ID: 1167893919

View in Genome Browser
Species Human (GRCh38)
Location 19:52565460-52565482
Sequence TGAGGCCCACAGTTTGTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167893919_1167893925 18 Left 1167893919 19:52565460-52565482 CCACTCACAAACTGTGGGCCTCA No data
Right 1167893925 19:52565501-52565523 AGTTCTGTTGAATTTCACCCTGG 0: 45
1: 85
2: 45
3: 47
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167893919 Original CRISPR TGAGGCCCACAGTTTGTGAG TGG (reversed) Intronic
No off target data available for this crispr