ID: 1167892740

View in Genome Browser
Species Human (GRCh38)
Location 19:52555051-52555073
Sequence GCAGCAAGACCTTCAGTAAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 1, 2: 4, 3: 13, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167892739_1167892740 -4 Left 1167892739 19:52555032-52555054 CCTTACAAGTGTAATGAGTGCAG 0: 5
1: 5
2: 72
3: 124
4: 295
Right 1167892740 19:52555051-52555073 GCAGCAAGACCTTCAGTAACAGG 0: 1
1: 1
2: 4
3: 13
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167892740 Original CRISPR GCAGCAAGACCTTCAGTAAC AGG Exonic