAAGAGGGAAGGAGG + Intronic
1146090987 17:29877720-29877742 GAAGAGTAGTAGAGGGGTGAAGG + Intronic
1146488437 17:33262424-33262446 GAGGAGGAAGGGAGGGAGGAAGG + Intronic
1146734900 17:35230356-35230378 CAGGATGAATAGAGGGAAGGGGG + Intergenic
1146914003 17:36666504-36666526 GAGGAGGAAGAGAGGGAAAAAGG + Intergenic
1147498753 17:40942321-40942343 GAGGGGGAAGAGAGGGAGGAGGG - Intergenic
1147571435 17:41573458-41573480 GAGTATTCTTAGAGGGAAGAAGG - Intergenic
1147669319 17:42167672-42167694 GAGGCATAACAGGGGGAAGATGG - Intronic
1147676577 17:42210656-42210678 GGAGAGGAAAAGAGGGAAGAAGG + Intronic
1148000892 17:44386240-44386262 GAGGTGTCATTGAGGAAAGATGG - Intronic
1148158219 17:45435491-45435513 GAGGAGAAATAAAGGAGAGATGG - Intergenic
1148673838 17:49433359-49433381 GAGAAGGAAGGGAGGGAAGATGG + Intronic
1148745138 17:49913903-49913925 GAGGAGGAAGAGGAGGAAGATGG + Intergenic
1148851369 17:50557049-50557071 GAGGTGGAAGAGAGGGAGGATGG + Intergenic
1149013292 17:51880204-51880226 CAGGAGGAATAAAGGGAGGAGGG - Intronic
1149052967 17:52328792-52328814 GAGGAAGAAGAGGGGGAAGAGGG - Intergenic
1149079382 17:52635426-52635448 GTGGATTACTAGAGGGGAGAGGG + Intergenic
1149136760 17:53375758-53375780 GGGGAGTACTAGAGGGAAGGAGG - Intergenic
1150748817 17:67840513-67840535 GAGGAGGAAAAGGGGGAAGGGGG - Intronic
1151050916 17:70978240-70978262 AAGGAGAGATGGAGGGAAGAAGG + Intergenic
1151432729 17:74075158-74075180 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1151641022 17:75394068-75394090 GAGGAGTAAAGGAGGAAAGGCGG - Intronic
1151677977 17:75609628-75609650 GAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1152322357 17:79614821-79614843 GAGGAGAAAAAGAAGAAAGAGGG + Intergenic
1152475777 17:80517050-80517072 GAAAAGTAAAAGAGGAAAGAGGG + Intergenic
1153170220 18:2307869-2307891 CAGGAGCAAGAGTGGGAAGAAGG - Intergenic
1153324034 18:3799806-3799828 GAGGAGTATTAGCGGGAGGGAGG - Intronic
1153574120 18:6503974-6503996 GAGGAGGAAGGGAGGGAGGAGGG + Intergenic
1153597557 18:6743107-6743129 GAGAAGGAAGAGAGAGAAGAGGG + Intronic
1155853981 18:30808942-30808964 GGGGAGTAATAGAGGGAGGAGGG - Intergenic
1156211181 18:34944758-34944780 AAGGAGCAAAAGAAGGAAGAAGG + Intergenic
1156250865 18:35351542-35351564 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1156252079 18:35360774-35360796 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1156406856 18:36791102-36791124 GAGGAGGAAGAGAGTGAAGGGGG - Intronic
1156472871 18:37388444-37388466 GAGGAGGAAGACAGAGAAGAAGG - Intronic
1156509983 18:37628260-37628282 GAGGAGTAGTGAAGGAAAGAGGG - Intergenic
1156632884 18:38991527-38991549 AAGGAGGAAGAGAGGGAGGAGGG + Intergenic
1156824835 18:41418568-41418590 CAGGAATAAAAGAGGGAAGAAGG - Intergenic
1157349226 18:46870045-46870067 GAGGAGGAATTGAGTGAAGGGGG - Intronic
1157410420 18:47458601-47458623 GATGAGAAAGAGAGAGAAGAGGG + Intergenic
1157569901 18:48705348-48705370 GAGGAGACACAGAGGGATGAAGG - Intronic
1157769699 18:50334982-50335004 TAGGAGTAAGAGAGAGAAGGGGG - Intergenic
1158079886 18:53577278-53577300 CAGGAGAAAGAGAGGGAAGCAGG - Intergenic
1158183972 18:54750420-54750442 AAGGAGGAAAAGAAGGAAGAAGG - Intronic
1158221400 18:55154460-55154482 GACGAGTGATAGAAGGAAGTTGG + Intergenic
1158516896 18:58138322-58138344 GAGGAGGAGGGGAGGGAAGAAGG - Intronic
1158522086 18:58180030-58180052 GTGGAGGAATAGAGAGAATAGGG - Intronic
1158686534 18:59620087-59620109 GAGGAGGGAGAGAGGGGAGAAGG + Intronic
1158751758 18:60270247-60270269 GAGGAGGGAGAGAGGGAAGGAGG - Intergenic
1159030849 18:63229580-63229602 AAGGAGTAAGAGAGAGGAGACGG - Intronic
1159079756 18:63724063-63724085 GAGGAGGAAGAGAAGGAAGAAGG - Intronic
1159300980 18:66567293-66567315 AAGGAGGAAGAGAGGGAATAAGG + Intronic
1159310262 18:66698469-66698491 GAGGAGAAAGGGAGGGAAGAAGG + Intergenic
1159310294 18:66698563-66698585 GAGGAGAAAGGGAGGGAAGGAGG + Intergenic
1159504967 18:69324743-69324765 GAGGAGGAGAAGAGGGAACAAGG + Intergenic
1159672208 18:71235694-71235716 GGTGAGGAATAGAAGGAAGATGG + Intergenic
1159999543 18:75003516-75003538 AAGGAATAAGAAAGGGAAGAAGG - Intronic
1160356147 18:78229695-78229717 GAGGAGGAAGGGAGGGAGGAAGG - Intergenic
1160373016 18:78390331-78390353 GAGGAGGGAGAGAGGGAGGAGGG + Intergenic
1160478845 18:79219656-79219678 GAGGAGAAAGAAAGAGAAGAGGG - Intronic
1160502508 18:79409228-79409250 GAGGAATAATGGATGGATGATGG - Intronic
1160502534 18:79409374-79409396 GAGGAATAATGGATGGATGATGG - Intronic
1160503372 18:79413440-79413462 GAGGAGTCATGGGGAGAAGACGG - Intronic
1160712794 19:560404-560426 GAGGAGGGCTAGGGGGAAGAAGG + Intergenic
1161035153 19:2080262-2080284 GGGGAGTCAGAGAGGGGAGAGGG + Intronic
1161329093 19:3677968-3677990 ATGGAGGAATAGAGGGAAGGAGG + Intronic
1161845254 19:6708500-6708522 AAGGAGGAATGGAGGGAGGAAGG - Intronic
1161868079 19:6849243-6849265 GGGGAGCACTAGAGGGAGGAGGG - Intronic
1162028770 19:7908576-7908598 CAGGAGGAAAAGAGGGGAGAGGG + Intronic
1162071898 19:8157912-8157934 GAGGAGAAAGAGAGGAAGGAAGG + Intronic
1162341954 19:10096583-10096605 GAGGAGGAACGGAAGGAAGACGG + Intronic
1163148989 19:15400109-15400131 GAGGAGGAAGAGTGGGAAGGGGG + Intronic
1164004230 19:21134243-21134265 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1164149713 19:22540797-22540819 GAGGAGGAGGAGAGGGGAGAGGG + Intergenic
1164324460 19:24179717-24179739 GAGGAAGTAAAGAGGGAAGAAGG + Intergenic
1164485277 19:28650507-28650529 GAGGACTACTACAAGGAAGATGG - Intergenic
1164505171 19:28854294-28854316 TAGGAGTGAGAAAGGGAAGAGGG - Intergenic
1164744224 19:30599351-30599373 GAGGAGGAAGGGAGGGAAGGAGG - Intronic
1164790341 19:30972133-30972155 GAGGAGTAAGAGCGAGAAGACGG - Intergenic
1164892188 19:31833663-31833685 GGGGACTACTAGAGGGGAGAGGG - Intergenic
1165127651 19:33611758-33611780 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1165281823 19:34804260-34804282 TAGGAGTAATTGAAGAAAGATGG - Intergenic
1165787142 19:38468419-38468441 GATGACAGATAGAGGGAAGAAGG - Intronic
1166040360 19:40198586-40198608 GGGGAGTAAGGGAGGGAGGAAGG + Intronic
1167374527 19:49103809-49103831 GGGGAGTCGTAGAGGGGAGACGG - Intronic
1167608138 19:50492703-50492725 GAGGAGGAGGAGAAGGAAGAAGG + Intergenic
1167798131 19:51724116-51724138 TGGGAGTAATAGCGGGAAGCGGG - Intergenic
1167859423 19:52270794-52270816 AAGAAGGAATAGAGGGAAGAAGG + Intronic
1167862832 19:52298746-52298768 GAGAAGGAATAGAAGGAAGAAGG + Intronic
1167867152 19:52337497-52337519 GAGAAGGAATAGAGGGAAGAGGG + Intronic
1167889633 19:52528924-52528946 GAGAAGGAATAGAGGGAAGAAGG + Intronic
1167890751 19:52537237-52537259 GAGGAGTAATAGAGGGAAGAAGG + Intronic
1167898779 19:52602454-52602476 GAGAAGTAATAGAGGGAAGAAGG + Intronic
1167903111 19:52637103-52637125 GAGAAGGAATAGAGGGAAGAAGG - Intronic
1167904512 19:52647723-52647745 GAGAAGGAATAGAGGTAAGAAGG - Intronic
1167909244 19:52688614-52688636 GAGAAGGAATAGAGTGAAGAAGG - Intronic
1167913627 19:52723192-52723214 GAGAAGCAATAGAGGGAAGAAGG - Intronic
1167915003 19:52733754-52733776 GAGAAGGAATAAAGGGAAGAAGG - Intronic
1167921256 19:52785182-52785204 GAGAAGTAATAGAGGGAAGAAGG - Intronic
1167924297 19:52810731-52810753 GAGGAAAAAAAGAGGAAAGAAGG + Intronic
1167940306 19:52941400-52941422 GAGAAGTAATAGAGGGAAGAAGG - Intronic
1167958804 19:53089891-53089913 GAGAAGGAATGGAGGGAAGAAGG - Intronic
1167964361 19:53131672-53131694 GAGAAAGAATAGAGGGAAGACGG - Intronic
1168125654 19:54281099-54281121 GAGGAGAAATGCAGGGAAGTAGG + Exonic
1168228127 19:55011211-55011233 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1168433798 19:56302294-56302316 GAGGGAGAAAAGAGGGAAGAAGG - Intronic
925330325 2:3053535-3053557 GAGGAATAAAAGTGGGAAGGAGG + Intergenic
925547029 2:5027804-5027826 GGGAAGTAATAGAGGAAAGAGGG - Intergenic
925640300 2:5980809-5980831 GAGGAGCAATAGAGGGACCCAGG - Intergenic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
926049790 2:9737516-9737538 GAGGAGTACTAGAGGGAGTAGGG - Intergenic
926210537 2:10866167-10866189 CAGGAGGAGGAGAGGGAAGAGGG - Intergenic
926412532 2:12619617-12619639 GAGGAAGAAGAGAGGGAGGAGGG - Intergenic
926451163 2:13005935-13005957 GAGGAGGAACAGAGGCAGGAAGG - Intergenic
926463306 2:13160836-13160858 CAAGTGTCATAGAGGGAAGATGG - Intergenic
926994323 2:18717473-18717495 GAGGAGTAAGGGAGGCGAGAGGG - Intergenic
927829897 2:26340690-26340712 GTGGAGTAATAAAGGGGAGGAGG + Intronic
927842244 2:26453158-26453180 CAGGAGAAAGAGTGGGAAGAAGG - Intronic
928406949 2:31022181-31022203 GGGGAGGAAGGGAGGGAAGAAGG + Intronic
928543935 2:32311394-32311416 GAGAAAGAATATAGGGAAGATGG + Exonic
929103257 2:38338294-38338316 GGGGAGTACTAGAGGGGAGAGGG + Intronic
929304173 2:40341058-40341080 ATGGAGTAGTAGAGAGAAGAGGG + Intronic
929494252 2:42425476-42425498 GAAGAGAAATAGAGGGATGATGG + Intergenic
929711619 2:44272280-44272302 GAGGTTTAATAGGCGGAAGAAGG + Intergenic
929806913 2:45154175-45154197 GAGGAGGAATACAGGGGAAAGGG - Intergenic
929881865 2:45843811-45843833 GAGGAGTAGGAGAGAAAAGAAGG - Intronic
929975103 2:46626095-46626117 GGGGACTACTGGAGGGAAGAGGG - Intergenic
931082105 2:58785220-58785242 AAGGAGAAAGAGAGGGAAGTTGG + Intergenic
931322252 2:61182495-61182517 AAGGAAGAAGAGAGGGAAGAAGG - Intronic
931518870 2:63073431-63073453 GAGGACTACTAGAGGTAGGAGGG + Intergenic
931896772 2:66740409-66740431 GTTGAGGAATAGAAGGAAGAGGG + Intergenic
931948116 2:67332856-67332878 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
932539370 2:72636274-72636296 AAGGAAAAATGGAGGGAAGAAGG + Intronic
932627971 2:73314076-73314098 GAGGAGTAGAAAAGAGAAGAGGG + Intergenic
932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG + Intronic
932848095 2:75155415-75155437 GAGGAGAGAAAGGGGGAAGAAGG - Intronic
933071862 2:77869244-77869266 AAGGAGACATACAGGGAAGAAGG + Intergenic
933170020 2:79114875-79114897 GAGGAGGAAGAGAGTGATGATGG - Intergenic
933346532 2:81093081-81093103 GAGGAGAGAGAGAGGGAAGAAGG + Intergenic
934047335 2:88183604-88183626 GAGGAAGGAGAGAGGGAAGAAGG - Intronic
935140616 2:100349993-100350015 AAGGAGGAAGAGAGAGAAGAGGG - Intergenic
935248705 2:101242254-101242276 GTGGAGTGACAGAGGGTAGAAGG - Intronic
935420822 2:102867009-102867031 AAGGAGGCAAAGAGGGAAGAAGG + Intergenic
935798595 2:106670136-106670158 CAGGAGGAAGAGAGGGAAAAGGG - Intergenic
936233643 2:110725220-110725242 AAGGAGGAATGGAGGGAGGAAGG + Intergenic
936649005 2:114404807-114404829 GAGGAGCAAGAAAGGGAACAAGG - Intergenic
936848374 2:116866208-116866230 GAACAGTAATAGAAGGAAGGGGG + Intergenic
937755866 2:125538139-125538161 AAGGAGTAATGGAAGGAAGATGG + Intergenic
938198910 2:129357072-129357094 GAGGGGCATTAGAGGGGAGAAGG - Intergenic
938731102 2:134148459-134148481 AAGGAAGAAGAGAGGGAAGAAGG - Intronic
938748052 2:134299670-134299692 GAGGAATAAAAGAGGGGACAGGG - Intronic
939175184 2:138739993-138740015 GAGCAGAGATAGAGGGATGAGGG - Intronic
939297425 2:140286339-140286361 GAGGAGTAAAAGAGGGAGACTGG + Intronic
939321506 2:140628876-140628898 CAGGAGGAAGAGAGTGAAGAGGG - Intronic
939462901 2:142519619-142519641 GAGGAGGAATTGGGGGAGGAGGG + Intergenic
940086132 2:149861198-149861220 CAGGAGGAATAGAGAGAAAAGGG + Intergenic
940784049 2:157962972-157962994 GAGGGGGAAGAGAGGGAACAAGG + Intronic
941003257 2:160222649-160222671 GAGGAGAAAAGTAGGGAAGATGG + Intronic
941517254 2:166494487-166494509 GAGGAGGGGTAGAGGGGAGAGGG + Intergenic
942509543 2:176682809-176682831 GAGGAGGAAGAGAGGGAGGGAGG + Intergenic
942655302 2:178208741-178208763 AAGGAGGGAAAGAGGGAAGAAGG - Intronic
942813724 2:180026607-180026629 AAGGAGAAATAGAGTGAAGTGGG + Intergenic
942980137 2:182070878-182070900 TAGGAGGAAGAGAGGGAGGAGGG + Intronic
943835004 2:192507301-192507323 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
943980048 2:194538611-194538633 GAGGACTACTAGAGTGCAGAGGG - Intergenic
943995218 2:194754704-194754726 GAGGAGTAATAAAGGTCAGTAGG + Intergenic
944430375 2:199626630-199626652 GAGGAGGAAGAGAGGAAGGAAGG + Intergenic
944581092 2:201133507-201133529 GAGGAGAAATAGATGGCAGTAGG - Intronic
945449265 2:209974998-209975020 GAGGAGGAATATGGGTAAGAAGG + Intronic
945652038 2:212574801-212574823 GAGGAGGGATACAGAGAAGATGG - Intergenic
945860837 2:215120260-215120282 GCAGAGTACTAGAGGGAAGAGGG + Intronic
946025459 2:216669299-216669321 AAGGATTAAGAGAAGGAAGAGGG + Intergenic
946294611 2:218773966-218773988 AAGAAGAAAGAGAGGGAAGAAGG - Intergenic
946488660 2:220126215-220126237 GAGGAGGACTGCAGGGAAGAAGG + Intergenic
946492227 2:220159960-220159982 GAGGAGTAGGAGGGGGAGGAGGG - Intergenic
946531067 2:220570774-220570796 GAGGAGTAGGTGAGGGGAGAGGG - Intergenic
946698161 2:222383130-222383152 CAGGAGTGGTAGAGGCAAGAAGG - Intergenic
947094984 2:226556064-226556086 GTGGAGTAATTGATGGAACAAGG + Intergenic
947228978 2:227866494-227866516 GAGGAGGAGGAGAAGGAAGAAGG - Intergenic
947480711 2:230497410-230497432 GAGGAGGGAAAGAGGGAAGGAGG + Intronic
948091885 2:235302050-235302072 GAGGAGGAAGAGAGAGAAGGGGG - Intergenic
948458425 2:238117972-238117994 GAGGAGAAATAGATGGAGGAAGG + Intronic
948458434 2:238118001-238118023 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458442 2:238118030-238118052 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458512 2:238118284-238118306 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458630 2:238118715-238118737 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458661 2:238118815-238118837 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458740 2:238119140-238119162 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458754 2:238119183-238119205 GAGGAGGAATGGATGGAGGAGGG + Intronic
1168733542 20:109447-109469 GTGGATTACTAGAGGGAGGAGGG + Intergenic
1169585983 20:7086045-7086067 GAGGAGGAAAAGAAGGAAGGAGG - Intergenic
1169881188 20:10349222-10349244 TAGGACTGATAGAGAGAAGAAGG - Intergenic
1170032688 20:11959300-11959322 GAGGGGGAAGAGAGAGAAGACGG + Intergenic
1171269144 20:23799819-23799841 GAGGAGGAAGAGAGTGAACAGGG - Intergenic
1171490861 20:25516107-25516129 CAGGAGGAATAGAGTGAAGCGGG - Intronic
1171753227 20:29076155-29076177 CAGGACTACTAGAGGGGAGAAGG - Intergenic
1171789027 20:29501405-29501427 CAGGACTACTAGAGGGGAGAAGG + Intergenic
1171858501 20:30373093-30373115 CAGGACTACTAGAGGGGAGAAGG - Intergenic
1171980883 20:31627925-31627947 AAGTAGACATAGAGGGAAGATGG + Intergenic
1172174486 20:32963855-32963877 GAGGAGGAGGAGATGGAAGAAGG - Intergenic
1172798040 20:37556806-37556828 GAGGAGAAGGACAGGGAAGATGG - Intergenic
1172815824 20:37685149-37685171 GAGGAGGAAGGGAAGGAAGAGGG + Intergenic
1172979735 20:38931881-38931903 GAGGAGAAATAAAGGGCAGGGGG + Intronic
1173149969 20:40558646-40558668 AAGAAATAATGGAGGGAAGAAGG + Intergenic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1173285950 20:41671555-41671577 GTTGAGTAAGGGAGGGAAGAAGG - Intergenic
1173300048 20:41794437-41794459 TAGGAGAAAAAGAGGAAAGAAGG - Intergenic
1173380482 20:42535311-42535333 GGGGAGTACTTGAGGGTAGAGGG + Intronic
1174526627 20:51176934-51176956 GTGGAGGAACAGAGGGAAGTGGG + Intergenic
1174631338 20:51960658-51960680 AAGGTGGAATAGAGGGAGGAGGG + Intergenic
1175025247 20:55894855-55894877 GAGGAAGAATAGAGGAAGGATGG + Intergenic
1175127539 20:56763661-56763683 GAGAAGAAAAATAGGGAAGAAGG + Intergenic
1177093542 21:16801186-16801208 TAGTACTAATAGAGGAAAGAAGG - Intergenic
1177928351 21:27248196-27248218 GAGGAGGAGGAGAGAGAAGAAGG - Intergenic
1178062842 21:28871351-28871373 CAGGAGGAAGAGAGCGAAGAGGG + Intergenic
1178186917 21:30232993-30233015 GAGGACTACTAGAGGAGAGAGGG + Intergenic
1178310262 21:31524302-31524324 GAGGAGCAAGAGAGAGTAGAGGG + Intronic
1178506693 21:33168635-33168657 GAGGAGTGAAAGAGGGAGGTGGG + Intronic
1178607366 21:34051484-34051506 AAGGAGGAAGAGAGGAAAGAGGG + Intergenic
1178777553 21:35566551-35566573 GAGGAAGAATAGAGGGAGGAAGG - Intronic
1178887558 21:36495863-36495885 GAGGAGACACAGGGGGAAGAGGG + Intronic
1179031451 21:37723751-37723773 GGGGACTACTAGAGGGGAGAAGG + Intronic
1179137202 21:38690074-38690096 AGGGAGGAAGAGAGGGAAGAAGG - Intergenic
1179525589 21:41974036-41974058 GAGGAGGAAAACAGGGAAGAAGG - Intergenic
1179601588 21:42481227-42481249 GAGGAGGAAAAGAGGGGAGGAGG - Intronic
1179650519 21:42805501-42805523 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1179984586 21:44913512-44913534 GAGGAGCAACAGTGGGGAGAAGG - Intronic
1181291406 22:21796675-21796697 AAAGAGTAAGAGAGGGAAGGAGG + Intronic
1182438030 22:30343278-30343300 GAGCAGAAATAGAGGGAGGTGGG - Intronic
1182818961 22:33196776-33196798 GAGGAGGAAAAGAGGGAGGAGGG + Intronic
1183115633 22:35690547-35690569 GAGGAGAAGGGGAGGGAAGAGGG + Intergenic
1183130772 22:35833215-35833237 GAGGAGTAATTCAAGGAAGTAGG + Intronic
1183381213 22:37491476-37491498 GAAGAGTCAGAGAGAGAAGATGG + Intronic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1184062016 22:42089019-42089041 GAGGAGGAAAAGAAGGCAGAGGG - Intronic
1184120548 22:42447002-42447024 GAGGAGACACAGAGGAAAGAGGG + Intergenic
1184137244 22:42556471-42556493 GAGAATGAATAGGGGGAAGAAGG - Intronic
1184449807 22:44576137-44576159 GAGGAGTAAGAGAAAGAAGGAGG + Intergenic
1185261778 22:49869964-49869986 GAGGAGTGAGGGAGGGAGGAAGG - Intronic
949889408 3:8722393-8722415 CAGGAGGAAGAGAGAGAAGAAGG - Intronic
950281266 3:11710048-11710070 CAGGAGCAAAAGAGGCAAGAAGG + Intronic
950586110 3:13893731-13893753 GAGACGTAAGAGAGGGAGGATGG - Intergenic
950951138 3:17000564-17000586 GAGGGGGAATAAAGAGAAGATGG - Intronic
951008014 3:17641585-17641607 GAGGAGGAATAGGAGGAGGAAGG - Intronic
951021639 3:17787297-17787319 GAGGAGGAAGAGAGGGAAGTGGG - Intronic
951574827 3:24102848-24102870 GAGGAGTGAGAGAGAGAAGGAGG - Intergenic
951894720 3:27599972-27599994 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
952030449 3:29135840-29135862 GAGGACTACTAGAGGGAGGAGGG + Intergenic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
952388167 3:32858075-32858097 GAGGAGGAAGAGAGAGAGGAGGG + Intronic
952663604 3:35878801-35878823 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
953167031 3:40474638-40474660 GAGGAGGAACAGGGGGATGAGGG + Intergenic
953203643 3:40800472-40800494 GAGGAGAAAGAAAGGGAAGCAGG - Intergenic
953230356 3:41059098-41059120 GGGGACTACTAGAGGGAGGAGGG - Intergenic
953599582 3:44349458-44349480 AAGGAGGAATGGAGGGTAGAAGG + Intronic
953637721 3:44676865-44676887 GAGGACTAATAGACGGAGGAGGG + Intergenic
953721954 3:45363919-45363941 GAGGAGGAATAGAAGAAGGAGGG - Intergenic
954095380 3:48322268-48322290 GAGGGGAAATAGTTGGAAGAGGG - Intronic
954479729 3:50787807-50787829 GAGGAGGAAGAGAGAGAGGAAGG - Intronic
955073807 3:55593886-55593908 GAGGAATACTTGAGAGAAGAAGG - Intronic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
955701332 3:61685011-61685033 GAGGAGTAACAGAGAGAGGGAGG - Intronic
955840773 3:63110445-63110467 GAGGAGGAAGAGAAGGAGGAGGG + Intergenic
955901853 3:63764383-63764405 GAGGAGAGAGAGAGGGAGGAAGG + Intergenic
957282798 3:78175093-78175115 GAGGTGAAGGAGAGGGAAGAAGG - Intergenic
957508850 3:81160907-81160929 GAGGAGTAAAGGAAGGAAGATGG + Intergenic
957550176 3:81694239-81694261 GAGGAGGAAGGGAGGGAAAAAGG + Intronic
957698170 3:83671554-83671576 CAGGAGGAAGAGAGGGAAGGGGG - Intergenic
957985267 3:87566628-87566650 GAGCTGTAATAGAAAGAAGAGGG + Intergenic
957989893 3:87614496-87614518 GAGGAGGAATTGAGTGAGGAGGG + Intergenic
958063246 3:88509850-88509872 GAGGAATAGTACAGGGAATAGGG - Intergenic
958739306 3:98049407-98049429 GAGGAGTGTGAGAGGGAGGAAGG + Intergenic
959182131 3:102994609-102994631 AAGGAAGAATAGAAGGAAGATGG + Intergenic
959479164 3:106850166-106850188 GGGGAGAAAGAGAGGGATGAAGG + Intergenic
959579098 3:107965900-107965922 GAGGGGTAAGAGAGTGAAGAGGG + Intergenic
959643682 3:108672055-108672077 GTGAAGTTATAGTGGGAAGACGG - Intronic
959690848 3:109196544-109196566 GAGGAGTAAGAAAGGGAGGAAGG - Intergenic
959912494 3:111779401-111779423 GGGGACTACTAGAGGGAGGAGGG - Intronic
960298833 3:115976777-115976799 GAGGAGAAAGAGAGTTAAGAGGG - Intronic
960298932 3:115977984-115978006 GAGGAGGAAGAGAGGAAGGAAGG - Intronic
960310259 3:116109751-116109773 GAGGAGGAATGGAGGGTGGAAGG + Intronic
960404590 3:117244398-117244420 GAGGAGCAAAAGATGGAAAAGGG - Intergenic
960671890 3:120162406-120162428 TAGGAGAAAAAAAGGGAAGATGG - Intergenic
960803724 3:121563179-121563201 GAGGAGAAATAGAGGAGAAAGGG + Intergenic
960803728 3:121563190-121563212 GAGGAGAAAGGGAGGGAAGGAGG + Intergenic
961035483 3:123638739-123638761 GAGGAGTAGGAGAGGCAGGAGGG - Intronic
961149132 3:124621497-124621519 GATGACTAAGAGATGGAAGATGG + Intronic
961345405 3:126260528-126260550 GGGGAGGAGGAGAGGGAAGAGGG - Intergenic
961689111 3:128655586-128655608 GAGGAGACATGGAGGTAAGAAGG - Intronic
961730434 3:128960991-128961013 GAGGAGGAATGGAGGGTGGAAGG - Intronic
961790420 3:129371961-129371983 GAGGACTACTAGAGGGAGGAGGG - Intergenic
962018305 3:131467595-131467617 CAGGAGGAAGAGAGGGAAGGGGG - Intronic
962101397 3:132346528-132346550 GAGGAGTCTTAGATGGAAGCTGG + Intronic
962116018 3:132508620-132508642 GGAGACTACTAGAGGGAAGACGG + Intronic
962355269 3:134688679-134688701 CAGGAGCAAAAGTGGGAAGAAGG + Intronic
962511142 3:136101832-136101854 GTGGAAAAATAAAGGGAAGAAGG + Intronic
962627837 3:137244695-137244717 AAGGAGTAATATAGGAATGATGG + Intergenic
962892665 3:139686169-139686191 CAGGAGGAAAAGTGGGAAGAAGG - Intergenic
962907256 3:139815424-139815446 AAGGAAAAATAGAGGGGAGAAGG - Intergenic
963408388 3:144898515-144898537 GAGCAGTAAGAGATGGAAGGTGG + Intergenic
963987772 3:151617155-151617177 GAGGAGGAAGAGAGGGGAGGGGG - Intergenic
964242343 3:154611261-154611283 GAGGGGGAAGGGAGGGAAGAAGG - Intergenic
964287450 3:155134292-155134314 GAGGATTAATAGAGGGTGGAGGG - Intronic
964937122 3:162103494-162103516 GGAGACTACTAGAGGGAAGAGGG - Intergenic
965023890 3:163273035-163273057 GAAGAGAAATAGGAGGAAGAAGG + Intergenic
965063712 3:163816050-163816072 GAGGACTACTAAAAGGAAGAGGG + Intergenic
965077087 3:163992884-163992906 GAGGAGACAGAGAGGGAGGAAGG + Intergenic
965110063 3:164409621-164409643 AAGGAGGAACAGAGGGAAGGAGG - Intergenic
965172168 3:165279838-165279860 GAGGAGAAGAAGAGAGAAGAAGG - Intergenic
965264904 3:166531061-166531083 AAGGAGAATTAGAGTGAAGAGGG + Intergenic
965286876 3:166828539-166828561 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
966066695 3:175828985-175829007 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
966092245 3:176154239-176154261 AAGGAGGAAAAGAGTGAAGAAGG - Intergenic
966262745 3:178000166-178000188 CAGGAGTAAGAGAGTGAAGGGGG - Intergenic
966319891 3:178690516-178690538 GAGGAGAATGAGAAGGAAGAAGG + Intronic
966459444 3:180159891-180159913 GAGGAGGAATAGAAGCAAGCCGG - Intergenic
966499275 3:180620371-180620393 TAGGAGTAAAAGAGGTAAAATGG + Intronic
966908573 3:184544755-184544777 GAGGAGGAGGAGAGGGAGGAGGG - Intronic
967194294 3:187013276-187013298 GGGAAGTAATAGATGGGAGAAGG - Intronic
967292605 3:187935939-187935961 CGGGAGTAATAGTGAGAAGAGGG + Intergenic
967986933 3:195102052-195102074 GAGGAGGAATGGAAGGAGGAAGG + Intronic
968236111 3:197030631-197030653 GGGGAGGAAGAGAGTGAAGAAGG + Intergenic
968744447 4:2352424-2352446 GAGGCGTGGAAGAGGGAAGAAGG + Intronic
968840934 4:3005355-3005377 GAGGTTAAAGAGAGGGAAGATGG + Intronic
969032128 4:4223951-4223973 GAGGAGAGAGAGAGGGAAGAGGG + Intronic
969141592 4:5078784-5078806 GAAGAGTAATAGAGGGTGGAGGG - Intronic
969617124 4:8260180-8260202 GAGGAGCAGGAGAGGGAAGGAGG - Intergenic
970118963 4:12731365-12731387 GATGAGGAATAAAGGGTAGAGGG - Intergenic
970676933 4:18461875-18461897 GAGGAGTAAAAGAAGAAAAATGG - Intergenic
970730283 4:19095137-19095159 GAGAAGAAAGAGAAGGAAGAGGG + Intergenic
970733725 4:19140701-19140723 GAGGAGCAAGAGAGTGAAGGGGG + Intergenic
970914892 4:21321589-21321611 GAGGAGGAAGAGGGAGAAGAAGG + Intronic
970986680 4:22166909-22166931 GTGGACTACTAGAGGGTAGAGGG - Intergenic
971073838 4:23125713-23125735 GAGGAGCATTAGAGGAGAGAGGG + Intergenic
971255422 4:25009478-25009500 GAGGGGAAATAAAGTGAAGAAGG - Intronic
971272468 4:25163480-25163502 GAGTAATAAAAGAGGGAAGCTGG - Intronic
971570942 4:28210001-28210023 GAGGAGGAAGAGGGGGAAGAGGG - Intergenic
972103268 4:35447996-35448018 GAGGAAGAAAAGAAGGAAGAAGG + Intergenic
972356261 4:38281807-38281829 GAGGAGGAGGAGAGGAAAGAAGG - Intergenic
972865434 4:43226550-43226572 GTGGACTACTAGAGGGGAGAGGG + Intergenic
972901084 4:43684251-43684273 GAGGAGTAGGAGGTGGAAGATGG + Intergenic
973628611 4:52797517-52797539 GAGGAGTGACAGAGGGATGAGGG + Intergenic
974179852 4:58370654-58370676 GTGGAGGAATAGAGAGAGGAAGG - Intergenic
974491885 4:62574293-62574315 AAGAAGAAATAGAGGAAAGAAGG + Intergenic
974660251 4:64879174-64879196 AAGGAGAGATAGAGGGAGGAGGG - Intergenic
975293616 4:72706620-72706642 AAGGAGAATGAGAGGGAAGAAGG + Intergenic
975380556 4:73695905-73695927 TTGGAGTAATAGAGAGTAGAAGG + Intergenic
975934038 4:79558429-79558451 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
976572751 4:86632627-86632649 GAGGAGAAAGAGAAAGAAGAAGG - Intronic
976574009 4:86647800-86647822 GAGAAGACATAGAGAGAAGATGG + Intronic
976794154 4:88913415-88913437 AAGTAGTAGTAGAGGGAAGAGGG + Intronic
976805157 4:89037809-89037831 GAGGAGGAAGAGAGGAAAGAGGG - Intronic
977183846 4:93911614-93911636 CAGGAGGAATAGAGGAAAGAGGG - Intergenic
978294397 4:107186683-107186705 GGGGACTGCTAGAGGGAAGAAGG + Intronic
978627837 4:110707660-110707682 GAGTAGTAAGAGAGGGTAGAGGG - Intergenic
978730654 4:112022877-112022899 GAGGAGAGAAAGAGGGAAGTTGG - Intergenic
979026588 4:115585084-115585106 GAGGACTACTAGAAGAAAGAGGG - Intergenic
979200432 4:117971370-117971392 AAGGAGGAAGAGAGGGAAGAAGG + Intergenic
979740809 4:124148298-124148320 GAAGAGAAAGAGAGGGAGGAAGG - Intergenic
979805814 4:124969638-124969660 GTGGACTACTAGAGAGAAGAGGG - Intergenic
979866404 4:125760387-125760409 GGGGAGGAAGTGAGGGAAGAGGG + Intergenic
981001018 4:139829129-139829151 AAGGAGTAAGGGAGGGAGGAAGG + Intronic
981040110 4:140214826-140214848 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
981254382 4:142644238-142644260 GAGGAGAAAGAGAAGGAAGGGGG + Intronic
981460919 4:145012990-145013012 TTGGAGGAAGAGAGGGAAGAGGG - Intronic
981624735 4:146742673-146742695 GAGGAGTAGAAGAGGAAAGAAGG - Intronic
982029168 4:151281973-151281995 GGGGAGAAAGAGAGGAAAGAAGG + Intronic
982226248 4:153170136-153170158 GAGGAGGAAGAGGGGGAAAAGGG + Intronic
982378011 4:154715926-154715948 GAAGAATAGTAAAGGGAAGAGGG - Intronic
982819594 4:159928931-159928953 GTGGACTACTAGAGGGGAGAGGG - Intergenic
982884277 4:160758674-160758696 GGGGACTACTAGAGGGAAGTGGG - Intergenic
983257014 4:165411322-165411344 GAAGAGGGATGGAGGGAAGAAGG - Intronic
983283501 4:165710429-165710451 GGAGAATGATAGAGGGAAGAAGG - Intergenic
983308062 4:166019292-166019314 GTGGACTACTAGAGGGGAGAGGG + Intronic
983552572 4:169032490-169032512 AAGAAGGAACAGAGGGAAGAAGG - Intergenic
984118238 4:175709225-175709247 GAGGAGGAGAAGAGGGAGGAAGG - Intronic
984125407 4:175803131-175803153 GAGGAGAAAGAGAAGGAAGAGGG - Intronic
984598820 4:181703532-181703554 GAAAAGTCATAAAGGGAAGAGGG - Intergenic
984842694 4:184082810-184082832 GTGAAGTAATTGAGGGAAAATGG + Intergenic
984928698 4:184827664-184827686 GAGGAGACATAGGGAGAAGATGG - Intergenic
985196787 4:187438893-187438915 GGGGACTAATAAAGGGAAGAAGG + Intergenic
985220059 4:187695062-187695084 GAGGAAAAATTGAGGGCAGAAGG - Intergenic
985383392 4:189419485-189419507 GAGGAGCACTTCAGGGAAGACGG + Intergenic
985629663 5:1008088-1008110 CAGGAGGAAGTGAGGGAAGAAGG + Intergenic
985993812 5:3585064-3585086 GAGGAGGAAAAGAGGGAGGAGGG + Intergenic
986193393 5:5516832-5516854 GAGGAGAAATGGAGGGTGGAAGG - Intergenic
986231392 5:5867465-5867487 GAGGGGTAGAAGTGGGAAGATGG - Intergenic
986533931 5:8766845-8766867 GAGGGGAGATGGAGGGAAGAGGG + Intergenic
986673851 5:10166974-10166996 GAGGAGACACACAGGGAAGAAGG + Intergenic
986800785 5:11257928-11257950 GAGGAGTAATAGGAGAATGATGG - Intronic
986919733 5:12666990-12667012 AAGGAGGAATAGAGGGTGGAAGG + Intergenic
986928545 5:12790347-12790369 GAGTAGAAATAGAGAGATGAGGG + Intergenic
987490001 5:18568004-18568026 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
987516256 5:18914241-18914263 GAGGACTACTAGAGGGAAAAGGG - Intergenic
987720981 5:21632345-21632367 GAGGACTAATAGGGGAAGGAGGG - Intergenic
987875648 5:23677167-23677189 GAGGAGTACTAGAGTGGGGAAGG + Intergenic
988027840 5:25722263-25722285 AAGGAGGAAGAGAGTGAAGAGGG - Intergenic
988219742 5:28328347-28328369 GAGGAGTACTAGATGGGATAGGG - Intergenic
988589685 5:32538063-32538085 GAGAAGCCACAGAGGGAAGAAGG - Intronic
988624512 5:32858730-32858752 GAGGACTACTAGAAGGAGGAAGG - Intergenic
989014354 5:36912277-36912299 GAGAAGGAATATAGGGAGGAGGG + Intronic
989536213 5:42566596-42566618 GAAGAGTAATAGAAGGGAAAGGG + Intronic
989615304 5:43332426-43332448 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
990182296 5:53174516-53174538 GAGGAGGAGGAGAAGGAAGAAGG + Intergenic
990240391 5:53811095-53811117 CAGGAGTAAGAGAGAGAAGGGGG + Intergenic
990384593 5:55247463-55247485 AAGGAGTAGTAGTGGGAAGTGGG + Intergenic
990425386 5:55682970-55682992 GAGGAGGAAAAGAGGGAGGGAGG + Intronic
990592722 5:57282601-57282623 GAGGAGGAAGAGAGTGAAGGGGG - Intergenic
990672807 5:58151416-58151438 GAGGAGTAATGGAGGGCTAAGGG + Intergenic
990986231 5:61643251-61643273 CAGGAGCAAGAGAGAGAAGAGGG - Intronic
991092899 5:62710085-62710107 GAGGAGGGAGAGAGGGAGGAAGG - Intergenic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
991659501 5:68935843-68935865 CAGGAGTAAGAGAAAGAAGAGGG - Intergenic
992090649 5:73312971-73312993 GAGGAGGAGGAGAAGGAAGAAGG - Intergenic
992161333 5:74006542-74006564 GAGGACTACTGGAGGGAGGAGGG - Intergenic
992259852 5:74958737-74958759 GAAAAGTAAGAGAGGGGAGAGGG + Intergenic
992353227 5:75952631-75952653 GAGGAGGAAGAGAGAGAAGGAGG - Intergenic
992420236 5:76596681-76596703 CAGGAGGAATAGAGAGAAGGGGG + Intronic
992452200 5:76885204-76885226 AAGGAGGAATGGAGGGTAGAAGG + Intronic
992719467 5:79545901-79545923 GAGGAGTGAAAGAGCAAAGAAGG - Intergenic
993541013 5:89151649-89151671 GAGGAGTAATGAAGAGAAGTCGG - Intergenic
993875821 5:93305505-93305527 AAGGAGAAAAAGAGGGAGGAAGG + Intergenic
994242488 5:97441280-97441302 GGGGAGGAATCAAGGGAAGAAGG + Intergenic
994603417 5:101937002-101937024 GAGGATTACTAGAGGGCGGAGGG - Intergenic
994775541 5:104032885-104032907 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
995150353 5:108836852-108836874 GAGGAGGAAGAGAGAGAAGGGGG - Intronic
995171223 5:109114957-109114979 GAGGAGGGAAAGAAGGAAGAAGG - Intronic
995275433 5:110272668-110272690 GAAGAGCAAGAGAGGGAATAAGG + Intergenic
995688662 5:114799238-114799260 AAGGAGGAATAGAGGGAAGGAGG + Intergenic
995731721 5:115250796-115250818 GGGGAGTACTAGAAGGAAGTGGG - Intronic
996516325 5:124373404-124373426 GAGTGGTAATAGAAAGAAGATGG - Intergenic
996575161 5:124971079-124971101 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
997174446 5:131760076-131760098 GTGGACTACTAGAGGGAAGAGGG + Intronic
997174514 5:131760855-131760877 CAGGAGGGAAAGAGGGAAGAAGG + Intronic
997448309 5:133959829-133959851 GAGGAGTAGGCGAGGGATGAGGG + Exonic
997759468 5:136431304-136431326 GAGGTGTGATGGAAGGAAGAAGG - Intergenic
998017077 5:138740819-138740841 GAAGAGGAAGGGAGGGAAGAAGG - Intronic
998393616 5:141804100-141804122 GAGGAGAGAGAGAGAGAAGAAGG - Intergenic
998398268 5:141833735-141833757 GAGGAGTGAAGGAGGGAGGAAGG + Intergenic
998734672 5:145122975-145122997 AAGGAGAGAGAGAGGGAAGAAGG - Intergenic
998743040 5:145226625-145226647 GGGGATTACTAGAGGGGAGAGGG - Intergenic
999256251 5:150211402-150211424 GAGGAGTGGGAGAGGGAAGGAGG - Intronic
999386283 5:151156548-151156570 AAGGAATAATGGAGGGAAAAGGG + Intronic
999632855 5:153588349-153588371 GAGGAGTAATGGAGGCATGGGGG - Intronic
1000747655 5:165055053-165055075 GAGGAGGAGTAGAAGGAGGAAGG - Intergenic
1001724890 5:173888448-173888470 GAGGAGGAAGAGGAGGAAGAAGG + Exonic
1001773645 5:174313030-174313052 GAGGAGGCATGGAAGGAAGAAGG + Intergenic
1001780848 5:174367839-174367861 TAGGAGAAAAAGAGGCAAGATGG + Intergenic
1001893818 5:175361913-175361935 GAGGAAAAAGAGAAGGAAGAGGG + Intergenic
1002110636 5:176908404-176908426 CAAGATAAATAGAGGGAAGAGGG + Intronic
1002439172 5:179255529-179255551 GTGGAGGCAGAGAGGGAAGATGG - Intronic
1002899548 6:1399463-1399485 GAGGAGGAGGAGAGGGAAGCAGG + Intergenic
1002995579 6:2280893-2280915 GAGAAGCAATAGACGGAAGAGGG + Intergenic
1003009221 6:2410489-2410511 GTGGAGGAAGAGAGGGAAGGGGG - Intergenic
1003709375 6:8571964-8571986 GAGGAACAATGGGGGGAAGACGG - Intergenic
1003759690 6:9162771-9162793 GAGGGGAAAGAGAGAGAAGAAGG + Intergenic
1003898369 6:10629561-10629583 TGGGAGTGATAGAGAGAAGAGGG + Intergenic
1004295568 6:14406842-14406864 GAGGAGTGAGAGAGGGAGGGAGG + Intergenic
1004423254 6:15489871-15489893 AAGGAGGAGGAGAGGGAAGAGGG - Intronic
1005049639 6:21673075-21673097 AAGGAGGAATAGAGAGTAGAAGG + Intergenic
1005275169 6:24209276-24209298 TAGTAGTAATAAAGGGAATATGG - Intronic
1005528172 6:26673190-26673212 AAGGAGGAAAAAAGGGAAGAAGG - Intergenic
1005542623 6:26828449-26828471 AAGGAGGAAAAAAGGGAAGAAGG + Intergenic
1006208021 6:32366923-32366945 GATGAATCATAGAGGTAAGAAGG + Intronic
1006371027 6:33643617-33643639 GAGGAGGAAAAGAAGGAAAAAGG - Intronic
1006814155 6:36839524-36839546 GGGAAGTGAGAGAGGGAAGAGGG + Exonic
1006932852 6:37697929-37697951 GAGGAGGAAGAGAGGGAGGGAGG - Exonic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007279644 6:40701614-40701636 GAGGACTCATAGAGGAAGGAAGG - Intergenic
1007783938 6:44269972-44269994 AAGGACTAACAGAGGGCAGAGGG - Intergenic
1008042451 6:46816495-46816517 GATGAGTGTTAGAGAGAAGAAGG + Intronic
1008125736 6:47666141-47666163 GAGGAGGAATAGGAGGAGGAGGG - Intronic
1008221691 6:48862313-48862335 GATGAGGCATAGAGGGCAGAAGG - Intergenic
1008664845 6:53706003-53706025 AAGGAGGAAGGGAGGGAAGAAGG + Intergenic
1008780528 6:55098459-55098481 GATGAGTAAAAGAGGTATGATGG + Intergenic
1008798476 6:55337138-55337160 GAGGAGAAATGGAGAGAAGTTGG - Intronic
1009013438 6:57870566-57870588 AAGGAGGAAAAAAGGGAAGAAGG + Intergenic
1009297446 6:61970857-61970879 GGGGAGTAGCAGTGGGAAGAGGG - Intronic
1009590925 6:65669984-65670006 GAGGAGTCAGAGAGGCATGATGG - Intronic
1009948359 6:70366066-70366088 AAGGAGGGATAGAGGGAGGAAGG + Intergenic
1010298657 6:74232087-74232109 GAGGAGGAAGGGAGGGAGGAAGG - Intergenic
1010298713 6:74232320-74232342 GAGGAGGGAGAGAGGGATGAAGG - Intergenic
1010457166 6:76069969-76069991 TGGGACTACTAGAGGGAAGAGGG + Intronic
1011033712 6:82950957-82950979 GAAGAGTAGTGGAGGGATGAGGG + Intronic
1011283866 6:85704058-85704080 GAGCAGGAAGAGAGAGAAGAGGG - Intergenic
1011417442 6:87137319-87137341 GAGGAGAAAGAGGGGGAAGGAGG - Intergenic
1011771090 6:90674660-90674682 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1012011860 6:93798391-93798413 GGGGAGTAATAGAAGGAAGTGGG + Intergenic
1012315675 6:97780855-97780877 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1012435813 6:99214314-99214336 GGGGACTACTAGAGGGAAGAGGG + Intergenic
1012530888 6:100234949-100234971 GAGAAGAAAGAGAGGGAAGGAGG + Intergenic
1012999084 6:106003937-106003959 GAGGAGTGACAGATGGAGGAAGG + Intergenic
1013205032 6:107936901-107936923 GAGGTCTAGTAGAGGGAGGAAGG - Intronic
1013342839 6:109232105-109232127 GAGGAGTGGCAGAAGGAAGAGGG - Intergenic
1013479278 6:110539285-110539307 GTGGACTACTAGAGGGAGGAGGG - Intergenic
1014045702 6:116883347-116883369 GAGTGGTAGAAGAGGGAAGAGGG - Intronic
1014318339 6:119894498-119894520 GAGGAGGAAGAGAAGGACGAAGG - Intergenic
1014405564 6:121046499-121046521 GTGGAGTGACAGAGGGTAGAAGG - Intergenic
1014555697 6:122841098-122841120 GAGGAGGAATGGAGGGTAGAAGG - Intergenic
1014794138 6:125706313-125706335 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
1015268944 6:131319395-131319417 GAGGACTACTAGAAGGGAGAAGG + Intergenic
1015308483 6:131736972-131736994 GAGGAGAAACACAGGGGAGAAGG - Intronic
1015547866 6:134379991-134380013 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1015973549 6:138767042-138767064 GAGAAGAAAGAGAGGGAAGGAGG - Intronic
1016091583 6:139985690-139985712 GAGGAGTGAGAGAGGAAGGAGGG - Intergenic
1016532628 6:145075251-145075273 AGGGAGGAAGAGAGGGAAGAAGG + Intergenic
1016546141 6:145226668-145226690 GATGAGAAATAGAGGGAACTGGG + Intergenic
1016568053 6:145480302-145480324 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1016589366 6:145728009-145728031 CAGGAGGAATAGAGAGAAGGGGG - Intronic
1016861322 6:148721478-148721500 GGAGAGTAACAGAGGGAAGCCGG - Intergenic
1017390155 6:153929427-153929449 GAGGGGTGGTAGAGGGAGGAGGG - Intergenic
1017454856 6:154592362-154592384 GAGGAGTAAGAGAGGGAGTTTGG + Intergenic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1018463033 6:164017205-164017227 ATGGAGAAATAGAGGGACGAGGG - Intergenic
1018548134 6:164961511-164961533 GGGGAGTAAGAGAGAGAATACGG - Intergenic
1018639007 6:165889902-165889924 GAGGAGTGAGGGAGGGAGGAGGG - Intronic
1018639021 6:165889946-165889968 GAGGAGTGAGGGAGGGAGGAGGG - Intronic
1018639042 6:165890020-165890042 GAGGAGTGAGGGAGGGAGGAGGG - Intronic
1018653513 6:166010651-166010673 GAAGAGTAACAGAGGGAACTGGG + Intergenic
1019103388 6:169649991-169650013 GAGGGGGAATAGAGGGATGGAGG - Intronic
1019327608 7:446008-446030 GAGGAGGGAGAGAGGGAGGAGGG + Intergenic
1019335180 7:479268-479290 GAGGAGGGAAGGAGGGAAGAGGG + Intergenic
1019830276 7:3321683-3321705 GAGGAGGAGGAGAAGGAAGAAGG - Intronic
1019860216 7:3651825-3651847 GAGCAGTAATAGAGAACAGAGGG + Intronic
1020011330 7:4807462-4807484 GGGGAGAAGGAGAGGGAAGAAGG - Intronic
1020961695 7:14812710-14812732 AAGAATTAATAGAGTGAAGAGGG - Intronic
1021293065 7:18869402-18869424 TAGGAGGAAGAGAGAGAAGAAGG - Intronic
1021673631 7:23058563-23058585 CTAGAGTGATAGAGGGAAGAAGG + Intergenic
1021943044 7:25698526-25698548 AACCAGTAGTAGAGGGAAGAAGG + Intergenic
1022673877 7:32480365-32480387 GAGTAGTGATAGAGGGATGAGGG + Intergenic
1022677285 7:32511775-32511797 GAGGAGTAAGGGGAGGAAGAAGG + Intronic
1022730454 7:33018336-33018358 GAAGGGTAAAAAAGGGAAGAGGG - Intronic
1022833750 7:34094338-34094360 GAAGAGTAATGGTGGGAATAGGG + Intronic
1023119764 7:36897564-36897586 GAGGAGTAGGAGAAGGAAGCTGG + Intronic
1023293001 7:38686875-38686897 GAGGAGTAACGGGGGGAAGGAGG + Exonic
1023361884 7:39425733-39425755 GAGGAGAAATGAAGGCAAGAAGG - Intronic
1023589391 7:41765118-41765140 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1023741714 7:43287172-43287194 GAGAAATAATACAGGGAATAGGG + Intronic
1023837694 7:44077978-44078000 GAGCAGAAACAGAGGGAAGGTGG + Intronic
1024157625 7:46640679-46640701 AAGGAGGAAAAGAGTGAAGAGGG + Intergenic
1024471157 7:49769849-49769871 GAAGAGCAAGGGAGGGAAGAAGG - Intergenic
1024538076 7:50454763-50454785 AAAGAGTCACAGAGGGAAGAAGG + Intronic
1024820238 7:53320223-53320245 GAGGAGAAACAAAGTGAAGAAGG - Intergenic
1025006544 7:55360108-55360130 GAGGAGTAAGATAGTGAAGGGGG + Intergenic
1025198714 7:56949445-56949467 GAGGAGGAATAGGGAGAAGGAGG - Intergenic
1025673234 7:63627486-63627508 GAGGAGGAATAGGGAGAAGGAGG + Intergenic
1025789867 7:64679615-64679637 GAGGAGGAATGGAGGGTGGAAGG - Intronic
1026198855 7:68196502-68196524 AAGGAGCAAGAGCGGGAAGAGGG + Intergenic
1026774033 7:73220252-73220274 GGAGAGTTATGGAGGGAAGATGG + Intergenic
1027014890 7:74773638-74773660 GGAGAGTTATGGAGGGAAGATGG + Intergenic
1027073141 7:75172315-75172337 GGAGAGTTATGGAGGGAAGATGG - Intergenic
1027209335 7:76132281-76132303 AAGCTGTAAGAGAGGGAAGAAGG + Intergenic
1027447040 7:78286209-78286231 GAGGAGGAATAGAGAGAGGGAGG - Intronic
1028167567 7:87555984-87556006 AAGGAGAAATAAAGGAAAGAAGG + Intronic
1028675207 7:93452008-93452030 GGGGACTACTAGAGGCAAGAGGG + Intronic
1028921327 7:96313600-96313622 GGGGACTACTAGAGGGAGGAGGG + Intronic
1029144954 7:98439267-98439289 GGGGAGGAAGAGAGGGAGGAAGG - Intergenic
1029327103 7:99819229-99819251 GAGGAGGGAGAGAGAGAAGAGGG - Intergenic
1029984620 7:104911711-104911733 CAGGAGAAATAGAGAGAATAAGG + Intergenic
1030367866 7:108666822-108666844 GAAGAAGAAGAGAGGGAAGAAGG - Intergenic
1030463301 7:109868053-109868075 AAGGACTACCAGAGGGAAGATGG + Intergenic
1030695202 7:112577634-112577656 CAGGAGCAAGAGAGTGAAGAGGG + Intergenic
1030799096 7:113827311-113827333 GAGGAGTAGAAGAGAGAAAATGG + Intergenic
1031216641 7:118901081-118901103 GATGAGGAAGGGAGGGAAGAAGG - Intergenic
1031296462 7:120010130-120010152 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1031360803 7:120846094-120846116 GAGGAGTAAGAGAGAGAAGGGGG + Intronic
1031422611 7:121568466-121568488 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1031448103 7:121879824-121879846 AAGGAGGAAGGGAGGGAAGAAGG - Intronic
1031490612 7:122383320-122383342 GTGGACTAGTAGAGGGGAGAGGG + Intronic
1031840981 7:126738860-126738882 GAGGAGTAGGGGAGGAAAGAAGG + Intronic
1032012027 7:128352891-128352913 GAGAAGTAGGAGAAGGAAGAGGG - Intronic
1032758059 7:134910527-134910549 GAGGAGTTATGGAGGTAAAAAGG + Intronic
1032887628 7:136158642-136158664 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1033084563 7:138330255-138330277 AAGGAGGAATAGAGGGTAGAAGG - Intergenic
1033211895 7:139466101-139466123 GAGGAGTAGTAGATAGCAGATGG - Intronic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033569939 7:142617770-142617792 GAGGAGAAAAAGAGGAAAAAGGG + Intergenic
1033610615 7:142960756-142960778 GGGGAGTAAAAGAGGCAGGATGG - Intronic
1033646252 7:143306844-143306866 GAGGGGTAATAGAAAGCAGAAGG - Exonic
1033646315 7:143307304-143307326 GTTGAATAAAAGAGGGAAGAAGG + Exonic
1033832600 7:145271570-145271592 GAGGAAGAAAAGAAGGAAGAAGG + Intergenic
1033926244 7:146464573-146464595 GAAGAGAAAAAGAGGGAAGAAGG - Intronic
1034014369 7:147566305-147566327 GAGGAGTAAGAGGAGGAGGAGGG + Intronic
1034068198 7:148156837-148156859 GAGAAGAAAGAAAGGGAAGAAGG - Intronic
1034121627 7:148633225-148633247 CAGGAGCAATAGAGGAAAGGGGG - Intergenic
1034212031 7:149372431-149372453 CAGGAGGAAGAGAGTGAAGAAGG + Intergenic
1035168932 7:157007286-157007308 GAGGAGAAAAAGAGGAAGGAAGG + Intronic
1035419667 7:158717150-158717172 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419693 7:158717283-158717305 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419753 7:158717611-158717633 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419768 7:158717685-158717707 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035707031 8:1683628-1683650 GGGGAGGAAGAGAGGGAAGCAGG + Intronic
1035992755 8:4510744-4510766 GAGGAGGGAAGGAGGGAAGAGGG - Intronic
1036286845 8:7450291-7450313 GAGGAGGCATAAAGGGAAAAGGG + Intronic
1036448740 8:8846324-8846346 GAGGAGTAGGAGGGGGAGGAGGG + Intronic
1036463999 8:8979213-8979235 GAAGAGCAAAAGAGAGAAGAGGG - Intergenic
1036571135 8:9980558-9980580 GAGGAGGGATTGAGGGAGGAGGG - Intergenic
1037035489 8:14161930-14161952 GAGAAGCAATAGGAGGAAGAAGG + Intronic
1037590955 8:20311691-20311713 GAGGAGGAAAAAAGGAAAGAAGG - Intergenic
1037694694 8:21213411-21213433 GTGGAGTAAGAATGGGAAGAGGG - Intergenic
1037799654 8:22025408-22025430 GAGGAGAAAGGGAGGGAAGTGGG - Intronic
1037972256 8:23180989-23181011 GAGGAGTAATGAAGAGAAGTGGG + Intergenic
1038125258 8:24666424-24666446 GAAGAGGAATAGAGGGAAATGGG - Intergenic
1038370628 8:26986412-26986434 GAGGAGGAAAAGAGGGGACAAGG - Intergenic
1038497384 8:28013249-28013271 GAGGAGGAAGAGAGGGAGCAAGG + Intergenic
1038579814 8:28738226-28738248 GAAGAGGTAGAGAGGGAAGATGG - Intronic
1039044427 8:33436915-33436937 GGGGACTACTAGAGGGGAGAAGG - Intronic
1039116692 8:34099261-34099283 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1039202916 8:35116594-35116616 GAGGGCTACTAGAGGGCAGAGGG - Intergenic
1039312391 8:36331225-36331247 AAGGAGTAATAGAAAGAATAGGG + Intergenic
1039407853 8:37328243-37328265 GAGGAGAGAGAGAGAGAAGAAGG - Intergenic
1039499149 8:38003160-38003182 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1040080913 8:43284099-43284121 GGAGACTAATAGAGGGAGGAGGG + Intergenic
1040509301 8:48079700-48079722 GAGGAGTAAGGAAGGGAGGAAGG + Intergenic
1041048832 8:53913616-53913638 AGGCAGTCATAGAGGGAAGAAGG + Intronic
1041392409 8:57358778-57358800 GAGAAGAAAGAGAGGGAAGGGGG - Intergenic
1041539758 8:58970375-58970397 GGGGAGAAATAGAAGGAAGTGGG - Intronic
1041570955 8:59336442-59336464 GAAGAGACATAGGGGGAAGATGG - Intergenic
1041713497 8:60913615-60913637 GGGGAGAAATAGAGTGGAGAAGG + Intergenic
1041844110 8:62307346-62307368 GAGGAGGGAGAGAGGAAAGAAGG - Intronic
1042230024 8:66545711-66545733 GAGGAGGGATGGAGGGAAGGAGG + Intergenic
1042765416 8:72315850-72315872 CAGGAGACAGAGAGGGAAGAGGG + Intergenic
1043327592 8:79071495-79071517 GAGGAGTGATGAAGGGAAAAGGG - Intergenic
1043930569 8:86086114-86086136 GAGCAGAAAGAGAGGGAGGAGGG + Intronic
1044030569 8:87230109-87230131 CAGGAGGAACAGAGAGAAGAGGG + Intronic
1044320775 8:90798451-90798473 GGGGACTAATAGAGGGAAGAGGG - Intronic
1044428611 8:92082904-92082926 GAGGAGGGAGAGAAGGAAGAGGG + Intronic
1044627190 8:94245578-94245600 GAGGGGACACAGAGGGAAGAAGG - Intergenic
1045357924 8:101405743-101405765 AAGGAGTGAAGGAGGGAAGAGGG - Intergenic
1045379279 8:101607102-101607124 GAAGAGAGATAGAGGGAAGGGGG - Intronic
1045755277 8:105534204-105534226 GAGGAAGAAAAGAAGGAAGAAGG - Intronic
1046072969 8:109281458-109281480 AAGGAGTGAAAGAGGGAGGAAGG - Intronic
1046159420 8:110340927-110340949 GAGGAGTAATGGAAAGAACATGG + Intergenic
1046220793 8:111211584-111211606 AAGGAGAAAGAAAGGGAAGAGGG - Intergenic
1046455151 8:114449590-114449612 GGGGACTAATAAAGAGAAGAGGG + Intergenic
1046605349 8:116365535-116365557 AAGGAGGAAGGGAGGGAAGAAGG + Intergenic
1047359621 8:124156172-124156194 GGGGACTACTAGAGGGAGGAGGG - Intergenic
1047511921 8:125521928-125521950 GAAGAGGAAGGGAGGGAAGAAGG - Intergenic
1047789054 8:128183806-128183828 GAGGAATAAAAGAAGGAAAAAGG - Intergenic
1048135331 8:131741972-131741994 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1048247793 8:132827660-132827682 TAGGATTAATAGAGGAAAAATGG + Intronic
1048392422 8:133980301-133980323 GAGGAGAAATAGAGTGTAGATGG - Intergenic
1048557750 8:135497096-135497118 AAGGAGTAAGAGAGGGAAGTTGG + Intronic
1048742556 8:137578237-137578259 AAGGAGGAATGGAGGGAAGGAGG - Intergenic
1048777217 8:137960407-137960429 GAGGAAGAAGAGAAGGAAGAGGG - Intergenic
1048853234 8:138664051-138664073 GGGGTGTAATACAGGGAAGTCGG - Intronic
1049058446 8:140257386-140257408 GAGGAGAAGTAGAAGGAAGGTGG - Intronic
1049469258 8:142768199-142768221 GAGGAGGAATAGAGAGGAGGAGG + Intronic
1049952576 9:659691-659713 CAGGAGAAAAAGAGGGAAGAAGG + Intronic
1050436453 9:5615500-5615522 TAAAAGTAAGAGAGGGAAGAAGG - Intergenic
1050895925 9:10885991-10886013 AAGGAGGAATAGAGGGTGGAAGG - Intergenic
1051301851 9:15660474-15660496 GGGGACTACTAGAGGGAAAAGGG - Intronic
1051718231 9:20008195-20008217 CAGGCTTAAGAGAGGGAAGAGGG - Intergenic
1051880721 9:21837001-21837023 GATGAGTAACACAGGGAGGAGGG - Intronic
1052191681 9:25670174-25670196 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1053057872 9:35004719-35004741 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1053121513 9:35550693-35550715 GTTGAGTTATAAAGGGAAGAAGG + Intronic
1053221410 9:36316131-36316153 GAGGAGAAGGAGGGGGAAGAGGG + Intergenic
1054968331 9:71055433-71055455 GATGAGTAATAGAATCAAGAGGG + Intronic
1055429479 9:76229026-76229048 GAGAAGGAAAAGAGGAAAGAAGG + Intronic
1055692481 9:78847197-78847219 GAGGAGTAAGAGAGAGTAGTTGG + Intergenic
1055722240 9:79188292-79188314 AAGGAGAAAGAGAGGGAAGAGGG - Intergenic
1055735803 9:79328715-79328737 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1055955641 9:81770820-81770842 GAGGAGTAATTGAGTGAACTTGG + Intergenic
1056077626 9:83058018-83058040 GAGGAGAAACTGAGGCAAGATGG + Intronic
1056089193 9:83187743-83187765 GAGGAGAAATGGAAGGTAGAGGG - Intergenic
1056238314 9:84618048-84618070 TAGGAGGAAGAGAGGGAGGAAGG - Intergenic
1056456754 9:86767869-86767891 AAGGACAAAGAGAGGGAAGAGGG - Intergenic
1056556770 9:87695873-87695895 GAGGATTAATTGAGAGAAGGTGG - Intronic
1056587691 9:87939032-87939054 GAGGATTAGGAGAAGGAAGAGGG - Intergenic
1057332641 9:94129907-94129929 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1057497418 9:95571969-95571991 GAGGAGGAGGAGAGGGAGGAGGG + Intergenic
1057521681 9:95765310-95765332 GAGGAGTAAGGAAGGGAGGAAGG + Intergenic
1057680236 9:97174423-97174445 TATGTGTACTAGAGGGAAGAGGG - Intergenic
1057931312 9:99195955-99195977 GAGGAAGAGCAGAGGGAAGAGGG - Intergenic
1058156139 9:101518025-101518047 GAGGAGAAAGGGAGGGAGGAAGG - Intronic
1059172048 9:112134593-112134615 GAGGACAAATAGAGGGAGGAGGG + Intronic
1059355560 9:113696852-113696874 AAGGAGAAATAGAGAGAAGGGGG - Intergenic
1059635275 9:116164277-116164299 GAGTAGGAAGAGAGAGAAGAAGG - Intronic
1059669312 9:116477977-116477999 GAGAAGAAACAGAGGGCAGAGGG + Intronic
1059987777 9:119836540-119836562 GAGGATTATTAGAGGAAGGATGG - Intergenic
1060008225 9:120019322-120019344 GAGGAGAAATTGAGGAGAGAAGG + Intergenic
1060525939 9:124321430-124321452 GAGGAGGGAAAGAGGGAAGGGGG - Intronic
1060599745 9:124869725-124869747 GAGGAGGCAAGGAGGGAAGAGGG - Intronic
1060744422 9:126121501-126121523 GAAGAGTAATAGTGGGTAAACGG - Intergenic
1060868910 9:127023407-127023429 GAGGAGGAATAAAGGGATTAAGG - Intronic
1061582907 9:131548311-131548333 AAGGAGGAATAGAGGGTGGAAGG - Intergenic
1061728128 9:132592492-132592514 GAGGAGAACTTTAGGGAAGAGGG - Intergenic
1061865664 9:133490768-133490790 GAGGAGGAGGAGAGGGAGGAGGG + Intergenic
1061964830 9:134007310-134007332 GAGGAGAGACAGACGGAAGAGGG + Intergenic
1062449180 9:136608364-136608386 GAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1062712048 9:137980666-137980688 GGGGAGTACTAGAGGGAGGAGGG - Intronic
1203444728 Un_GL000219v1:44749-44771 AAGGAGGAAGAGAGGGAAGGAGG - Intergenic
1185688331 X:1948454-1948476 GAGGAGGAAGAGAGGGGAGGAGG + Intergenic
1185688609 X:2133976-2133998 GAGGAGGAAGAGAGGGGAGGAGG + Intergenic
1185834101 X:3329111-3329133 AAGGAGTAAAGGAGGGAAGGTGG + Intronic
1185834126 X:3329231-3329253 AAGGAGTAAAGGAGGGAAGGTGG + Intronic
1185872980 X:3680046-3680068 GAGGAGGGATAGATGGATGAGGG - Intronic
1185918118 X:4058788-4058810 AGGGAGTGACAGAGGGAAGAAGG + Intergenic
1186113024 X:6276639-6276661 AAGGAGGAATAGAGGGTGGAAGG + Intergenic
1186854004 X:13608507-13608529 GGAGAGAAATAGAGGGAGGAAGG - Intronic
1186870632 X:13767691-13767713 GAAGAGAAATAGAGGAAGGAGGG - Intronic
1186996456 X:15128674-15128696 GAGGAGGAATAGCAGAAAGAGGG + Intergenic
1188029914 X:25252801-25252823 GAGGAGACATACAGGGAAGAAGG + Intergenic
1188043567 X:25399282-25399304 GAGGACTACTAGAAGGCAGAGGG + Intergenic
1188580587 X:31707457-31707479 GGGGACTACTAGAGGGAGGAGGG + Intronic
1188697722 X:33216445-33216467 GAGGGGGAATGGAGGGAAGCGGG + Intronic
1188705634 X:33326115-33326137 TAGTAATATTAGAGGGAAGAAGG + Intronic
1188901750 X:35741276-35741298 AAGGAGAGATAGAGGGAAGGAGG + Intergenic
1189224105 X:39398334-39398356 GAGGAGCAAAGGACGGAAGAAGG - Intergenic
1189357985 X:40326037-40326059 CAGGAGCAAGAGAGGGGAGAGGG + Intergenic
1189424624 X:40886986-40887008 GAGGACTACTAGAGGGAGGAGGG - Intergenic
1190037512 X:47039560-47039582 GGGGATTACTAGAGGGAGGAGGG - Intronic
1190048618 X:47132567-47132589 GAGGAGGAAGAAAGGGAGGAAGG - Intergenic
1193199451 X:78671131-78671153 GTAGACTAATAGAGGGTAGAGGG + Intergenic
1193847490 X:86492605-86492627 GGGGACTACTAGAGGGAAGAGGG - Intronic
1194407034 X:93509351-93509373 GGGGAGTAATAGGAGGAACAAGG + Intergenic
1194769648 X:97886049-97886071 AAGGAGAAATAGAGGGGAAAAGG + Intergenic
1194918405 X:99733042-99733064 GGGGAGTGCTAGAGGGCAGAAGG - Intergenic
1195496446 X:105540514-105540536 GGGGACTACTAGAGGGAAGAGGG + Intronic
1195505624 X:105653498-105653520 AAGGAGGAAGGGAGGGAAGAAGG - Intronic
1196044068 X:111238041-111238063 GGGGACTATTAGAGGGGAGAGGG - Intergenic
1196075246 X:111568989-111569011 GAGGAGTTAGAGAGGGAGAATGG - Intergenic
1196081450 X:111637225-111637247 AAGGAGGAAGAGAGTGAAGAGGG - Intergenic
1196458782 X:115908694-115908716 GAGGATGAATAGAAGGCAGAGGG + Intergenic
1196462766 X:115947121-115947143 GAGGATGAATAGAAGGCAGAGGG + Intergenic
1196469703 X:116011566-116011588 AAGGAGGAATGGAGGGCAGAAGG - Intergenic
1196992850 X:121347466-121347488 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1197576450 X:128218075-128218097 GTGGACTACTAGAGGGAGGATGG + Intergenic
1197651604 X:129071542-129071564 GAGGGGGAAAAGAGGGAGGAAGG + Intergenic
1197834185 X:130677203-130677225 GAGGAGGAAGTGAGGGAGGAAGG - Intronic
1198134076 X:133729282-133729304 GAGGAATAATGGAGGGAATAGGG - Intronic
1198320471 X:135514594-135514616 GAGGAATAACACAGGGAAGGAGG - Intergenic
1198451336 X:136769014-136769036 GAGGAGGAAGAGAGGGAAGGAGG + Intronic
1198506755 X:137308872-137308894 CAGGAGGAATAGAGTGAAGGAGG - Intergenic
1198818724 X:140622157-140622179 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1199316543 X:146385336-146385358 AAGTAGGAATAGAGAGAAGATGG + Intergenic
1199776346 X:151015311-151015333 GAGGTGTATTAGAAGGAAAAAGG - Intergenic
1201484167 Y:14474612-14474634 GGGGACTACTAGAGGGAGGAAGG - Intergenic
1201558730 Y:15292225-15292247 GAGGAGGGAGAAAGGGAAGAAGG + Intergenic
1201697389 Y:16840952-16840974 AAGGAAAAATAGAAGGAAGAAGG + Intergenic
1201741102 Y:17325462-17325484 AAGGAGTAAGAGAGGAGAGAGGG + Intergenic
1201887717 Y:18904040-18904062 GAGAAGAAATAGAGAGAGGAAGG + Intergenic
1202093407 Y:21217592-21217614 GGGGAGTGGGAGAGGGAAGAGGG + Intergenic