ID: 1167894586

View in Genome Browser
Species Human (GRCh38)
Location 19:52570704-52570726
Sequence GAACTCGGCCTCCCTGAGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167894586_1167894590 -7 Left 1167894586 19:52570704-52570726 CCAGTCTCAGGGAGGCCGAGTTC 0: 1
1: 0
2: 2
3: 9
4: 111
Right 1167894590 19:52570720-52570742 CGAGTTCTCTGCCTGGTGCTGGG 0: 1
1: 0
2: 2
3: 27
4: 163
1167894586_1167894593 15 Left 1167894586 19:52570704-52570726 CCAGTCTCAGGGAGGCCGAGTTC 0: 1
1: 0
2: 2
3: 9
4: 111
Right 1167894593 19:52570742-52570764 GATCTTGTGGACCCCACCGAAGG 0: 1
1: 0
2: 0
3: 5
4: 56
1167894586_1167894589 -8 Left 1167894586 19:52570704-52570726 CCAGTCTCAGGGAGGCCGAGTTC 0: 1
1: 0
2: 2
3: 9
4: 111
Right 1167894589 19:52570719-52570741 CCGAGTTCTCTGCCTGGTGCTGG 0: 1
1: 0
2: 3
3: 25
4: 166
1167894586_1167894591 2 Left 1167894586 19:52570704-52570726 CCAGTCTCAGGGAGGCCGAGTTC 0: 1
1: 0
2: 2
3: 9
4: 111
Right 1167894591 19:52570729-52570751 TGCCTGGTGCTGGGATCTTGTGG 0: 1
1: 0
2: 3
3: 30
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167894586 Original CRISPR GAACTCGGCCTCCCTGAGAC TGG (reversed) Exonic
900405938 1:2493020-2493042 GAACCCAGCCTCCCTGACAGAGG + Intronic
906185460 1:43858987-43859009 GAACTCAGGCTCCCTGAGTAGGG - Intronic
909662269 1:78097317-78097339 AAACTCTGCCTCACTAAGACTGG - Intronic
914516972 1:148382610-148382632 GAACTCGGTTCCCCTGTGACGGG + Intergenic
917161837 1:172066060-172066082 GATCTAGGCCTCCCTGAAATGGG - Intronic
921023644 1:211259019-211259041 GAACGCGGTCACCCTGAGAAAGG - Intronic
1062898929 10:1126796-1126818 GAAATGAGCTTCCCTGAGACCGG + Intronic
1063065098 10:2600032-2600054 AAACTCAGCCTCCCTCAGCCGGG - Intergenic
1066650770 10:37652895-37652917 GAACTTGGCCAATCTGAGACTGG - Intergenic
1069721712 10:70554001-70554023 GAAGTCGGGCTGCTTGAGACAGG - Intronic
1069784143 10:70977264-70977286 GACTGCAGCCTCCCTGAGACAGG + Intergenic
1074377034 10:112949703-112949725 GAAATCAGCCACCCTTAGACGGG - Intergenic
1079455697 11:20634253-20634275 GAACTTGGCCTTCATCAGACTGG + Intronic
1080343778 11:31298069-31298091 GAACTCGGAATATCTGAGACAGG - Intronic
1081660667 11:44886102-44886124 AAACTTGCCCTCCCTGGGACCGG + Intronic
1081912828 11:46711127-46711149 GAAGTGGGCCTGCCTGAGTCAGG - Intergenic
1083384452 11:62297161-62297183 GAGCTGGGCCTCCCACAGACAGG - Intronic
1083820632 11:65169480-65169502 GAAGTCGGCCTCCCCTAGAAAGG - Intergenic
1083894065 11:65611464-65611486 GCCCTCAGCCTCCCTGAGCCTGG - Intronic
1088316312 11:108510272-108510294 GAATTCTGCTTCCCTGAGGCTGG + Exonic
1091405537 12:206996-207018 GAGCTGGGCCTCGCTCAGACCGG + Intronic
1091793584 12:3285028-3285050 GAAGACCGCTTCCCTGAGACAGG + Exonic
1095959453 12:47825189-47825211 GAACACGGCCTCCATGAAGCTGG + Intronic
1096603185 12:52745143-52745165 GTCCTGGGCCTCCCTCAGACAGG - Intergenic
1096694811 12:53341770-53341792 CACCTCGGCCAGCCTGAGACAGG - Intronic
1102529837 12:113538097-113538119 GGACTCAGCCTCCCTGAGTGGGG + Intergenic
1106810849 13:33357680-33357702 CACCTCGGCCTCCCAAAGACTGG - Intergenic
1110670541 13:78172049-78172071 GCACACGGCCTCCCTGATTCAGG - Intergenic
1111130600 13:83970225-83970247 CAACTCGGCCTCCCAAAGGCTGG - Intergenic
1112167895 13:96939258-96939280 GAAGTCTGACTACCTGAGACTGG - Intergenic
1112851494 13:103711814-103711836 GAACTCAGCCACACTGAGAGAGG + Intergenic
1118808429 14:69257351-69257373 GAACTGGCCCTCCCTGGGATAGG - Intergenic
1122783375 14:104153160-104153182 GCTTTCGGCCTCCCTGTGACTGG + Intronic
1126172139 15:45704091-45704113 GAACTCGGGCTCCCTTAGACTGG - Intergenic
1127039869 15:54962847-54962869 GAACAGGGCCTCCCTGAACCAGG + Intergenic
1131435585 15:92419091-92419113 GAACTGGGGCTCCCTGGGTCTGG - Intronic
1131672317 15:94632684-94632706 GCCCTCAGCCTCCCTGAAACAGG + Intergenic
1132348046 15:101120569-101120591 GGACTTGGCCTCTCTGAGCCAGG + Intergenic
1133288150 16:4700709-4700731 GGAGTTGGCCTCCCTGAGCCTGG - Intronic
1134412597 16:14015468-14015490 GACCTGGGACTCCATGAGACCGG + Intergenic
1139138606 16:64234113-64234135 GAGCTGGGGCTCCCTGAGCCAGG + Intergenic
1141224362 16:82101167-82101189 GATCTTGGACTCCCTGAGAACGG - Intergenic
1146001542 17:29133428-29133450 GAACTGGGTCTCCCTGATCCTGG - Intronic
1147645140 17:42028795-42028817 GAACTCGGCCTCCCAGCTTCAGG - Exonic
1148457338 17:47818167-47818189 AAACTGGGGCTCCCTGAGGCAGG + Intronic
1160067298 18:75587537-75587559 GAATTTGGCTTCCCTGAGAGTGG - Intergenic
1160228954 18:77032121-77032143 GGGCTCGGCCTCCTTGAGAGGGG - Intronic
1160748519 19:722823-722845 GAACCCAGCCTCCCTGAGGAGGG + Intronic
1161114916 19:2491262-2491284 GACCTTGGCTTCCCTGAAACTGG + Intergenic
1161719019 19:5893021-5893043 GGCCTCGGGCTCCCTGAGAAAGG - Exonic
1163271596 19:16257926-16257948 CAGCTCTGTCTCCCTGAGACTGG + Intergenic
1167873175 19:52390328-52390350 GTTCACGGCCTCCCTGGGACTGG - Intergenic
1167889480 19:52528087-52528109 GGACGCGGCCTCCCTGGGACTGG - Intronic
1167894586 19:52570704-52570726 GAACTCGGCCTCCCTGAGACTGG - Exonic
1167903266 19:52637920-52637942 GTACGCGGCCTCCCTGGGACTGG + Intronic
1167909446 19:52690035-52690057 GGACACGGCCTCCCCGGGACAGG + Intronic
1167915165 19:52734604-52734626 GGACTCGGCCTCCCCGGGACTGG + Intronic
1167952325 19:53037455-53037477 GGACGCAGCCTCCCTGGGACTGG + Intergenic
1167991715 19:53366134-53366156 GAACTCGGCCTCCCCGGGACCGG - Intronic
1168717934 19:58539955-58539977 AGACTCTGCTTCCCTGAGACAGG + Intergenic
926528064 2:14007763-14007785 TACCTCTGCCTCTCTGAGACAGG + Intergenic
927148317 2:20181029-20181051 GAACTTGGGGTCCCTGAGGCTGG - Intergenic
927708312 2:25310570-25310592 GCACTCCGCCTCCCTGATCCTGG + Intronic
929822925 2:45287866-45287888 TCACTAGGCCTCCCTGAGGCGGG - Intergenic
932901949 2:75711025-75711047 GAACTCGGCCTACCAGATCCAGG - Intergenic
934662953 2:96152882-96152904 GGGCTCCTCCTCCCTGAGACGGG + Intergenic
937473436 2:122192978-122193000 GAACTCAGTCTCCCTGAGGCTGG + Intergenic
937877584 2:126837083-126837105 GGAGTCGGCCTCCCTGAAAATGG + Intergenic
937942058 2:127293856-127293878 GAACTCGGCCTAGGGGAGACGGG - Intronic
939778665 2:146417264-146417286 GAACTTGGCCTCCCTCCTACTGG + Intergenic
942419641 2:175794847-175794869 GAATTCCTCTTCCCTGAGACAGG - Intergenic
947124505 2:226853418-226853440 GAACTCGGCTTTCTTGAGGCAGG + Intronic
948306576 2:236952633-236952655 AAAATCGTCCTCCATGAGACTGG + Intergenic
949056945 2:241932869-241932891 CATCTCAGCCTCCCTGGGACAGG + Intergenic
1168952356 20:1811085-1811107 GCACGTGGCCTCCCTGGGACAGG + Intergenic
1174362549 20:50038048-50038070 GAAAGTGGGCTCCCTGAGACTGG + Intergenic
1178985696 21:37300981-37301003 GAACTTGGCCTCCTTGAAAACGG - Intergenic
1180182141 21:46122865-46122887 CGCCTCGGCCTCCCTGTGACAGG - Exonic
1181019652 22:20092651-20092673 GACCTGGGGCTCCCTGGGACTGG - Intronic
1184105503 22:42365484-42365506 GAGCCCTGCCTCCCTGCGACTGG + Intergenic
1184236493 22:43186048-43186070 GAACTAGGAGTCCCTGAGCCTGG - Intronic
1185078659 22:48696898-48696920 GTTTTCGGTCTCCCTGAGACGGG - Intronic
950449511 3:13057781-13057803 GAGCTCAGCCTGCCTGAGTCTGG + Intronic
953778236 3:45841853-45841875 CACCTCAGCCTCCCTGAGAAGGG - Intronic
954233414 3:49236592-49236614 GAACTGGGAATCACTGAGACTGG - Exonic
955714020 3:61809908-61809930 AAGCTCTGCCTCCCTGATACAGG - Intronic
959830919 3:110861584-110861606 TACCTCTGCCACCCTGAGACAGG + Intergenic
962388967 3:134955988-134956010 CAACTCGGCCTCCCTGGCACAGG - Intronic
962389877 3:134962536-134962558 AGATTCGGCCTTCCTGAGACTGG - Intronic
968572628 4:1350033-1350055 GGTCACGGCCTCCCTGAGAGGGG + Intronic
969330367 4:6471086-6471108 CCACTCGGTCTCCCTGACACAGG + Intronic
972310439 4:37877483-37877505 GATCTCGGATTCCCTGATACAGG - Intergenic
973265682 4:48208068-48208090 GAACTTGGCTTCCCAGAGGCAGG + Intronic
975579248 4:75892008-75892030 GAGCTCGGACTCCCTGGGCCAGG + Intronic
982099480 4:151953988-151954010 GAACTCAGCCTCAGTGAGTCTGG + Intergenic
995438226 5:112160970-112160992 GAACGCGGCCACCCTGAGTCTGG + Intronic
1002139936 5:177132580-177132602 GGACTCGGCCTCCCTGGGCGGGG + Intergenic
1002336219 5:178480273-178480295 AAACTCTGCCTCCCTCAGACAGG + Intronic
1007049021 6:38806937-38806959 GAACCCGGCCCCTCTGAGACTGG - Intronic
1007267829 6:40610580-40610602 GAACTGGGTCTACCTGTGACTGG - Intergenic
1007395506 6:41575565-41575587 GACCTCCCCCTCCCTGTGACAGG - Intronic
1007599738 6:43074566-43074588 GACCTCGGCCTCCCAAAGACTGG - Intronic
1007707207 6:43798222-43798244 AAACTGGGGCTCCCTGAGTCAGG - Intergenic
1008920844 6:56843374-56843396 GGACTCGGGCTCCCGGAGCCGGG - Intronic
1016973231 6:149784710-149784732 CACCTCGGCCTCCCAAAGACTGG + Intronic
1018341488 6:162855899-162855921 GAACCCGGACTCCGTGAGAAGGG - Intronic
1024825599 7:53386391-53386413 GAACTAGGCTCCCCTGTGACTGG + Intergenic
1026260761 7:68753424-68753446 GAACTCACCCTCCCTGACATAGG - Intergenic
1028390150 7:90306449-90306471 GAACCCAGCCACCCTGAGAAAGG - Intronic
1044549981 8:93501242-93501264 GAACTCAGCCTCCATGTGAGAGG - Intergenic
1047564277 8:126024640-126024662 GATATGGGCCCCCCTGAGACAGG + Intergenic
1048883830 8:138892604-138892626 GAGCTCTGCCTCCCAGGGACAGG - Intronic
1052020735 9:23522576-23522598 GAACTGGGCTTTCCTGAGAACGG + Intergenic
1056905322 9:90642632-90642654 TGACTCGCCCTCCCTGAGAGCGG + Intronic
1057076394 9:92140421-92140443 CAGCTCGGCCACCCTGAGGCTGG - Intergenic
1061261844 9:129484471-129484493 CAACTCGGCCTCTCTGAACCTGG + Intergenic
1185513055 X:677474-677496 GAACTCGGCATCCCCAGGACCGG - Intergenic
1186514540 X:10156801-10156823 AAACCCGGCGTCCCGGAGACAGG - Intergenic
1186825029 X:13330694-13330716 AAACTCGGCCTACCTGGGATTGG - Intergenic
1188542688 X:31267045-31267067 GAACCCGGACACCCAGAGACTGG + Intronic
1190141219 X:47846858-47846880 TAACTCCACCTCCCTAAGACAGG + Intronic
1190322444 X:49186922-49186944 GAACCTGGCCTCGCTGAGAGGGG - Intergenic
1197335049 X:125203172-125203194 GAACCCGGGCTCCCTGAGTGAGG + Intergenic