ID: 1167892064

View in Genome Browser
Species Human (GRCh38)
Location 19:52548337-52548359
Sequence GGAGCTTGTGAGGTTGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 2, 1: 0, 2: 4, 3: 15, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167892059_1167892064 14 Left 1167892059 19:52548300-52548322 CCCTGTAAGAGATATGGTTTTCA 0: 3
1: 1
2: 12
3: 55
4: 574
Right 1167892064 19:52548337-52548359 GGAGCTTGTGAGGTTGAATGAGG 0: 2
1: 0
2: 4
3: 15
4: 186
1167892060_1167892064 13 Left 1167892060 19:52548301-52548323 CCTGTAAGAGATATGGTTTTCAT 0: 3
1: 1
2: 0
3: 18
4: 181
Right 1167892064 19:52548337-52548359 GGAGCTTGTGAGGTTGAATGAGG 0: 2
1: 0
2: 4
3: 15
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167892064 Original CRISPR GGAGCTTGTGAGGTTGAATG AGG Intronic
906483835 1:46219734-46219756 GCAGCTGGTGACCTTGAATGAGG + Exonic
907389983 1:54151829-54151851 GGCGCATGTGAGGTTGATGGAGG + Intronic
909416389 1:75410673-75410695 GAAGCTTGTGACTTTGTATGTGG - Intronic
909444232 1:75730343-75730365 GGAGATTGTGAAGTTCAATACGG + Intronic
909447286 1:75761194-75761216 GCAGCTTGGGAGGTTGATTCTGG + Exonic
916577733 1:166082202-166082224 GGAGGGGGTGAGGATGAATGAGG - Intronic
918051958 1:180981460-180981482 GGAGTGTGTGAGGTTGAGGGCGG - Intronic
924140969 1:241022895-241022917 GGAGTTAGTGAGGTTTAGTGAGG - Intronic
924307985 1:242711387-242711409 GGAATTGGTGAGGGTGAATGGGG - Intergenic
924441870 1:244092925-244092947 GGAGAGTGTGAACTTGAATGTGG - Intergenic
924528889 1:244876785-244876807 GGAGATTGTGAGCTGGAGTGAGG + Intergenic
1063058803 10:2529449-2529471 GGAGCAAGTGAAGCTGAATGAGG - Intergenic
1063627682 10:7705835-7705857 GGAGATTGTGAGGCTGCAAGGGG - Intronic
1063668056 10:8077730-8077752 GGAGTTTGTGGGCTTGAATTTGG - Intergenic
1063795063 10:9504795-9504817 GTAGATTATGAGGCTGAATGGGG + Intergenic
1064825879 10:19400127-19400149 GGAGCTTGTGAGTTTAAAGTGGG + Intronic
1067274538 10:44822026-44822048 GGAGCTTGGGTGGATAAATGTGG - Intergenic
1069483767 10:68807489-68807511 GGAGCTTTAGAGGTGGAATGGGG + Intergenic
1069789415 10:71010170-71010192 GGAGCTTGTAAAGTTGCCTGTGG - Intergenic
1070404494 10:76082950-76082972 GGAGATTGGAAGGTAGAATGTGG + Intronic
1070734319 10:78852833-78852855 GGAGCTTCTGAGGAGGAAGGCGG + Intergenic
1072537462 10:96374447-96374469 GACGCTGGTGAGGTTGTATGAGG + Intronic
1073177959 10:101568075-101568097 GGAGCTGGTGAGTTTGATTTGGG + Intergenic
1073335516 10:102705096-102705118 GGAGCTGGGGAGGGGGAATGGGG - Intronic
1075799428 10:125143876-125143898 GGAGCTTGTCTGCTTGAATATGG - Intronic
1076195181 10:128512734-128512756 GGAGCTTCTGAGGTCGAGTGTGG - Intergenic
1077632426 11:3819777-3819799 GGAACTTGTGTGCTGGAATGGGG + Intronic
1077647765 11:3941059-3941081 GGTTGTTGTGAGGATGAATGAGG + Intronic
1079079124 11:17401783-17401805 GGAGCATCTGAGGTTGCCTGGGG - Intronic
1079410999 11:20187400-20187422 TGAACTTGTGAGTCTGAATGTGG - Intergenic
1079594235 11:22222531-22222553 GGTCCTGGTGAGGTTGAAAGAGG - Intronic
1080641106 11:34158894-34158916 GGAGCTTGTGAAGATGCAGGAGG + Intronic
1084163851 11:67365982-67366004 GGAGCTGGAGAGGTAGAAGGTGG + Intronic
1085187461 11:74588625-74588647 GGAGCTTGCACGGGTGAATGTGG + Intronic
1086399056 11:86446107-86446129 GGGGCTTTTGAGGGGGAATGGGG - Intronic
1086911555 11:92478561-92478583 GGAGGTTGTCAGGTTGTTTGGGG - Intronic
1087817318 11:102673994-102674016 GGAGCTAGTGTGGTTGTCTGAGG + Intergenic
1089728520 11:120504647-120504669 GTAGATTAGGAGGTTGAATGAGG - Intergenic
1090560648 11:127928325-127928347 GGAACTTGTGAGATAGACTGGGG + Intergenic
1093226319 12:16488139-16488161 GGAGAATGTGAAGTTGAATTAGG + Intronic
1094291447 12:28855048-28855070 GAAGCTTATTAGTTTGAATGAGG + Intergenic
1096422862 12:51475145-51475167 GGTGCTTGAGAGGATGAAGGTGG - Exonic
1096444986 12:51681402-51681424 GAACCTCATGAGGTTGAATGAGG + Intronic
1096470095 12:51870130-51870152 GGAGCTTGGGCAGTTGAGTGGGG - Intergenic
1100887997 12:99093658-99093680 GGAGCCTGTGATGGTGAAGGTGG + Intronic
1101068811 12:101051256-101051278 GAAGTTTCTGAGGTTGAAAGTGG + Intronic
1102791908 12:115653598-115653620 GGAGCTTGGGAGCTTGGATGTGG - Intergenic
1103503565 12:121424483-121424505 GGACCTTGTGAGGTTGAGGCTGG + Intronic
1110717248 13:78720413-78720435 GGGGCTTGGCAGGTTGGATGAGG - Intergenic
1113360358 13:109625313-109625335 TGAGCCTGAGAGGTTGAGTGAGG - Intergenic
1113536515 13:111070855-111070877 GGAGCCTGTGAGGAAGGATGAGG + Intergenic
1113583184 13:111443400-111443422 GGAGGGTGTGAAGGTGAATGAGG - Intergenic
1116203277 14:41826147-41826169 GGATTTTGTGAGGTGGAGTGTGG + Intronic
1117871998 14:60210886-60210908 GTTGCTTGTGAGGCTGAGTGGGG - Intergenic
1123836809 15:24203198-24203220 TGAGGTTGAGAGGTTGTATGTGG + Intergenic
1125476306 15:40050270-40050292 GGAGTGTGTGAGGTGGAAGGTGG + Intergenic
1125622443 15:41075837-41075859 GCACTTTGTGAGGCTGAATGTGG - Intronic
1126789333 15:52206467-52206489 GGAGGTAATGAGGTTAAATGAGG + Intronic
1129559109 15:76547073-76547095 GGAGATTTTGGGGTTGAATAGGG + Intronic
1130636042 15:85621033-85621055 TGAACTTGTGAGGGTGTATGTGG + Intronic
1131383552 15:91983975-91983997 GGAGCTTGTGAGAGTGGATGTGG + Intronic
1135988062 16:27198824-27198846 GGAGCTTGCATGGGTGAATGAGG + Intergenic
1140036695 16:71376729-71376751 GGGGTGTGTGTGGTTGAATGTGG - Intronic
1141993262 16:87622143-87622165 GTAGCTTGTGGGGTGGCATGCGG - Intronic
1142267690 16:89072010-89072032 TGGGCTTGTGGAGTTGAATGGGG + Intergenic
1142968713 17:3596949-3596971 GGTGCTTGTGAGCTTGAAGGCGG + Exonic
1143065491 17:4244040-4244062 GCTGCTTGGGAGGTTGAAGGAGG - Intronic
1143538771 17:7557554-7557576 GGAGCTAGTGAGGTGGAGAGTGG - Exonic
1143732012 17:8886719-8886741 GGAGCTGGTGAGGTGGAAGCAGG + Intronic
1144295925 17:13875069-13875091 AGAGATTTAGAGGTTGAATGGGG + Intergenic
1144734857 17:17549554-17549576 GCATTTTGTGAGGTTGAGTGAGG - Intronic
1147129793 17:38400478-38400500 TCAGCTTGTGAGGGGGAATGTGG + Exonic
1149379539 17:56079483-56079505 CTGGCTTGTGAGGATGAATGGGG - Intergenic
1152332849 17:79683524-79683546 GGTGCTAATGAGGTTGAATACGG - Intergenic
1155246703 18:23917507-23917529 GATGCTGGTGAGGTTGAAAGTGG - Intronic
1155666753 18:28318220-28318242 GAAGGATGTGATGTTGAATGAGG - Intergenic
1157411593 18:47467490-47467512 GGAGGATGTGTGGTTGAGTGAGG - Intergenic
1160396671 18:78577215-78577237 GGTGCTTGTGAAGTTGCATGGGG + Intergenic
1160758568 19:771420-771442 GGCGCCTGTGAGGCTGACTGGGG + Intergenic
1161873344 19:6887639-6887661 GGTGAGTGTGAGGCTGAATGGGG + Exonic
1162221154 19:9177626-9177648 GGGGCTGGGGAGGGTGAATGAGG + Intergenic
1162350059 19:10143181-10143203 GGAGCTTGGGAGGTTCTCTGGGG + Intronic
1162504837 19:11077376-11077398 GGGGCTGGGGAGGTGGAATGGGG - Intergenic
1162927357 19:13937153-13937175 GGGGCATGTGGGGTTGATTGCGG - Intronic
1162927375 19:13937213-13937235 GGGGCATGTGGGGTTGATTGCGG - Intronic
1162927393 19:13937273-13937295 GGGGCATGTGGGGTTGATTGCGG - Intronic
1164529020 19:29033554-29033576 GGAGGTTGGGAGGGGGAATGAGG + Intergenic
1165066698 19:33233615-33233637 GGAGTGTGTGGGGTTGTATGTGG - Intergenic
1165311840 19:35033245-35033267 GGGGCTTGGGAGGATGACTGAGG + Intronic
1167075253 19:47244486-47244508 GGTGGTTGTGAGGATGAATTGGG - Intergenic
1167143806 19:47670590-47670612 GGTGCTGGGGAGGTGGAATGAGG - Intronic
1167836293 19:52074371-52074393 GAAGCTAATGAAGTTGAATGAGG - Intronic
1167886687 19:52505812-52505834 GGAGCTTGTGAGGTTGAATGAGG + Intronic
1167892064 19:52548337-52548359 GGAGCTTGTGAGGTTGAATGAGG + Intronic
1167912226 19:52713289-52713311 GAAGCTTTTGAGGTTGAATGAGG - Intronic
925476938 2:4227754-4227776 GAGGTTTGTGTGGTTGAATGGGG + Intergenic
926906197 2:17807870-17807892 GGTTGTTGTGAGGATGAATGTGG + Intergenic
927948402 2:27151132-27151154 GGAGGTTATGAGGCTGAAAGCGG + Intronic
928465758 2:31520805-31520827 GGAGCTTATGAGGTGGGTTGGGG - Intergenic
929091032 2:38217570-38217592 GGAGCTTGTGAGCTCATATGTGG - Intergenic
932074287 2:68648458-68648480 GGAGCTTCTATGGTTGAGTGGGG + Intronic
932169294 2:69539052-69539074 GGTGGTGGTGAGGTTGAATGAGG - Intronic
933987297 2:87602664-87602686 GGAGCTTGTGAGGTCAACAGGGG - Intergenic
936053873 2:109246145-109246167 GGTGGTTGTGAGGTTGACAGAGG + Intronic
936306542 2:111348144-111348166 GGAGCTTGTGAGGTCAACAGGGG + Intergenic
938912521 2:135898609-135898631 TGACCTTGTGGGGTTGGATGTGG + Intergenic
939737791 2:145870911-145870933 TGAGCTTGTGAGAATGATTGTGG - Intergenic
940720013 2:157271686-157271708 GGAGCTGGTTGGGTTGAGTGGGG + Intronic
943282553 2:185955504-185955526 GGAGTATGTGAGGTTGCATTTGG - Intergenic
946363593 2:219234866-219234888 GGAGCTAGTGGAGTTGACTGTGG + Exonic
1169567051 20:6866383-6866405 GGAGCCTGGGAGGGTGAAGGTGG - Intergenic
1170474458 20:16701119-16701141 GCAGCCTGGGAGGATGAATGAGG - Intergenic
1170693860 20:18639603-18639625 GGAGCTAGTGAGGTATAAAGTGG - Intronic
1173838564 20:46141216-46141238 GGGGCTTGAGGGGTTGAGTGGGG + Intergenic
1173863356 20:46298435-46298457 GTAGATTCTGAGGGTGAATGAGG + Intronic
1174567028 20:51472405-51472427 GGAGGTTGTGAAAATGAATGGGG - Intronic
1175322189 20:58096993-58097015 GGAGGCTGTCAGGATGAATGAGG - Intergenic
1176040425 20:63062597-63062619 GGAGCTGGTGGGCTTGAATGTGG + Intergenic
1177898752 21:26887325-26887347 AGAGCTTGTCAGGTGAAATGAGG + Intergenic
1178805028 21:35832021-35832043 GGAGCTGGTGAAGGTGAATTGGG - Intronic
1179030240 21:37713684-37713706 GGAGCTCAGCAGGTTGAATGTGG + Intronic
1179237960 21:39563924-39563946 GGAGCTTGGTAAGTTGCATGTGG + Intronic
1179933904 21:44590737-44590759 TGAGCTGGGGAGGGTGAATGTGG + Intronic
1179940989 21:44638802-44638824 GGAGCTGGGGAGGGTGAATGTGG - Intronic
1185118052 22:48949203-48949225 GGAGGTAGTGAGGTTGGAGGAGG - Intergenic
950150284 3:10681411-10681433 CCAGCTTGTGAGGATCAATGGGG - Intronic
950495677 3:13333023-13333045 GGAGCCTGGGAGGTGGAACGGGG - Intronic
951463641 3:22977993-22978015 GGAGCATGGGAGGTTAAAAGTGG - Intergenic
953083461 3:39643548-39643570 GAAGCATGTGAGGTTGAAACAGG - Intergenic
953988063 3:47460913-47460935 GGAGTTTGTGAGGAGAAATGTGG + Intronic
954608910 3:51933990-51934012 TGAGTTTGTGAGGATGAAGGAGG + Intronic
959609391 3:108277098-108277120 GGAGCTAATGAGGTACAATGGGG - Intergenic
964863768 3:161231177-161231199 GAAGCTAGTGAGGAGGAATGAGG + Intronic
965700162 3:171452538-171452560 GGAGATGGTGAGGTTTAATGAGG - Intronic
967826702 3:193882867-193882889 GGTGCTTTTGAGGTTGCACGTGG - Intergenic
974883361 4:67786353-67786375 GGAGCCTGGGAGGTTGATTGAGG + Intergenic
976393875 4:84534829-84534851 GGTGCTGGTGAGGTTGCTTGTGG + Intergenic
979710300 4:123771303-123771325 GGAGGTTTTGAGGTTGTTTGGGG + Intergenic
980283667 4:130755097-130755119 GGGGCTGGTGTGGTTGAAGGAGG - Intergenic
980712597 4:136590304-136590326 GGTGCTTTTGAGGGTGTATGTGG + Intergenic
984017861 4:174447027-174447049 GAAACTTGTGAGGGAGAATGGGG + Intergenic
984784157 4:183552735-183552757 TGAGGGTGTGTGGTTGAATGTGG + Intergenic
986934704 5:12868353-12868375 GGAGCTTGTAAGGGTGTCTGAGG + Intergenic
987382416 5:17297867-17297889 GGTTCTTGTGAGGATAAATGGGG + Intergenic
988846936 5:35136695-35136717 GGAGCCGGTGAGGTTGAGGGTGG - Intronic
988907521 5:35804443-35804465 AAAGCTGGTGATGTTGAATGTGG - Intronic
989705708 5:44327817-44327839 GGAGCTGGTGATGATGAAAGAGG - Intronic
990348366 5:54891042-54891064 GGATTTTGTAAGGTTAAATGAGG + Intergenic
990765582 5:59178403-59178425 GGAGCTTGTGGGTACGAATGAGG + Intronic
991432324 5:66561399-66561421 GGAGCTTTTGAGGTTGAAAAAGG + Intergenic
993502507 5:88679035-88679057 GGAGGTTGTGAAGTTCAGTGAGG - Intergenic
995841205 5:116444980-116445002 GGAGCTCTTGAGGATGAAAGGGG + Exonic
996362171 5:122661749-122661771 GAAGCTTGGGAGGAAGAATGGGG + Intergenic
999017884 5:148128364-148128386 GTAGCTTATGAGGGAGAATGAGG - Intronic
999297156 5:150466864-150466886 GGTGCTTGTGAGGTTCAAATGGG + Intergenic
999303102 5:150503117-150503139 GGTTACTGTGAGGTTGAATGAGG + Intronic
1001721341 5:173859623-173859645 GGAGGTTGTGTGGTGGACTGGGG - Intergenic
1004877998 6:19975344-19975366 GGAGCTTAGGAGGTTAGATGGGG - Intergenic
1006099749 6:31679302-31679324 GTAGGGTGTGAGGTAGAATGGGG - Intronic
1007383000 6:41502784-41502806 GGATCTTGTGAGATTGCAAGCGG - Intergenic
1015305217 6:131699631-131699653 GAAGATTGTGAGGTTGAATGAGG + Intronic
1015417506 6:132966452-132966474 AGATCTTGTGAGTTTGAAAGAGG + Intergenic
1015964546 6:138684708-138684730 GGAGCTTCTGTGTTTGACTGAGG - Intronic
1016809850 6:148249728-148249750 GGCTCTTGTGAGGTTGAAACAGG - Intergenic
1020741751 7:12028654-12028676 GGAGGCTGTGAGGGAGAATGGGG - Intergenic
1021324498 7:19249081-19249103 GGTGCTTGTGGGGTAGAAGGGGG + Intergenic
1023899810 7:44467046-44467068 GGGGCTGGTGAGGGTGAATGTGG - Intronic
1027143687 7:75679068-75679090 GGAGAGTGTGAGGTTGAAGATGG - Intronic
1029122809 7:98279979-98280001 GCACCTTGTGAGGCTGAGTGAGG + Intronic
1029661226 7:101963374-101963396 CCAGCATGTGATGTTGAATGAGG + Intronic
1030597857 7:111561689-111561711 GGAGCCTGTGACTTTGAAGGTGG + Intronic
1032762808 7:134960268-134960290 TGTGTTTGTGAGGTTGCATGAGG + Intronic
1033739328 7:144257858-144257880 GAAGATTGTGAGGTTGAATGAGG + Intergenic
1037585069 8:20270488-20270510 GGAGCTTGTGAGTTTGGATGGGG + Intronic
1039444522 8:37620596-37620618 GGAGCTTATGAGCTGGGATGCGG - Intergenic
1040367825 8:46737260-46737282 GGAGCTTGGAAGGTTTTATGGGG - Intergenic
1042875149 8:73434951-73434973 TGAGGTTGTGAGGTAGAATGGGG - Intronic
1044793048 8:95867406-95867428 GGAGTTTGGGAGGTTGAAGAGGG + Intergenic
1044960086 8:97521962-97521984 GGAGGTTGAGAGGCTGAGTGGGG + Intergenic
1047279745 8:123434760-123434782 GGAGCTTGTGTGGTAGAAAGAGG + Intronic
1048136693 8:131753039-131753061 GGAGGTTGGGGGTTTGAATGAGG + Intergenic
1048229828 8:132627776-132627798 GGGGCTTGGGAAGATGAATGAGG + Intronic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1049001995 8:139832128-139832150 GAAGCTTGTGAGCTCGAACGAGG - Intronic
1049691032 8:143959118-143959140 AGGGCGTGTGAGGGTGAATGCGG + Intronic
1050527420 9:6558096-6558118 GGAGGTTGGGAGGTTGAGAGTGG + Intronic
1050586613 9:7118950-7118972 GGCTTTTGTGAGGTAGAATGAGG - Intergenic
1052200695 9:25775637-25775659 GAAGCTTGAGAGGTTGTAGGAGG - Intergenic
1052234455 9:26193066-26193088 GTACCTTTTGAAGTTGAATGGGG - Intergenic
1052381291 9:27773692-27773714 TGACCTTTTGATGTTGAATGAGG - Intergenic
1052735195 9:32334510-32334532 GGAGCTTGTGTGGTAGAGTTAGG - Intergenic
1052802263 9:32979912-32979934 GGAGCTGGTGAGGAAGAATTAGG - Intronic
1053387727 9:37707873-37707895 GGAGCGTGTGGGGTTCAAAGAGG - Intronic
1056002261 9:82229954-82229976 GCAGCTTTGGAGGTTGAGTGAGG + Intergenic
1056114111 9:83425432-83425454 CTAGCTTGTGAGAGTGAATGGGG + Intronic
1057229360 9:93310124-93310146 GGAGCTTGGGAGTGTGGATGTGG - Intronic
1058987208 9:110219407-110219429 GAAGCTTGTGAGGATGAAATGGG - Intergenic
1060565803 9:124590432-124590454 GGAGCTTTTGAGAGTGACTGGGG - Intronic
1187106811 X:16251755-16251777 GGAGAGTGAGAGGGTGAATGGGG + Intergenic
1187134904 X:16538717-16538739 GGGGCTTGAGAGGTAGATTGGGG + Intergenic
1187407591 X:19017579-19017601 GGGGCATGTGAAGCTGAATGGGG + Intronic
1189057568 X:37714472-37714494 GGGGTATGTGAGGTTGACTGTGG - Intronic
1189865636 X:45324292-45324314 GGTGCTTGTGAGGGTGGAGGAGG - Intergenic
1192219541 X:69188093-69188115 GGAGCTTGGGAGGTTGAGATGGG - Intergenic
1197765403 X:130056747-130056769 GGAGGGGGTGAGGTGGAATGGGG + Exonic
1202349886 Y:23978022-23978044 GGAGTTTGGGAGGCTGAAGGAGG + Intergenic
1202520893 Y:25692097-25692119 GGAGTTTGGGAGGCTGAAGGAGG - Intergenic