ID: 1167898779

View in Genome Browser
Species Human (GRCh38)
Location 19:52602454-52602476
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 967
Summary {0: 3, 1: 5, 2: 12, 3: 63, 4: 884}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900305884 1:2007661-2007683 AATAAGTAATACAGGGAAGGTGG + Intergenic
900781241 1:4618437-4618459 GACAATTTATAGAGGGAAGCAGG + Intergenic
900993141 1:6107017-6107039 GAGGGATAATGGAGGGAAGATGG + Intronic
900993464 1:6108288-6108310 GAGAGATGATAGAGGGAAGATGG + Intronic
901205324 1:7491437-7491459 GAGTAGACACAGAGGGAAGATGG + Intronic
901472920 1:9470224-9470246 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
901661204 1:10798997-10799019 GAGAAGGAATGGAGAGAGGATGG - Intergenic
902613694 1:17612084-17612106 GAGAATGAATGGAGGGAGGATGG - Intronic
902653832 1:17854013-17854035 GAGGAGTAAGACAGGGAAGAGGG + Intergenic
903359466 1:22767701-22767723 GAGAAGACACAGGGGGAAGAGGG - Intronic
903469400 1:23575365-23575387 GAGAAGTAATACAGTTAATATGG + Intergenic
904480732 1:30791713-30791735 GAGAAGGAAGAGAGGGAAGAAGG + Intergenic
905042431 1:34971144-34971166 GAGAAGCAAGAGAGAGAAGCAGG - Intergenic
905502521 1:38450947-38450969 GAAAAGACACAGAGGGAAGATGG - Intergenic
905609277 1:39335501-39335523 GAAAAGTAAGAGAGAGAAGAGGG + Intronic
905765095 1:40593856-40593878 GAGAAGAAAAAGAAAGAAGAGGG - Intergenic
906516740 1:46443433-46443455 GAGAAGGAAAAGGAGGAAGAAGG - Intergenic
906516746 1:46443467-46443489 GAGAAGGAAAAGGAGGAAGAAGG - Intergenic
907509639 1:54948631-54948653 GAGAAAGAACAGAGGAAAGAAGG - Intergenic
907952302 1:59195594-59195616 AAGAAGGAAGAGAGGGAGGAAGG - Intergenic
908032055 1:60011432-60011454 AAGAAGTGAGGGAGGGAAGAAGG - Intronic
908433598 1:64082790-64082812 GAGAAAGAAGAGTGGGAAGAAGG - Intronic
909103556 1:71380633-71380655 GAGAAAAAATAGAGCAAAGAAGG + Intergenic
909123527 1:71635496-71635518 GAGAAGTATTTGAGGCAAAATGG + Intronic
909540785 1:76789229-76789251 GAGAAGAGAAAGAGGGAAGATGG + Intergenic
909639913 1:77861568-77861590 GAGAAGGAAGAGAGGGAACAAGG - Intronic
909914232 1:81298041-81298063 GAGAAGTAAGGCAGAGAAGATGG + Intergenic
910158840 1:84252162-84252184 AAGACGTAACAGATGGAAGAGGG + Intergenic
911139980 1:94489528-94489550 GAGCAGGAATATAGGGATGAAGG - Intronic
911224547 1:95290899-95290921 GAGAAGTAACAGAGGGAGGACGG - Intergenic
911285024 1:95979899-95979921 GAGGAGAAAGAAAGGGAAGAGGG - Intergenic
911597615 1:99814752-99814774 GAGAAGTAAGAGATGAAACAAGG - Intergenic
911679415 1:100697609-100697631 GAGGACTACTAGAGTGAAGAGGG - Intergenic
912193431 1:107368225-107368247 GAGAAGGAAAAGAAGGAAGAGGG - Intronic
912472195 1:109913422-109913444 GAGAAGGAAGAGAGGAAGGAAGG + Intronic
913711117 1:121484647-121484669 TAGAAATAATAGAGGCTAGATGG + Intergenic
914058627 1:144187754-144187776 GAAAAGAAGGAGAGGGAAGAAGG - Intergenic
914120522 1:144778617-144778639 GAAAAGAAGGAGAGGGAAGAAGG + Intergenic
914829830 1:151162874-151162896 GAGTAGAAATAGAGCGAGGAAGG - Intronic
914880242 1:151541058-151541080 GAGAACTACAAGGGGGAAGAAGG - Intronic
914880632 1:151543942-151543964 AAGAAGGAAGAGAGGGAAGGAGG - Intronic
915509026 1:156376302-156376324 GAAAAGGAATTGAAGGAAGAAGG - Intronic
915650787 1:157308940-157308962 GAAAAGGGAGAGAGGGAAGAGGG - Intergenic
916185439 1:162127679-162127701 CAGAAGCAATAGAGAGACGAAGG + Intronic
916476082 1:165170272-165170294 GAGAAATAATGGAGGGAGAAAGG - Intergenic
916949413 1:169763717-169763739 GAGAGGTAATATAAGGAAAAGGG - Intronic
917287938 1:173441222-173441244 GAGAAGTAAAAGAAGCAAGTAGG - Intergenic
917591827 1:176483828-176483850 GAGATGTCATAGAGGGAATGGGG + Intronic
918030414 1:180802411-180802433 GAGAAGTAATGAAGGGTAGTGGG + Intronic
918094170 1:181321061-181321083 GAGAAGCAAGAGAGAGAGGAGGG + Intergenic
918522954 1:185434965-185434987 GAGAGGGAAGAGAGGGAAGAGGG - Intergenic
918656822 1:187037179-187037201 GAGAAGGAGTAGATAGAAGAGGG + Intergenic
918722818 1:187875598-187875620 CAGGAGAAATAGAGGGGAGAGGG + Intergenic
918843921 1:189583929-189583951 GAGAAGTCACAGAGTGAACAAGG - Intergenic
918900481 1:190410040-190410062 AAGAAGTAAAATAGGAAAGAAGG - Intronic
919770036 1:201152246-201152268 GAGAAGGAATGTGGGGAAGAGGG - Intronic
919930230 1:202216624-202216646 GAGAGGTAGTAGAGAGCAGAGGG + Intronic
920119801 1:203647882-203647904 GAGAAATCAGAGAGGGGAGAAGG + Intronic
920274682 1:204795358-204795380 GAGGAGTTCTAGAAGGAAGAAGG + Intergenic
920343107 1:205288075-205288097 GAGAACTATAAGAGGGAAGCAGG - Intergenic
920530045 1:206695210-206695232 GAGAAGGAATAGAGAGTAGTAGG + Intronic
920634485 1:207686188-207686210 GAGAAGGAAAGGAGGGAAGGAGG - Intronic
920747918 1:208646446-208646468 GAGGAATAATGGAGGGAGGAAGG - Intergenic
921082694 1:211755550-211755572 GAAAAAAAATAGAGGAAAGAAGG + Intronic
921317352 1:213905131-213905153 GAGAGGTGAGGGAGGGAAGAAGG + Intergenic
921557551 1:216616704-216616726 TAGAGATAATAGAGAGAAGAGGG - Intronic
921775247 1:219090578-219090600 AAAAAGGAATACAGGGAAGAAGG + Intergenic
921788225 1:219258686-219258708 AAGAAGTAATATAGTAAAGATGG - Intergenic
922076319 1:222248215-222248237 AGGAAGTAATAGAGGGTGGAAGG - Intergenic
923105865 1:230853245-230853267 GAGAACTGATAGAGTGAGGAAGG + Intronic
923183258 1:231543955-231543977 CAGAAGTACTGGTGGGAAGAAGG + Intronic
923230533 1:231982396-231982418 AAGAAGAAATAAAGGGGAGAAGG - Intronic
923247568 1:232147399-232147421 AAGAAAGAAAAGAGGGAAGAAGG + Intergenic
923344594 1:233039246-233039268 GGGAAGGAACAGAGGGAGGAAGG - Intronic
923563404 1:235058936-235058958 GAGAAGGAAGGGAGGGAGGAAGG + Intergenic
923613917 1:235520543-235520565 TGGAAGAAATAGAGGGTAGATGG - Intergenic
924216451 1:241827059-241827081 CAGAAGTATTAGGGAGAAGAGGG + Intergenic
924461465 1:244263356-244263378 GAGAAGGAAGAGAGGGAGGAGGG + Intergenic
1063384139 10:5605458-5605480 GGGAAGTAAGAGAACGAAGAGGG - Intergenic
1063789631 10:9427552-9427574 AAGAAGGAAGAGAGGGAAGGAGG + Intergenic
1063802229 10:9593380-9593402 GAGAAGAAATAGCGAGAAGAGGG + Intergenic
1063988368 10:11532960-11532982 GAGAAACAATGAAGGGAAGAAGG - Intronic
1064178511 10:13096159-13096181 GAGAAGGAAGAAAGGTAAGAAGG - Intronic
1065130323 10:22613493-22613515 CAGAACTGATGGAGGGAAGATGG + Intronic
1065198100 10:23286476-23286498 AAGAAGGAAGGGAGGGAAGAAGG + Intronic
1065822998 10:29543660-29543682 GAGGAGGAAGAGAGGTAAGAAGG - Intronic
1066047470 10:31605701-31605723 GAGAAGCAGCAGAGGGTAGAAGG - Intergenic
1066155920 10:32677800-32677822 AAGAAGAAAGAGAGGGAAAATGG - Intronic
1066556590 10:36621171-36621193 AAGAAGGAATAAAGGGAGGAAGG - Intergenic
1066686475 10:37986507-37986529 GAGAAGGAAAACAAGGAAGAAGG - Intergenic
1067380803 10:45771416-45771438 GAGAAGAAATAGGGAGTAGAGGG + Intronic
1067807912 10:49405909-49405931 GAGAAGGAAAAGGGGGAAGAGGG - Intergenic
1067958928 10:50825756-50825778 GGAAAGGAATAGAGGGAAGGTGG - Intronic
1068430173 10:56921233-56921255 GAGAATTAATAGAAGAAAAAAGG - Intergenic
1068438285 10:57018916-57018938 GATAAGTAGTTGAGGAAAGATGG - Intergenic
1068460895 10:57327000-57327022 GAGAAGGAAGAGAGAGAAGCAGG - Intergenic
1068659851 10:59612640-59612662 CAGAGGTAAGAGAGGGAAGGTGG - Intergenic
1068775269 10:60862103-60862125 GAGAAGAAAGAGAGGAAGGAAGG - Intergenic
1069455519 10:68550964-68550986 GAGCAGGAAGAGAGAGAAGATGG + Intergenic
1069696130 10:70386895-70386917 GAGAGGTAAGGGAGGGAGGAAGG + Intergenic
1070701955 10:78610371-78610393 GGGAAGTATTGGAGGGAAGGTGG + Intergenic
1070761947 10:79029442-79029464 GAGAAGTAGTAGAAGAAAGAAGG - Intergenic
1071065615 10:81631721-81631743 GAGAAGTAATAGAAGTGAGGTGG + Intergenic
1071229785 10:83572110-83572132 GAGAGGAAAGAGAGGGAAGAAGG + Intergenic
1071795382 10:88999231-88999253 AAGAAGTAACAGAAGGCAGAGGG - Intronic
1072824237 10:98590080-98590102 GAAAAGTAAGAGAGTAAAGAAGG + Intronic
1072946965 10:99819024-99819046 GGCAAGTAAGACAGGGAAGATGG + Intronic
1073225950 10:101919198-101919220 GAGAAGAAAGGGAGGGAAGGAGG - Intronic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1073518139 10:104097630-104097652 GTGAAGTAATGGGGGGAAGTGGG - Intergenic
1073748881 10:106501274-106501296 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
1073959594 10:108911668-108911690 GCGGAGAATTAGAGGGAAGATGG - Intergenic
1074598510 10:114889594-114889616 CTGAAGTAATAGAGGTAAGGTGG - Intronic
1074691336 10:116007335-116007357 GACAAGTAGGAGAGGGAGGAGGG + Intergenic
1074729136 10:116349816-116349838 GAAAAATAAGGGAGGGAAGAGGG + Intronic
1075963005 10:126585438-126585460 AAGAAGGAAAGGAGGGAAGAAGG + Intronic
1076075439 10:127530343-127530365 GAGAAGTTACAGGGGGAAGCTGG + Intergenic
1076088220 10:127654658-127654680 GAGGAGTGGTAGAGGGAAGGAGG - Intergenic
1076199690 10:128548040-128548062 AAGAAGGAAAAAAGGGAAGAAGG + Intergenic
1076530785 10:131142987-131143009 GAGAAGAGAGAGAGGCAAGATGG + Intronic
1076676738 10:132151013-132151035 GAGAAGGAATGGATGGAGGATGG - Intronic
1077829653 11:5852533-5852555 GAGGACTACTAGAGGGAGGAGGG - Intronic
1077868627 11:6243096-6243118 GAGCAGGAACAGAGGGAAGGGGG - Intronic
1078151595 11:8764250-8764272 AAGAAGCAGTAGAGGGTAGAGGG + Intronic
1078314797 11:10285333-10285355 GAGAAGGAAGAGAGGGGAGAGGG + Intronic
1078567001 11:12424316-12424338 GAGAATAAATACAGGAAAGATGG - Intronic
1078727512 11:13944849-13944871 CAGAAGAGTTAGAGGGAAGAAGG + Intergenic
1079056703 11:17212345-17212367 GAGAAAAGATAGAGGGAAGATGG + Intronic
1079938104 11:26642880-26642902 AAGAAGAAATAGAGGGAAGATGG - Intronic
1080032862 11:27680277-27680299 GAGAATGAAAAGAGGGAGGAAGG + Intronic
1080581776 11:33650323-33650345 GAGAAGGGAGAGAGGGAAGGTGG + Intronic
1080614339 11:33932961-33932983 GAGAGGAAATGGAGGGCAGAGGG - Intergenic
1080628575 11:34052380-34052402 GAGAAGAAAAAGCGGGAGGAAGG - Intronic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1081028358 11:38044961-38044983 GAGCTGTATTAGAGTGAAGATGG - Intergenic
1081259846 11:40946089-40946111 GAGGACTACTAGAGGGAGGAGGG - Intronic
1081758290 11:45559959-45559981 GTGAAGGAAGAGATGGAAGAAGG - Intergenic
1081896097 11:46588034-46588056 GAAAAGAAATAGAAGGAGGATGG + Intronic
1082282425 11:50284185-50284207 GAGAAGCAAGAGAGAGAAGTGGG + Intergenic
1082637386 11:55613125-55613147 GTCAAGTAATAGGGGGAAAATGG + Intergenic
1082807868 11:57461545-57461567 GAGAAGGAATAAAGGTTAGATGG + Intronic
1083058053 11:59842250-59842272 GAGGAGTAAGTGAAGGAAGAGGG - Intronic
1084050860 11:66599091-66599113 GGCAAGAAAGAGAGGGAAGAGGG - Intronic
1084166362 11:67376468-67376490 AAGAAGGAAGAGAGGAAAGACGG + Intronic
1084469753 11:69352232-69352254 TAGAACTAATAGATGGATGAAGG - Intronic
1084551550 11:69846179-69846201 GAGAAGACACAGAGGGGAGAAGG + Intergenic
1084998035 11:73002690-73002712 GAGAAGGGATAAAGAGAAGAGGG - Intronic
1085214666 11:74818287-74818309 AAGAAGAAATGGAGGAAAGAAGG + Intronic
1085335416 11:75690053-75690075 AAGAAGAAGTAGAAGGAAGAAGG - Intergenic
1085420519 11:76354392-76354414 GAGAAATAATGGAGGAGAGAGGG - Intronic
1085847507 11:80083194-80083216 AAGAAGGAAGAGAGGGAGGACGG - Intergenic
1086193153 11:84104409-84104431 GGGAAATATAAGAGGGAAGAAGG + Intronic
1086313992 11:85569980-85570002 GCAAACTACTAGAGGGAAGAGGG + Intronic
1086477862 11:87198659-87198681 AGGAAGTAAGAGAGGGAAGGAGG - Intronic
1087361034 11:97159779-97159801 GAAAAGTAATACAGTGAAAATGG + Intergenic
1087426014 11:97987091-97987113 GAGAAGTGATATATAGAAGATGG + Intergenic
1087586223 11:100125324-100125346 GAGGATTACTAGAGGGAAGTAGG - Intronic
1087806522 11:102561378-102561400 GAGAAGGAAAAGAAGGAAGGAGG - Intergenic
1088190926 11:107227369-107227391 TAGAAATAAAAGAAGGAAGAGGG - Intergenic
1088365053 11:109031878-109031900 GTGAACTAATGGAGGAAAGATGG - Intergenic
1088667336 11:112106534-112106556 GAGAAGAAATACAGGGTAAATGG + Intronic
1089184778 11:116607378-116607400 GAGAAGGAAAAGGGGGAGGAAGG - Intergenic
1089451743 11:118603274-118603296 GAGAAGTGATCCAGGGATGAGGG + Intergenic
1090046493 11:123339739-123339761 GGGAACTACTAGAGGGAGGAGGG + Intergenic
1090243336 11:125199139-125199161 GAGGAGAAAAAAAGGGAAGAAGG - Intronic
1090531077 11:127592010-127592032 GAGAAGGAAGAAAGGAAAGAAGG + Intergenic
1090585336 11:128205996-128206018 GAGGAGCAAGAGAGGGAGGAGGG + Intergenic
1091427756 12:406231-406253 GAAAAGTAAAACAGAGAAGAGGG + Intronic
1091750956 12:3020943-3020965 GAGGAGGGAAAGAGGGAAGAGGG - Intronic
1091771450 12:3154579-3154601 GGGAAGGAAGAGAGGGAGGAAGG - Intronic
1091901962 12:4151526-4151548 GAGAAAGAAAAGAGGGAAGGAGG - Intergenic
1091998616 12:5015345-5015367 GGGAAGAAATAGAGGAATGAAGG + Intergenic
1092233323 12:6790044-6790066 GAGGAGAAAAAGAGTGAAGAAGG + Intronic
1092334298 12:7615153-7615175 GAAAAAGAAAAGAGGGAAGAAGG + Intergenic
1092778518 12:11964585-11964607 GGGAAGGAAGAGAGGGAGGAAGG - Intergenic
1092884781 12:12915605-12915627 GAGAAGGAGGAGAAGGAAGAAGG - Exonic
1093094539 12:14957831-14957853 GAGAAGGAAGAGGGGAAAGAGGG + Intronic
1093492552 12:19721823-19721845 GGGAAGAAGAAGAGGGAAGAAGG - Intergenic
1093839225 12:23875578-23875600 GAGGAGGAAGAGAGGAAAGAAGG + Intronic
1094037869 12:26090048-26090070 AAGAGGTAACAGATGGAAGAAGG + Intergenic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1094583227 12:31753815-31753837 GAGAAGTTGTAGAGAGAAAAAGG + Intergenic
1094619249 12:32064558-32064580 AAGAAGAAGGAGAGGGAAGAAGG + Intergenic
1095153429 12:38823051-38823073 GAGAAGGAAGAGGAGGAAGAGGG - Intronic
1095398238 12:41785770-41785792 AAGAATTAAAAGAGGCAAGAGGG - Intergenic
1096640122 12:52987714-52987736 GAGAAGAAAGAAAGGGAGGAAGG + Intergenic
1097032876 12:56102115-56102137 GAGAGGGAATAGGGAGAAGACGG - Exonic
1097347908 12:58515323-58515345 GAGAAGTCCTAGAAGTAAGAAGG - Intergenic
1097377572 12:58858276-58858298 GAGGAGAGAGAGAGGGAAGAGGG - Intergenic
1097699591 12:62806643-62806665 GAGAAGGAAGAGAGTGAAGGGGG - Intronic
1097824093 12:64156895-64156917 AAGAAGTGATAGGGGGAATAAGG + Exonic
1098668228 12:73192116-73192138 AAGAAATAATAGGGGAAAGAAGG - Intergenic
1099079426 12:78157810-78157832 GAGGAGAAAAAGAAGGAAGAGGG + Intronic
1099163838 12:79276934-79276956 GAGAAGAAGAAGAAGGAAGAAGG + Intronic
1099769705 12:87035276-87035298 GAGAGGAAATAGAGGGATGGAGG + Intergenic
1100065684 12:90641393-90641415 GGGAAGGAAGGGAGGGAAGAAGG + Intergenic
1100290400 12:93208584-93208606 GAGAATGAATTGAGAGAAGAGGG + Intergenic
1100393674 12:94165879-94165901 GAGGAGGAAGTGAGGGAAGAGGG + Intronic
1100465289 12:94839183-94839205 GAGAAGCAAGAGAGAGGAGAGGG + Intergenic
1100650350 12:96581066-96581088 GAGCAGTAATAGTAGAAAGAGGG - Exonic
1100991356 12:100254708-100254730 AAGAAGAAAGAGAGGGAAGGAGG - Intronic
1101266401 12:103092917-103092939 CAGAAGTGAAACAGGGAAGAGGG - Intergenic
1101430664 12:104624252-104624274 GAGAAGAAAAAGAAGGGAGACGG + Intronic
1101638317 12:106565928-106565950 GAGAAGGAAGGGAGGGAGGAAGG + Intronic
1101672165 12:106885710-106885732 GGAAAGAAAAAGAGGGAAGAGGG - Intronic
1101861883 12:108489149-108489171 GAGAAGGGAAAGAGGGAAGGAGG + Intergenic
1101982584 12:109420513-109420535 GAGGAGGAATAGAGTGAAGGGGG + Intronic
1102180317 12:110907608-110907630 GAGAAGTAAAAGCGGGAACAGGG + Intergenic
1102556076 12:113727391-113727413 GAGAAGAAAGAAAGGGAGGAAGG - Intergenic
1102657819 12:114497761-114497783 GAGAAGCTTGAGAGGGAAGAGGG - Intergenic
1102822956 12:115923797-115923819 GAGAAGAAAGAGAGGAAACAAGG - Intergenic
1103023566 12:117555852-117555874 TAGAAGTAACAGAAGGGAGAGGG - Intronic
1103044825 12:117727370-117727392 GTGAAGAAAAAGAAGGAAGAAGG + Intronic
1103104385 12:118210192-118210214 AAGAAGAAAAAGAGGGAGGAAGG - Intronic
1103200972 12:119087674-119087696 GAGAGGAAATAGGGAGAAGATGG + Intronic
1103602661 12:122064022-122064044 GAGGAGCGATAGAGGGAAGTTGG - Intergenic
1104074980 12:125380949-125380971 GAAAATTAATCCAGGGAAGAGGG - Intronic
1104335775 12:127893285-127893307 GTAAAGTAATAAAGGGAAGGAGG + Intergenic
1105563556 13:21519570-21519592 GGGAAGAAATAGAGTGAAAAGGG - Intronic
1106777181 13:33019767-33019789 GAGAAGGAGAAGAGGGGAGAGGG + Intronic
1107375710 13:39801989-39802011 GAGAAGAAAGAGAGGGAAAGGGG + Intergenic
1107563445 13:41578144-41578166 AAGAAGAAAGAAAGGGAAGAGGG - Intronic
1107667003 13:42700765-42700787 AAGAAGGAAAAGAGGAAAGAAGG + Intergenic
1107794445 13:44035562-44035584 GAGAAGAAAAGGAGGGAAGGAGG + Intergenic
1108775350 13:53759099-53759121 AAGAATGAAAAGAGGGAAGAAGG - Intergenic
1109425378 13:62160208-62160230 GGGAGGTAATATAGGGAAGTCGG + Intergenic
1109576879 13:64271214-64271236 AAGAAGGAAAAGAGGGAAGGAGG - Intergenic
1109971743 13:69779396-69779418 GGGAAGGAAAGGAGGGAAGAGGG - Intronic
1110171622 13:72507566-72507588 GAGAAGTAGGAGTGGGAAGCTGG - Intergenic
1110348583 13:74478788-74478810 TAGAAGAAAAAGATGGAAGAAGG - Intergenic
1110387524 13:74931518-74931540 GAGAGGTAATGGAGGGAGTAGGG - Intergenic
1110638044 13:77789221-77789243 GAGAAGTTGTAAAGCGAAGAAGG + Intergenic
1110644011 13:77860169-77860191 GAGAAGTAAAACAGGAAGGAAGG - Intergenic
1110846499 13:80195804-80195826 GAGAAGGAAAAAAGGGAAGGAGG + Intergenic
1110969290 13:81740624-81740646 GAGAAGTTATAGGAAGAAGAAGG + Intergenic
1111368729 13:87287584-87287606 GAGAAGTAAAAGAAGGGACAAGG + Intergenic
1111745401 13:92262127-92262149 GAGAAGTACTGGAAGGAAAAGGG - Intronic
1111779427 13:92702834-92702856 GGGAAGTCATGGAGGGAGGAGGG - Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112630239 13:101153420-101153442 GAGAAGAAATTGGGGAAAGAGGG - Intronic
1113024191 13:105922211-105922233 AAGAAGAAATGGAGGGAAGAGGG - Intergenic
1113315975 13:109179253-109179275 GATAAGTATTGGAGGGGAGAAGG - Intronic
1113891495 13:113737932-113737954 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1114281300 14:21194595-21194617 GAGAAATCATAGAGGCAAGAAGG + Intergenic
1114585340 14:23807276-23807298 GAGAAGTAACAGAGTCAAAAAGG + Intergenic
1114655741 14:24314691-24314713 GAGCAGTGAGAGAGGAAAGAGGG - Exonic
1114910292 14:27185406-27185428 AAGAAGTAATAGATGTAAAATGG - Intergenic
1114969722 14:28011635-28011657 GAGAAGAGAAAGAGGCAAGAAGG + Intergenic
1115090800 14:29572601-29572623 GAGAGATAATAGAGGGTAAAAGG + Intergenic
1115443783 14:33466166-33466188 GAGAAGCAAGAGAGGGACCATGG + Intronic
1115683639 14:35769439-35769461 GGGAAGTACTAGAGGGACAAGGG + Intronic
1115945403 14:38654204-38654226 GAGAAGTAATAAAAGCCAGATGG - Intergenic
1116319971 14:43448990-43449012 GAGAAGGAAAAGAGAGAGGATGG + Intergenic
1116507184 14:45698588-45698610 CAGAAGCAAGAGAGAGAAGAGGG - Intergenic
1116761703 14:49022878-49022900 GATACATAATAGAGGCAAGAAGG - Intergenic
1117214965 14:53541553-53541575 GAGAAGAGAAAGAGGGAAGAGGG + Intergenic
1117388246 14:55238154-55238176 GAGAAGTAGTAGATGAAAGGAGG - Intergenic
1118055827 14:62078588-62078610 GGGAAGTAAGGCAGGGAAGAAGG + Intronic
1118963269 14:70555786-70555808 GAGAAGTAAGAGGGTGCAGAGGG - Intergenic
1119054561 14:71406082-71406104 GAGAAGTAAAGGAGTTAAGATGG + Intronic
1119065851 14:71525511-71525533 GAGAAGAAATAAAGAAAAGAAGG - Intronic
1119103794 14:71905475-71905497 GAAAAGAAACAGAGAGAAGAAGG - Intergenic
1119255999 14:73197475-73197497 GAGAAGTACTTGAAGTAAGAGGG - Intronic
1119510542 14:75207765-75207787 GAGAAGGAAGAGAGCCAAGAAGG + Intergenic
1119609233 14:76047704-76047726 GGGAAGGAACAGAGGGAGGAAGG - Intronic
1119922209 14:78456966-78456988 GAGAAGGAGGAGAAGGAAGAAGG - Intronic
1120470540 14:84918273-84918295 GAGAAGAAAAAGAAGGAAGAAGG - Intergenic
1120721237 14:87891622-87891644 GAGAGACAAAAGAGGGAAGAAGG + Intronic
1120781762 14:88491988-88492010 AATAAGTAAAAGAGGGAAGAGGG - Intronic
1120824904 14:88946271-88946293 GAGAGGGAAGAGAGAGAAGAAGG + Intergenic
1120915496 14:89706578-89706600 GTGAGGTAATAGTGAGAAGATGG - Intergenic
1121005206 14:90486121-90486143 GTGAAGAACTAGAGGGGAGAGGG + Intergenic
1121077020 14:91077352-91077374 GAGAAGGAAGGGAGGGAGGAAGG + Intronic
1121104184 14:91270131-91270153 GAGGAGGAAGAGAGGGAAGGAGG - Intergenic
1121538544 14:94707969-94707991 GGAACGTGATAGAGGGAAGAGGG + Intergenic
1121624620 14:95374992-95375014 GAGAAGGGAGAGAGGAAAGAAGG - Intergenic
1121624651 14:95375095-95375117 GAGAAGGGAGAGAGGAAAGAAGG - Intergenic
1121888046 14:97562576-97562598 TAGAAGGAAGAGATGGAAGAAGG + Intergenic
1121986106 14:98507649-98507671 GAGAAGAAAAAGAGGGAGAAGGG + Intergenic
1124475457 15:30029398-30029420 GGGAAGGAGGAGAGGGAAGATGG - Intergenic
1124531882 15:30515803-30515825 GAAAGGAAATAAAGGGAAGAAGG + Intergenic
1125124992 15:36209776-36209798 GTGAAGATAGAGAGGGAAGAAGG + Intergenic
1125523702 15:40362312-40362334 GAGAAGTCACAGAGGGCTGAGGG - Intronic
1125968917 15:43896298-43896320 GTGAAGTCACAGAGGAAAGAAGG - Intronic
1125983574 15:44027158-44027180 GGGACGTAATATAGAGAAGAAGG - Intronic
1126639227 15:50807842-50807864 GAGGAGTAAGATAGGGAAGGGGG + Intergenic
1126674817 15:51151732-51151754 AAGAACTACTAGAGGGAGGAGGG + Intergenic
1126806981 15:52360812-52360834 GAGAATAACTTGAGGGAAGAAGG + Intronic
1126820444 15:52497785-52497807 AAGAAGAAATTGAGGGCAGAAGG + Intronic
1126860701 15:52879974-52879996 GAGCAGAAAGAGAAGGAAGAGGG - Intergenic
1127234910 15:57038451-57038473 GAGAAGGAAGAGAGGGAGGGAGG + Intronic
1127249554 15:57217634-57217656 GAGGAGGAATAGGGAGAAGAGGG - Intronic
1127560568 15:60132471-60132493 AGAAAGGAATAGAGGGAAGAAGG + Intergenic
1129202607 15:74013201-74013223 GAGAAGGAAGAAAAGGAAGATGG - Intronic
1129294296 15:74591454-74591476 GAGAAGGAAGAAAGGGAGGAAGG + Intronic
1129368963 15:75076022-75076044 CAGAAAAAATGGAGGGAAGAAGG + Intronic
1130042544 15:80417531-80417553 GAGAAGGAAGAGAAGGAGGAGGG - Intronic
1130077854 15:80705108-80705130 AAGAGGCAAGAGAGGGAAGATGG + Intronic
1130664260 15:85855959-85855981 CAGAAGCAAGAGAGGAAAGAGGG - Intergenic
1130713299 15:86305638-86305660 GAGTAGTAATAGGAGGAATATGG - Intronic
1130805511 15:87316988-87317010 GAGAAGGAAGAAAGGAAAGAAGG + Intergenic
1130847155 15:87758169-87758191 GAGAAGGAAAGGAGGGAAGGAGG + Intergenic
1131024808 15:89131214-89131236 CACAAGGAATATAGGGAAGAAGG - Intronic
1132206187 15:99987756-99987778 GAGAAGGCAGAGAGGGAAAACGG + Intronic
1133452586 16:5916371-5916393 AAGAAATAAGAGAGGGAGGAAGG - Intergenic
1133656711 16:7872049-7872071 GGGAAGGAAGGGAGGGAAGAAGG - Intergenic
1133863524 16:9619517-9619539 AAGAAATAAGAAAGGGAAGATGG + Intergenic
1135531642 16:23259724-23259746 GAGAAGGGAAAGAGGGAAAAGGG + Intergenic
1135543348 16:23349051-23349073 GAAAAGTAATAAAGGGAGAAAGG - Intronic
1135627174 16:24006076-24006098 GATAAGTGAGAGAGGGAAGAAGG - Intronic
1135877756 16:26219191-26219213 GGGAAGTAATAGAGAGAAAAAGG - Intergenic
1135983753 16:27168588-27168610 GAGAAGGGAGGGAGGGAAGAAGG + Intergenic
1136939670 16:34511004-34511026 GGAAAGGAAGAGAGGGAAGAAGG - Intergenic
1136960150 16:34837556-34837578 GGAAAGGAAGAGAGGGAAGAAGG + Intergenic
1137498303 16:48988901-48988923 AAGAAGGAATGGAGGGAAGGAGG - Intergenic
1137800970 16:51261947-51261969 AAGAAGGGAGAGAGGGAAGAAGG - Intergenic
1138009511 16:53364368-53364390 AAGAAAAAATAAAGGGAAGATGG - Intergenic
1138154116 16:54686654-54686676 GATACGTAATAGATGGATGATGG - Intergenic
1138202555 16:55100972-55100994 AGGAAGGAATGGAGGGAAGAAGG + Intergenic
1138486729 16:57349938-57349960 GAGAAGGAAGAGAGGGAGGAAGG - Intergenic
1138713988 16:59000790-59000812 GACAATGAATAGAGAGAAGAAGG - Intergenic
1138788456 16:59873390-59873412 GAGACGGATTATAGGGAAGAAGG + Intergenic
1138967087 16:62097619-62097641 GAGAAGCATTACAAGGAAGATGG + Intergenic
1138967099 16:62097794-62097816 GAGAAGCATTACAAGGAAGATGG + Intergenic
1139246763 16:65452326-65452348 AGGAAGTAAGAGAGGGAGGATGG + Intergenic
1139278518 16:65749994-65750016 GGGAAGGAAGAGAGGGAGGAAGG + Intergenic
1139561137 16:67743161-67743183 GAGAAGTCATAGAGGGGATGTGG + Intronic
1139662436 16:68430205-68430227 GAGGGGGCATAGAGGGAAGAGGG - Intronic
1140496748 16:75396006-75396028 GAGAAGTCATGGAGGGGAGATGG - Intronic
1140943608 16:79747090-79747112 GAGAAGGAGACGAGGGAAGAGGG + Intergenic
1141059880 16:80856631-80856653 GAGTTGTAATAGATGGATGAAGG - Intergenic
1141364071 16:83426131-83426153 GAGAAGGAATGGATGAAAGAGGG - Intronic
1141382888 16:83591612-83591634 GAGAATTCAGAGAAGGAAGAAGG - Intronic
1141794069 16:86257778-86257800 AAGAAGTCATAGAGCAAAGAGGG - Intergenic
1141799574 16:86297725-86297747 GAGAAGGAAGGGAGGGAAAAGGG - Intergenic
1141856223 16:86683106-86683128 GAGAAGGAAAAGAAGGAAGGAGG + Intergenic
1142135023 16:88447960-88447982 AAGAAGGAAGGGAGGGAAGAGGG + Intergenic
1142507539 17:374474-374496 GAAAAGTAAAACAGGTAAGAGGG + Intronic
1142553514 17:755961-755983 GAGCAGGAAGGGAGGGAAGAGGG - Intergenic
1142820486 17:2462628-2462650 GAGGAGGAAGAGAGGGAAGGAGG - Intronic
1142903176 17:3026117-3026139 GAGAAGTAAGAGAGTGAGGGTGG + Exonic
1142953893 17:3506985-3507007 GAGAAGGAAGGGAGGGAGGAAGG + Intronic
1143508974 17:7384787-7384809 GAGAGCGAATGGAGGGAAGAGGG - Intronic
1143530659 17:7501370-7501392 AGGACGTAATAGAGGTAAGAGGG + Exonic
1143590120 17:7880288-7880310 GAGAAGTAAGAGAGGGAAAGAGG + Intronic
1144044307 17:11441098-11441120 TTGAAGTCATGGAGGGAAGAAGG - Intronic
1144355785 17:14444901-14444923 GATAAATAATACAGGGGAGATGG - Intergenic
1145270514 17:21402224-21402246 GAGAAGAGAATGAGGGAAGAGGG - Intronic
1145722661 17:27088352-27088374 GAGAAGGAAGAGAGGGAGGTAGG - Intergenic
1145901096 17:28491009-28491031 GAGAAGAAAGAGATGCAAGAAGG + Intronic
1146363701 17:32201159-32201181 GAAAACTAATAGAGTGTAGATGG - Intronic
1146366473 17:32232907-32232929 GAAAAGTAAGAGATGTAAGAGGG - Intronic
1146547698 17:33753300-33753322 GGGAAGAAAAGGAGGGAAGAAGG + Intronic
1146554019 17:33807567-33807589 GAGAAGAAAGAGAGTAAAGAGGG - Intronic
1146914003 17:36666504-36666526 GAGGAGGAAGAGAGGGAAAAAGG + Intergenic
1147039397 17:37706396-37706418 GGGAAGTGAAAGATGGAAGAAGG - Intronic
1147571435 17:41573458-41573480 GAGTATTCTTAGAGGGAAGAAGG - Intergenic
1148410175 17:47459504-47459526 GAGAAGTATGAGAGAGAAAATGG + Intergenic
1148612344 17:48972654-48972676 GAGAAGCCAGAGAGGGAAGTCGG - Intergenic
1148673838 17:49433359-49433381 GAGAAGGAAGGGAGGGAAGATGG + Intronic
1148721220 17:49754648-49754670 GAGAAGAAGGGGAGGGAAGAGGG + Intronic
1149031472 17:52087542-52087564 GAAAAGTTATTCAGGGAAGAAGG - Intronic
1149136760 17:53375758-53375780 GGGGAGTACTAGAGGGAAGGAGG - Intergenic
1150810283 17:68350841-68350863 GAGAAGAGATAGAAGGAAGGAGG + Intronic
1150822214 17:68444862-68444884 GAGAAGGAAGAGAGGGAGGGAGG - Intronic
1151052643 17:70995874-70995896 GAGAAGATGGAGAGGGAAGATGG - Intergenic
1151190410 17:72393912-72393934 GAAAGAAAATAGAGGGAAGAGGG + Intergenic
1152003216 17:77660286-77660308 AAGAAGGAAAGGAGGGAAGAAGG - Intergenic
1152475777 17:80517050-80517072 GAAAAGTAAAAGAGGAAAGAGGG + Intergenic
1152574322 17:81133483-81133505 GAGAAGTCAGGGAGGGAGGAGGG - Intronic
1152913043 17:83016490-83016512 GAGAAGGGATGGAGGGAGGAGGG + Intronic
1153193432 18:2568338-2568360 GAAATGAATTAGAGGGAAGAAGG + Intronic
1153531356 18:6049704-6049726 GGAAACTAATAGAGGGAGGAGGG + Intronic
1153597557 18:6743107-6743129 GAGAAGGAAGAGAGAGAAGAGGG + Intronic
1155034521 18:22014664-22014686 GAGAATAAAGAGAGGGAAAAAGG - Intergenic
1155384419 18:25261625-25261647 GAGAAAAAATAGAGGAGAGAAGG - Intronic
1155587783 18:27387560-27387582 GAGAACTAATAGAGAAAAAAAGG + Intergenic
1155853981 18:30808942-30808964 GGGGAGTAATAGAGGGAGGAGGG - Intergenic
1155917779 18:31572980-31573002 GAGAGGAAAGAGAGGGAAGGAGG + Intergenic
1155943921 18:31826578-31826600 GAGATTTCAGAGAGGGAAGAGGG - Intergenic
1156237209 18:35217020-35217042 AAGAAGGAATAGAGGGTGGAAGG - Intergenic
1156349953 18:36295547-36295569 GAGAAGTGGGAGATGGAAGATGG + Intergenic
1156684625 18:39629709-39629731 GAGAAGGAAGAAAGAGAAGAAGG - Intergenic
1156736772 18:40269625-40269647 GAGAAATGAAAGAAGGAAGAAGG - Intergenic
1156824835 18:41418568-41418590 CAGGAATAAAAGAGGGAAGAAGG - Intergenic
1157836815 18:50911500-50911522 GAGAGTTAACAGAGGGAAGTAGG + Intronic
1158003394 18:52644762-52644784 GAGAAGGAAGAAAGGAAAGAAGG + Intronic
1158032370 18:52981935-52981957 TAGAAGAAATCGAGGCAAGAAGG + Intronic
1158475456 18:57775436-57775458 AAGAAGGAAGAGAGGGAGGAAGG + Intronic
1158565558 18:58551400-58551422 GGAAAGATATAGAGGGAAGATGG - Intronic
1158602671 18:58868022-58868044 GAGAAGAAATAAATGGGAGATGG - Intronic
1159079756 18:63724063-63724085 GAGGAGGAAGAGAAGGAAGAAGG - Intronic
1159283111 18:66312291-66312313 AAGAAGGAATGGAGGAAAGAAGG + Intergenic
1159310262 18:66698469-66698491 GAGGAGAAAGGGAGGGAAGAAGG + Intergenic
1159520724 18:69518283-69518305 GAGAAGGAAGAGGAGGAAGAAGG - Intronic
1159568662 18:70086179-70086201 GAGAAGTAATACAGCAAAGTGGG + Intronic
1159778576 18:72633522-72633544 GAGAACTCATAGAGCAAAGAAGG + Intronic
1159829322 18:73254749-73254771 AGGAAGTAAGAGAGGGAGGAGGG + Intronic
1160100779 18:75917405-75917427 GAGAAGTGAGAGAGGAGAGACGG - Intergenic
1160135290 18:76266316-76266338 GAGAAGGAAGGGAGGGAGGAAGG + Intergenic
1160135310 18:76266387-76266409 GAGAAGGAAGGGAGGGAGGAAGG + Intergenic
1160175936 18:76594041-76594063 GGGAAGTTTTGGAGGGAAGATGG - Intergenic
1160313339 18:77818532-77818554 AAGAAGGAAGAAAGGGAAGATGG - Intergenic
1160408277 18:78657953-78657975 GAAAAGTTTTAGAGGGAAGGAGG + Intergenic
1161754153 19:6119386-6119408 AAGAAGGAATGGAGGGAAGGAGG - Intronic
1161849377 19:6730831-6730853 GAGAAGGGATGGAGGGGAGATGG - Intronic
1162059429 19:8085841-8085863 CAGAAGGGACAGAGGGAAGAGGG + Intronic
1162641616 19:12014639-12014661 GAGAAGTCACAGAGGGAGAATGG - Intergenic
1163054599 19:14708849-14708871 GTGAAGATATAGAGAGAAGATGG - Intronic
1163176288 19:15566113-15566135 GAGAAGAAATAAAGAGAACACGG - Intergenic
1163204911 19:15795235-15795257 GAGAAGGGAAAGAGGGAAGTAGG - Intergenic
1163254506 19:16147392-16147414 GAGAATCACTTGAGGGAAGAAGG + Intronic
1164260757 19:23566914-23566936 GGGAAGTAAAAGACAGAAGAGGG + Intronic
1164567662 19:29339479-29339501 GAGAAGGAAGAGGAGGAAGAAGG + Intergenic
1164790341 19:30972133-30972155 GAGGAGTAAGAGCGAGAAGACGG - Intergenic
1165897900 19:39154572-39154594 GAGAAGGAAAAGAAGGAAAAGGG + Intronic
1166215477 19:41331881-41331903 GTGAAGTAACAGAGGGATGGGGG - Intronic
1166248296 19:41546574-41546596 AAGAAATCATAGAGGGAGGAGGG - Intergenic
1166994023 19:46710759-46710781 AGGAAGTAATAATGGGAAGAAGG - Intronic
1167128897 19:47571745-47571767 GAGAAGTCAAACAGGGAAAAGGG - Intergenic
1167531886 19:50022937-50022959 GAGAGGTCAGAGAGGGAACAGGG - Intronic
1167859423 19:52270794-52270816 AAGAAGGAATAGAGGGAAGAAGG + Intronic
1167862832 19:52298746-52298768 GAGAAGGAATAGAAGGAAGAAGG + Intronic
1167867152 19:52337497-52337519 GAGAAGGAATAGAGGGAAGAGGG + Intronic
1167889633 19:52528924-52528946 GAGAAGGAATAGAGGGAAGAAGG + Intronic
1167890751 19:52537237-52537259 GAGGAGTAATAGAGGGAAGAAGG + Intronic
1167898779 19:52602454-52602476 GAGAAGTAATAGAGGGAAGAAGG + Intronic
1167903111 19:52637103-52637125 GAGAAGGAATAGAGGGAAGAAGG - Intronic
1167904512 19:52647723-52647745 GAGAAGGAATAGAGGTAAGAAGG - Intronic
1167909244 19:52688614-52688636 GAGAAGGAATAGAGTGAAGAAGG - Intronic
1167913627 19:52723192-52723214 GAGAAGCAATAGAGGGAAGAAGG - Intronic
1167915003 19:52733754-52733776 GAGAAGGAATAAAGGGAAGAAGG - Intronic
1167921256 19:52785182-52785204 GAGAAGTAATAGAGGGAAGAAGG - Intronic
1167940306 19:52941400-52941422 GAGAAGTAATAGAGGGAAGAAGG - Intronic
1167946323 19:52992073-52992095 GAGAAGAAATAGACCAAAGAAGG - Intergenic
1167958804 19:53089891-53089913 GAGAAGGAATGGAGGGAAGAAGG - Intronic
1167964361 19:53131672-53131694 GAGAAAGAATAGAGGGAAGACGG - Intronic
924961927 2:43458-43480 GAGAAATAGTTGAAGGAAGAGGG - Intronic
925398764 2:3556930-3556952 GATAAGTTAGAGAAGGAAGAAGG - Intronic
925443326 2:3907098-3907120 GGGAAGGAAGAGAGGGAGGAAGG - Intergenic
925462550 2:4075838-4075860 GAGAAGGAAAAGAGGGAGGCAGG - Intergenic
925547029 2:5027804-5027826 GGGAAGTAATAGAGGAAAGAGGG - Intergenic
925573470 2:5335801-5335823 GAAAATTAAAAGGGGGAAGAAGG - Intergenic
926049790 2:9737516-9737538 GAGGAGTACTAGAGGGAGTAGGG - Intergenic
926531669 2:14054485-14054507 GAGAAGAGTTAGAGGGATGAGGG + Intergenic
926798649 2:16639834-16639856 GATAAGTCAGAGAGGGAGGAGGG + Intronic
927271698 2:21217216-21217238 GAGAAGTGTAAGAGGAAAGAGGG + Intergenic
928543935 2:32311394-32311416 GAGAAAGAATATAGGGAAGATGG + Exonic
928634830 2:33234186-33234208 GAGAAGAACAAGATGGAAGAGGG - Intronic
929103257 2:38338294-38338316 GGGGAGTACTAGAGGGGAGAGGG + Intronic
929172945 2:38949523-38949545 CAGAAGTAAGGAAGGGAAGAAGG - Intronic
929494252 2:42425476-42425498 GAAGAGAAATAGAGGGATGATGG + Intergenic
930414659 2:51076237-51076259 GAGAGAAAATAGGGGGAAGAAGG + Intergenic
930426816 2:51223277-51223299 GAGAAGAAAAAGAGAGAAAAAGG + Intergenic
931209749 2:60181249-60181271 GAGAAATAATGGAGGAGAGAAGG + Intergenic
931316613 2:61139051-61139073 GAGAAGGAAGGGAGGGAGGAGGG - Intergenic
931438294 2:62268048-62268070 TAGAAGTAATAAAGGGAAAGAGG + Intergenic
931839294 2:66131700-66131722 AAGAAGTAATAGAGAGTGGAAGG - Intergenic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG + Intronic
933346532 2:81093081-81093103 GAGGAGAGAGAGAGGGAAGAAGG + Intergenic
934041024 2:88127531-88127553 GAGAAGAAATAAAGGTAATAAGG - Intronic
934997205 2:98975179-98975201 CAGAAGTAATGGAGGCCAGAAGG + Intergenic
936642406 2:114329786-114329808 GAGAAGTCATGAAGGGAAGGTGG + Intergenic
936848374 2:116866208-116866230 GAACAGTAATAGAAGGAAGGGGG + Intergenic
937283049 2:120733591-120733613 GAGAAGAAAAACAGAGAAGAAGG + Intergenic
937305609 2:120868710-120868732 GAGAAATGGTCGAGGGAAGAGGG + Intronic
937444079 2:121941914-121941936 GGAAAGGAAAAGAGGGAAGAAGG - Intergenic
937539895 2:122936359-122936381 GAGAAGAAATGGACAGAAGAGGG + Intergenic
937755866 2:125538139-125538161 AAGGAGTAATGGAAGGAAGATGG + Intergenic
937770545 2:125715633-125715655 GTGAACTACTAGAGGGGAGAGGG + Intergenic
937822634 2:126328050-126328072 AAGAGGTAATAAAGGGAATAAGG - Intergenic
939069451 2:137521489-137521511 GAGAAGAAAAAGAGGGATGGGGG - Intronic
939175184 2:138739993-138740015 GAGCAGAGATAGAGGGATGAGGG - Intronic
939400877 2:141692297-141692319 GATAAGTAAGAGATGGAAAAGGG - Intronic
939638494 2:144611396-144611418 GAGAAGGAAAAGGGGAAAGAGGG - Intergenic
939645774 2:144697107-144697129 GGGAACTACTAGAGGCAAGAGGG - Intergenic
939733834 2:145819264-145819286 GAGAAGGGAGAGAGGGAGGAAGG - Intergenic
940179738 2:150918669-150918691 GAGAAGGAAAAGGGGAAAGACGG + Intergenic
940287798 2:152049579-152049601 GAGAAGAAAAAAAGGAAAGAAGG - Intronic
940579801 2:155564104-155564126 CAGAAGAAAGAGAGGGAAAAAGG + Intergenic
941124823 2:161571999-161572021 AAGAAAAAATTGAGGGAAGATGG - Intronic
941237421 2:162992532-162992554 GATAAGTGAGACAGGGAAGAGGG + Intergenic
941350305 2:164424348-164424370 AAGAAGGAACAGAGGGAGGAAGG + Intergenic
941913718 2:170793416-170793438 GAGAAATAAAGTAGGGAAGAAGG + Intronic
942402826 2:175621537-175621559 TAGAAGGAATAGAGGGACAAGGG + Intergenic
942857477 2:180566953-180566975 GTGAAGTAAGGGAGGGAACAGGG + Intergenic
943330758 2:186556300-186556322 AAGAAGGAATAGAGGGAGGGAGG - Intergenic
943657181 2:190522068-190522090 AGGAATTAATAGAGGGAGGAGGG + Intronic
944039568 2:195338520-195338542 GAGAAAGAAAAGAGGGAAAAAGG - Intergenic
944263750 2:197701768-197701790 AAAAAGTGAGAGAGGGAAGATGG - Intronic
944489018 2:200238323-200238345 GAGAAGGAAGAGAGAGAAGCTGG + Intergenic
945605220 2:211921247-211921269 GACAAGAAAGAGAGGGAAAAAGG - Intronic
945695816 2:213102947-213102969 GAAAAATAAGAGAGGTAAGATGG + Intronic
945771515 2:214048927-214048949 GAGAAGGAAGAAAGGAAAGAAGG - Intronic
945860837 2:215120260-215120282 GCAGAGTACTAGAGGGAAGAGGG + Intronic
946073035 2:217050626-217050648 GAGAAGAAATAAAAGGAAAAGGG + Intergenic
946277675 2:218643386-218643408 GAGAGGTAATAGAGGAGAGCCGG + Exonic
946294611 2:218773966-218773988 AAGAAGAAAGAGAGGGAAGAAGG - Intergenic
946524849 2:220507350-220507372 GAGAAGTAAGAAAGGAAGGAAGG - Intergenic
946641577 2:221789383-221789405 ATGAAGTAAAAGAGGGAAAAAGG - Intergenic
946969390 2:225074882-225074904 GACAAGAAAAAAAGGGAAGAAGG + Intergenic
947042776 2:225942489-225942511 GAGAAGGGGAAGAGGGAAGAGGG + Intergenic
947437881 2:230088592-230088614 GAAAAGGGAGAGAGGGAAGAAGG - Intergenic
947847818 2:233259738-233259760 GGGAAGATCTAGAGGGAAGAAGG - Intronic
947853402 2:233306712-233306734 CAGAAATAATAGTGGGAAGGAGG + Intergenic
948013083 2:234665504-234665526 GGGAAGGAAAAGAGGGAAGGAGG - Intergenic
948226327 2:236311903-236311925 GAGAAGAAATAGGAGGAAAAGGG - Intergenic
948458425 2:238117972-238117994 GAGGAGAAATAGATGGAGGAAGG + Intronic
948458469 2:238118129-238118151 GAGAAGGAATGGATGGAGGAGGG + Intronic
948939254 2:241187934-241187956 GAGAAGGAGGAGAGGGAAGGTGG + Intergenic
1169296261 20:4402613-4402635 AGGAAGTCAAAGAGGGAAGAGGG + Intergenic
1169995064 20:11547039-11547061 GAGAAAGACCAGAGGGAAGAAGG + Intergenic
1170193938 20:13671301-13671323 GAGAAGGAAGAAAGGAAAGAAGG - Intergenic
1171369806 20:24654608-24654630 GAGAAGGAAGAGAGGGAGGGAGG + Intronic
1171980883 20:31627925-31627947 AAGTAGACATAGAGGGAAGATGG + Intergenic
1173112407 20:40204611-40204633 GAGAAGTAAAGAAAGGAAGAAGG - Intergenic
1173149969 20:40558646-40558668 AAGAAATAATGGAGGGAAGAAGG + Intergenic
1173202481 20:40964276-40964298 GACAAGTATTAAAGGGAACATGG - Intergenic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1173265141 20:41472334-41472356 GAGAAGGGATGCAGGGAAGAGGG - Intronic
1174398309 20:50261349-50261371 GAGAAATAAAGGAGGGAAGCAGG - Intergenic
1174425600 20:50429909-50429931 GAGAAGCAGTAGAGGGTGGAAGG + Intergenic
1174692302 20:52518435-52518457 GGGAATTACTAGAGGGCAGAGGG - Intergenic
1174760989 20:53207227-53207249 GAGAAGGAAGAGAGGGAAATTGG + Intronic
1174792860 20:53496635-53496657 GAGAAGTCACAGAAGGATGAAGG + Intergenic
1174828004 20:53786413-53786435 GAGAAGGAAAAGAGAAAAGAAGG - Intergenic
1175122598 20:56727745-56727767 AAGAAGTAAGAAAGGGAAAAAGG - Intergenic
1175127539 20:56763661-56763683 GAGAAGAAAAATAGGGAAGAAGG + Intergenic
1175206170 20:57313185-57313207 GAAAGAAAATAGAGGGAAGAGGG - Intergenic
1175332533 20:58175256-58175278 GAGAAGGAAAAGAGGGAGGGAGG + Intergenic
1175474946 20:59265548-59265570 GAGAAGGAATGAAGGGAGGAAGG - Intergenic
1175554777 20:59842249-59842271 GAAAATTAATAGAAGCAAGAAGG - Intronic
1176345461 21:5740878-5740900 GAGAAGTAGTAGAAGGTTGAGGG - Intergenic
1176352275 21:5861462-5861484 GAGAAGTAGTAGAAGGTTGAGGG - Intergenic
1176499366 21:7583577-7583599 GAGAAGTAGTAGAAGGTTGAGGG + Intergenic
1176539782 21:8138948-8138970 GAGAAGTAGTAGAAGGTTGAGGG - Intergenic
1176558733 21:8321993-8322015 GAGAAGTAGTAGAAGGTTGAGGG - Intergenic
1176908870 21:14538311-14538333 AAGAAGTAATAGAGAGTAGGAGG + Intronic
1177093542 21:16801186-16801208 TAGTACTAATAGAGGAAAGAAGG - Intergenic
1177650876 21:23960841-23960863 GAGAACAAATACAGGGAAGTTGG + Intergenic
1178158181 21:29879345-29879367 GAGAAGCAAAAGAGTAAAGAGGG + Intronic
1178689729 21:34740966-34740988 GAGAAGGAAGAGAAGGGAGAAGG - Intergenic
1178777553 21:35566551-35566573 GAGGAAGAATAGAGGGAGGAAGG - Intronic
1178844232 21:36161071-36161093 GAGAAGGAAAAGATGGGAGAAGG + Intronic
1179011873 21:37562732-37562754 GAGATGCAAAAAAGGGAAGAAGG - Intergenic
1179166528 21:38939392-38939414 GAGAAGGAATGAAGGGAAGGGGG + Intergenic
1179525589 21:41974036-41974058 GAGGAGGAAAACAGGGAAGAAGG - Intergenic
1179799132 21:43802757-43802779 GGGAAGAAGTGGAGGGAAGAAGG - Intronic
1181901551 22:26160323-26160345 GAGAGGAAGTAGAGGGAAGGAGG + Intergenic
1182438030 22:30343278-30343300 GAGCAGAAATAGAGGGAGGTGGG - Intronic
1182675318 22:32034701-32034723 GAGAAGGACTAGAGGGATGCTGG + Intergenic
1182677785 22:32053364-32053386 GAGAAGGAAGAAAGGGAAGGAGG - Intronic
1182818961 22:33196776-33196798 GAGGAGGAAAAGAGGGAGGAGGG + Intronic
1183732751 22:39627851-39627873 GGGAAGGAAGAGAGGGAAGGAGG + Intronic
1184137244 22:42556471-42556493 GAGAATGAATAGGGGGAAGAAGG - Intronic
1185151611 22:49167130-49167152 AAGAAGGAAGAGAGGGAGGAAGG - Intergenic
1203244735 22_KI270733v1_random:55303-55325 GAGAAGTAGTAGAAGGTTGAGGG - Intergenic
949441695 3:4088211-4088233 TGGAAGGAATAGATGGAAGAAGG - Intronic
949765366 3:7520397-7520419 GAGAATTAATAAGGGCAAGATGG - Intronic
950128288 3:10524637-10524659 GGGAAGTAATAAATAGAAGAGGG - Intronic
950586110 3:13893731-13893753 GAGACGTAAGAGAGGGAGGATGG - Intergenic
950844040 3:15997242-15997264 GAGAAGAAAAAGAGTGAAAAAGG - Intergenic
950973582 3:17215660-17215682 GAGAAGGGATAGAGAGAAAAAGG + Intronic
951021639 3:17787297-17787319 GAGGAGGAAGAGAGGGAAGTGGG - Intronic
951175640 3:19596083-19596105 GAGAAGAAAGAAAGGGAAGTGGG - Intergenic
951618347 3:24573173-24573195 GAGAAAAAATACATGGAAGAAGG + Intergenic
951760452 3:26141753-26141775 GAGAAGGAAGAAAGGGAAGCAGG + Intergenic
952030449 3:29135840-29135862 GAGGACTACTAGAGGGAGGAGGG + Intergenic
952361589 3:32635689-32635711 AAGATGTAAAAGAGGGCAGACGG - Intergenic
952548230 3:34446211-34446233 CAGAAGTAAGAGAGAGAAAAGGG - Intergenic
952656302 3:35790030-35790052 GGGAAGGAAAAGAGGGAAGTGGG - Intronic
952881586 3:37989287-37989309 GAGATGTGACAGACGGAAGATGG + Intronic
952961514 3:38594035-38594057 GAGAAGACATAGAAGAAAGAAGG - Intronic
953356080 3:42257320-42257342 GAGAAGTGCTAGAGTGATGAAGG + Intergenic
953637721 3:44676865-44676887 GAGGACTAATAGACGGAGGAGGG + Intergenic
953916399 3:46923515-46923537 GAGAAGGAATGGGGGGCAGAGGG + Intronic
955164969 3:56501977-56501999 GTGAAGACATAGAGAGAAGATGG - Intergenic
955889247 3:63632385-63632407 AAGAAGGAAGAAAGGGAAGAAGG + Intergenic
956547785 3:70425013-70425035 GAGAAGGAAGAGGAGGAAGAAGG + Intergenic
957508850 3:81160907-81160929 GAGGAGTAAAGGAAGGAAGATGG + Intergenic
957985267 3:87566628-87566650 GAGCTGTAATAGAAAGAAGAGGG + Intergenic
959090374 3:101896148-101896170 CAGAAGTAAGAGTGGGAAGGGGG - Intergenic
959397197 3:105855263-105855285 GGGAAGAAATGGAGAGAAGAAGG + Intronic
959471957 3:106763442-106763464 TAGAAGTCAGAGATGGAAGAAGG - Intergenic
959579098 3:107965900-107965922 GAGGGGTAAGAGAGTGAAGAGGG + Intergenic
959623238 3:108421683-108421705 GGGAAGGAAGAGAGGTAAGAAGG + Intronic
959643682 3:108672055-108672077 GTGAAGTTATAGTGGGAAGACGG - Intronic
959690848 3:109196544-109196566 GAGGAGTAAGAAAGGGAGGAAGG - Intergenic
960138731 3:114131476-114131498 GAGAATTCAAAGAAGGAAGACGG + Intronic
960381100 3:116962779-116962801 GAAAACTAAAAGAGGTAAGAAGG + Intronic
960858409 3:122126567-122126589 GAGAATTAGTAGTGGGAGGATGG + Intergenic
961083126 3:124043423-124043445 CAGAAGTAATAGATTGAGGAAGG + Intergenic
961636513 3:128336332-128336354 GAGAAGTAAGAAAGGAAACATGG - Intronic
961790420 3:129371961-129371983 GAGGACTACTAGAGGGAGGAGGG - Intergenic
961944437 3:130671319-130671341 GAGAAATATGAGTGGGAAGAGGG + Intronic
962668227 3:137678266-137678288 GAGAAGGAAGGGAGGGAGGAAGG + Intergenic
963008623 3:140749413-140749435 GAGAAAGAAAAGAGGAAAGATGG + Intergenic
963408388 3:144898515-144898537 GAGCAGTAAGAGATGGAAGGTGG + Intergenic
963772899 3:149407101-149407123 AAGAAGGAAGAAAGGGAAGAAGG + Intergenic
964108105 3:153060453-153060475 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
964287450 3:155134292-155134314 GAGGATTAATAGAGGGTGGAGGG - Intronic
964863765 3:161231112-161231134 GTGAAATAAGAGAGGGAACAAGG + Intronic
965315613 3:167186407-167186429 GGAAAGGAAGAGAGGGAAGAAGG + Intergenic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
965551868 3:169974481-169974503 GAAAGGGAATAAAGGGAAGATGG + Intronic
965640984 3:170828813-170828835 GAGAAGAAACAGAGGGAGGGAGG + Intronic
966577623 3:181520144-181520166 GGGACGTAATAGAGGGTAGTAGG - Intergenic
966929241 3:184665087-184665109 GGGAACTAATAAAGGGCAGAAGG + Intronic
967194294 3:187013276-187013298 GGGAAGTAATAGATGGGAGAAGG - Intronic
967278005 3:187795401-187795423 AAGAAGGAAGGGAGGGAAGATGG + Intergenic
968066786 3:195763339-195763361 GAGAAGGAAGAGAGCGAAGGAGG - Intronic
968355867 3:198106232-198106254 GAGAAAAAATAAAAGGAAGAGGG - Intergenic
969032128 4:4223951-4223973 GAGGAGAGAGAGAGGGAAGAGGG + Intronic
969141592 4:5078784-5078806 GAAGAGTAATAGAGGGTGGAGGG - Intronic
970065075 4:12084148-12084170 TAGAATTAAGATAGGGAAGAGGG - Intergenic
970163760 4:13214930-13214952 GAGAAGCAAAGTAGGGAAGAGGG - Intergenic
970164409 4:13221364-13221386 CAAATGTAAAAGAGGGAAGAGGG + Intergenic
970468163 4:16348778-16348800 GGGAAGTGATGGAAGGAAGAGGG - Intergenic
970730283 4:19095137-19095159 GAGAAGAAAGAGAAGGAAGAGGG + Intergenic
970755686 4:19422966-19422988 AAGAAGTAAGAAAGGGAGGACGG + Intergenic
971272468 4:25163480-25163502 GAGTAATAAAAGAGGGAAGCTGG - Intronic
971407392 4:26334847-26334869 GAGAAGTAGCAAAGAGAAGATGG - Intronic
971444865 4:26732372-26732394 GAAAAATAATGGAGGGAAGGAGG - Intronic
971570942 4:28210001-28210023 GAGGAGGAAGAGGGGGAAGAGGG - Intergenic
971740576 4:30515362-30515384 GAGAAATAACAGAGAGAATAAGG - Intergenic
973077564 4:45948347-45948369 GACAAGTTATAGAGAGTAGAGGG - Intergenic
973252867 4:48078940-48078962 AAGAAGGAAGAGAAGGAAGAAGG + Intronic
973628611 4:52797517-52797539 GAGGAGTGACAGAGGGATGAGGG + Intergenic
974352016 4:60760670-60760692 GAGAAGAAAAAGAAGAAAGATGG + Intergenic
974404054 4:61442560-61442582 GAGAGGTAATAAGAGGAAGAAGG + Intronic
974491885 4:62574293-62574315 AAGAAGAAATAGAGGAAAGAAGG + Intergenic
974976084 4:68893646-68893668 CAGACCTAATAGAGGGTAGAGGG - Intergenic
975090217 4:70393061-70393083 GGGAACTATTAGAGGGGAGAGGG + Intergenic
975097987 4:70479621-70479643 GAGATTGAATACAGGGAAGAGGG + Intronic
975951824 4:79783154-79783176 GAGAAGTAAATGAGGGGATAAGG - Intergenic
976206359 4:82626649-82626671 GGGAAGTAGCAGAGGGAACAAGG + Intergenic
976574009 4:86647800-86647822 GAGAAGACATAGAGAGAAGATGG + Intronic
976794154 4:88913415-88913437 AAGTAGTAGTAGAGGGAAGAGGG + Intronic
976805157 4:89037809-89037831 GAGGAGGAAGAGAGGAAAGAGGG - Intronic
977183846 4:93911614-93911636 CAGGAGGAATAGAGGAAAGAGGG - Intergenic
977361370 4:96010603-96010625 GAGAATGATTAGATGGAAGAAGG + Intergenic
977440179 4:97056063-97056085 GAGACCTAATTGAGGGTAGAGGG - Intergenic
978092680 4:104737185-104737207 CAGAGGTAATAGACGGTAGATGG + Intergenic
978379697 4:108113755-108113777 GAAAAGTAAGAGAGGCAAGGAGG + Intronic
978555338 4:109973578-109973600 GGGAAGTAAGAGGGGAAAGAGGG - Intronic
978627837 4:110707660-110707682 GAGTAGTAAGAGAGGGTAGAGGG - Intergenic
978687606 4:111465094-111465116 GAGAAGGAAGAGAGGAAGGAAGG + Intergenic
978963947 4:114719114-114719136 GTGAAGTTATAGTGAGAAGATGG - Intergenic
979200432 4:117971370-117971392 AAGGAGGAAGAGAGGGAAGAAGG + Intergenic
979453542 4:120900914-120900936 GACAAGAAATAGAGGAGAGAGGG - Intronic
981156119 4:141438353-141438375 TAGAAGACACAGAGGGAAGAAGG - Intergenic
981299764 4:143173873-143173895 GAAAAGTAATTCAGGGAAGGGGG - Intergenic
981624735 4:146742673-146742695 GAGGAGTAGAAGAGGAAAGAAGG - Intronic
982063391 4:151627061-151627083 TAGAAGGAAAAGATGGAAGAAGG + Intronic
982093006 4:151896691-151896713 CAGAAGTACAAGAGGGAATAGGG + Intergenic
982151595 4:152464322-152464344 GAAAAATAGTAGAGGAAAGAAGG + Intronic
982818430 4:159916409-159916431 GAGAATGAATAGTGGGAAGTGGG - Intergenic
982972050 4:162000879-162000901 AAGAAGGGATGGAGGGAAGAGGG + Intronic
983263389 4:165481750-165481772 TTGAAGTAATTGAGGGAAGTTGG + Intronic
983273659 4:165592084-165592106 GAGAAGGAATGGAGGGATGGAGG - Intergenic
983379837 4:166978700-166978722 GAGAAGGAGAAGAAGGAAGACGG + Intronic
983552572 4:169032490-169032512 AAGAAGGAACAGAGGGAAGAAGG - Intergenic
984125407 4:175803131-175803153 GAGGAGAAAGAGAAGGAAGAGGG - Intronic
984453052 4:179928281-179928303 GAGAACTAACAGATGGCAGATGG + Intergenic
984598820 4:181703532-181703554 GAAAAGTCATAAAGGGAAGAGGG - Intergenic
984825069 4:183916855-183916877 GATAGGAAGTAGAGGGAAGAGGG - Intronic
984842694 4:184082810-184082832 GTGAAGTAATTGAGGGAAAATGG + Intergenic
985196787 4:187438893-187438915 GGGGACTAATAAAGGGAAGAAGG + Intergenic
985993812 5:3585064-3585086 GAGGAGGAAAAGAGGGAGGAGGG + Intergenic
986067061 5:4245124-4245146 GAGAAGAAAGAGAAGGAAAACGG - Intergenic
986928545 5:12790347-12790369 GAGTAGAAATAGAGAGATGAGGG + Intergenic
986984181 5:13481348-13481370 GAGAAGGAAGAGAGAAAAGATGG + Intergenic
987463201 5:18239554-18239576 CAGAAATAATAGAGGGGATATGG - Intergenic
987516256 5:18914241-18914263 GAGGACTACTAGAGGGAAAAGGG - Intergenic
988344129 5:30014756-30014778 GAGAAAAAATAGGAGGAAGAGGG - Intergenic
988589685 5:32538063-32538085 GAGAAGCCACAGAGGGAAGAAGG - Intronic
988772884 5:34449752-34449774 GGGAAGTGAGAGAGGGAAGGGGG + Intergenic
989014354 5:36912277-36912299 GAGAAGGAATATAGGGAGGAGGG + Intronic
989136918 5:38165162-38165184 GAGAAGTCATAGTGGGAAAGTGG + Intergenic
989507853 5:42247988-42248010 CAGAAGGAAGAGAGAGAAGAGGG + Intergenic
989514253 5:42323300-42323322 TAAAAGTGAAAGAGGGAAGAGGG + Intergenic
991119663 5:62997101-62997123 GTGAAGTAACAGTGAGAAGATGG - Intergenic
991245261 5:64503592-64503614 GAGAAGGAAGAGAGAGAGGAAGG + Intergenic
991522994 5:67521496-67521518 AGGAAGAAAGAGAGGGAAGAAGG - Intergenic
991705507 5:69354261-69354283 GAGAAGTAATAGAGACTATATGG - Intronic
992020558 5:72619720-72619742 GAGAAGTGAAAGAAGGCAGAGGG + Intergenic
992112704 5:73511234-73511256 AAGAAGCAGAAGAGGGAAGAGGG - Intergenic
992259852 5:74958737-74958759 GAAAAGTAAGAGAGGGGAGAGGG + Intergenic
992376301 5:76191162-76191184 CAGAAGGAAGAGAGAGAAGAGGG + Intronic
992712366 5:79471989-79472011 TAAAAGAAATAAAGGGAAGAGGG - Intronic
992940662 5:81758133-81758155 TAGAAGGAAGAGAGGGAAGGAGG + Intergenic
993012655 5:82501073-82501095 GGGAAGGAAGGGAGGGAAGAAGG - Intergenic
993202334 5:84831513-84831535 GAGAAAAAATAAAAGGAAGAGGG + Intergenic
993503276 5:88684915-88684937 GAGAAGTAAAAGGGGGATGGAGG + Intergenic
994225507 5:97247829-97247851 GAGAGGAAATAAGGGGAAGAAGG + Intergenic
994742422 5:103637211-103637233 GAGAAGAGAGAGTGGGAAGAAGG - Intergenic
995018840 5:107344517-107344539 CAGAAATAATGGAGGTAAGAAGG - Intergenic
995609470 5:113893602-113893624 GACAAGTAAAGCAGGGAAGAAGG - Intergenic
995688662 5:114799238-114799260 AAGGAGGAATAGAGGGAAGGAGG + Intergenic
995735851 5:115298373-115298395 GAGAAGGAGAAGAGAGAAGAAGG + Intergenic
996516325 5:124373404-124373426 GAGTGGTAATAGAAAGAAGATGG - Intergenic
997067279 5:130576439-130576461 GAGAAATAAAAGAGGATAGAAGG - Intergenic
997098740 5:130944039-130944061 GAGAGGTACCAGAGGAAAGAGGG + Intergenic
997174446 5:131760076-131760098 GTGGACTACTAGAGGGAAGAGGG + Intronic
997597154 5:135114674-135114696 GAGAATTAATGCAGGGGAGAGGG + Intronic
997677797 5:135726464-135726486 AAGAAGGAATGGAGGCAAGAGGG - Intergenic
998391279 5:141788514-141788536 GAGAAGTAGGAGAGAGAAGGAGG - Intergenic
999047499 5:148485000-148485022 GAGAAGGAAGAAAGGGAAGGAGG + Intronic
1000262073 5:159597650-159597672 GAGAAGCAAAAGTGGGGAGAAGG - Intergenic
1000333345 5:160223409-160223431 AAGAAGTAAGAAAGGAAAGAAGG - Intronic
1000692425 5:164340010-164340032 GAGAAGAAAAAGCAGGAAGAGGG + Intergenic
1000827081 5:166058417-166058439 AAGAAGGAAGAGAGGGAAGGAGG + Intergenic
1000961583 5:167607199-167607221 GAGAAGTAATAGTGCCAATATGG + Intronic
1001121657 5:168985817-168985839 GAGAAGGAAAGGAGGGATGATGG + Intronic
1002899508 6:1399259-1399281 GAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1002995579 6:2280893-2280915 GAGAAGCAATAGACGGAAGAGGG + Intergenic
1003144275 6:3496487-3496509 GAGAAGGAATAGAGAGAGAAAGG - Intergenic
1003435926 6:6088021-6088043 GAGAAGAAAGAGAGGGAGAAGGG + Intergenic
1003456416 6:6286800-6286822 GAGAAGAAAGAGGGTGAAGAGGG + Intronic
1003491754 6:6628298-6628320 GAGAAGGGAGAGAAGGAAGAAGG - Intronic
1003550847 6:7100937-7100959 GAGAAGTCATGGAGTTAAGAAGG - Intergenic
1003703207 6:8493872-8493894 GAGAAGGAAATGAAGGAAGAAGG + Intergenic
1004111440 6:12722556-12722578 GAGAAGAAAAAGAAGGAAAAAGG + Intronic
1004130662 6:12916163-12916185 GGGAAGTCATAGAGGGAGGGTGG - Intronic
1004566434 6:16802369-16802391 GAGAAGGAAGACAGGAAAGATGG - Intergenic
1004604075 6:17177326-17177348 AAGAAGGAACAAAGGGAAGAAGG - Intergenic
1004668279 6:17769963-17769985 ATGAAGAAATAGAGGGAAAATGG + Intronic
1004751332 6:18565600-18565622 GGAAAGGGATAGAGGGAAGAAGG - Intergenic
1005275169 6:24209276-24209298 TAGTAGTAATAAAGGGAATATGG - Intronic
1005471561 6:26166410-26166432 AAGAAGGAATAAAGGGAAGGAGG - Intronic
1005850767 6:29819055-29819077 GAGAAGAAAGAGAGGGAGGGAGG - Intergenic
1006597326 6:35203049-35203071 GGGAAGCAACAGAGGGAGGAAGG + Intergenic
1006727268 6:36208721-36208743 GAGAAATGAGAGAGAGAAGAAGG + Intronic
1006814155 6:36839524-36839546 GGGAAGTGAGAGAGGGAAGAGGG + Exonic
1006970195 6:38035975-38035997 GAGAGGTAATGGATGGAAGCTGG - Intronic
1007377438 6:41466531-41466553 AGGAAGGAAGAGAGGGAAGAAGG + Intergenic
1007432399 6:41784254-41784276 GAAAGGCAAGAGAGGGAAGATGG - Intronic
1007692318 6:43710555-43710577 GAGAAGAAATGGAGGGAGGGAGG + Intergenic
1009700590 6:67173257-67173279 GAGAAGGAAAAGAAGAAAGAAGG + Intergenic
1010331635 6:74629971-74629993 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1010890837 6:81308540-81308562 GAGAAATAAAGGAGAGAAGAAGG + Intergenic
1011214900 6:84995234-84995256 AAGAAGAAAAAGAGGAAAGAAGG + Intergenic
1011283866 6:85704058-85704080 GAGCAGGAAGAGAGAGAAGAGGG - Intergenic
1011300862 6:85872239-85872261 GAAAAGAAAGAGAGAGAAGAAGG - Intergenic
1011847461 6:91584199-91584221 AAGAAGGAAGAGAGGGAGGAAGG + Intergenic
1011962636 6:93110171-93110193 GAGAAGGAATAAAAAGAAGATGG - Intergenic
1012011860 6:93798391-93798413 GGGGAGTAATAGAAGGAAGTGGG + Intergenic
1012383280 6:98646425-98646447 GAGAAGTGGGGGAGGGAAGAAGG + Intergenic
1012435813 6:99214314-99214336 GGGGACTACTAGAGGGAAGAGGG + Intergenic
1012530888 6:100234949-100234971 GAGAAGAAAGAGAGGGAAGGAGG + Intergenic
1012688423 6:102282716-102282738 GAGATGGAATAGATGAAAGAAGG + Intergenic
1012966309 6:105677651-105677673 GAGAAGCAGAAGATGGAAGAAGG - Intergenic
1014045702 6:116883347-116883369 GAGTGGTAGAAGAGGGAAGAGGG - Intronic
1014555697 6:122841098-122841120 GAGGAGGAATGGAGGGTAGAAGG - Intergenic
1014989484 6:128056167-128056189 GAGAAATTAAAGAGGAAAGAGGG - Intronic
1015349767 6:132203913-132203935 CAGAAGTTAGAGAGGGAGGAAGG - Intergenic
1015597669 6:134881177-134881199 GAGAACTAATATAGGAGAGAGGG - Intergenic
1015973549 6:138767042-138767064 GAGAAGAAAGAGAGGGAAGGAGG - Intronic
1016045665 6:139477927-139477949 GCAAGGTAAAAGAGGGAAGAAGG + Intergenic
1016402335 6:143694096-143694118 AAGAAGGAAGGGAGGGAAGAAGG + Intronic
1016532571 6:145075035-145075057 AAGAAGGAAGACAGGGAAGAAGG + Intergenic
1016546739 6:145232493-145232515 GAGAACTACTTGAGGGCAGAGGG - Intergenic
1016898052 6:149073503-149073525 AAGAAATAAAAGAGGGAAAATGG + Intronic
1016995309 6:149958361-149958383 GAGAAACAATGGAAGGAAGAAGG + Intergenic
1017003301 6:150011141-150011163 GAGAAACAATGGAAGGAAGAAGG - Intergenic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1019018982 6:168901784-168901806 GGGAAGAACAAGAGGGAAGACGG + Intergenic
1019508412 7:1404943-1404965 GAGAGGGAGGAGAGGGAAGAGGG + Intergenic
1019860216 7:3651825-3651847 GAGCAGTAATAGAGAACAGAGGG + Intronic
1020435358 7:8156674-8156696 CAGAAGTAAGAGAGGAAAGGAGG + Intronic
1020518696 7:9158477-9158499 GAGAAGGAATAAAGAGAAGTTGG + Intergenic
1020961695 7:14812710-14812732 AAGAATTAATAGAGTGAAGAGGG - Intronic
1021183945 7:17540994-17541016 GAAAAGAAAGGGAGGGAAGAAGG + Intergenic
1021273176 7:18617322-18617344 GAGAGGTCAGAGAGGGAATAAGG - Intronic
1021352287 7:19609928-19609950 AAGAAGGAACAGAGGGAGGAAGG - Intergenic
1021943044 7:25698526-25698548 AACCAGTAGTAGAGGGAAGAAGG + Intergenic
1022601881 7:31768620-31768642 GAGAAGCTATAGATGGAAGGCGG - Intronic
1022673877 7:32480365-32480387 GAGTAGTGATAGAGGGATGAGGG + Intergenic
1022990354 7:35701202-35701224 GAGAAGTAGTAAGGGAAAGAGGG + Intergenic
1023014213 7:35950782-35950804 GAGAAGCAAGAGAGAGAAGTGGG - Intergenic
1023483900 7:40664029-40664051 GAGAATGCATAGAGGGGAGATGG + Intronic
1023575497 7:41622064-41622086 GAGAAGGAATGGAGGGAGGGAGG + Intergenic
1023654153 7:42403113-42403135 GAGAAGCAAAAGAGGGAAAGAGG - Intergenic
1023693448 7:42818728-42818750 GAGAAGGAGAAGAAGGAAGAAGG + Intergenic
1023741714 7:43287172-43287194 GAGAAATAATACAGGGAATAGGG + Intronic
1023837694 7:44077978-44078000 GAGCAGAAACAGAGGGAAGGTGG + Intronic
1024066786 7:45744224-45744246 GAGAAGCAAGAGAGAGAAGCGGG + Intergenic
1025744887 7:64233938-64233960 GAGAAGAAAGAGAGTCAAGAAGG + Intronic
1025837899 7:65112896-65112918 GAGAAGGAAGGGAGGGAAGGAGG + Intergenic
1025872668 7:65449359-65449381 CAGAAGAAAGGGAGGGAAGAAGG - Intergenic
1025879370 7:65520187-65520209 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1025885169 7:65583088-65583110 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1027209335 7:76132281-76132303 AAGCTGTAAGAGAGGGAAGAAGG + Intergenic
1027545225 7:79519189-79519211 GGGAAGAAGGAGAGGGAAGAGGG + Intergenic
1027601214 7:80243752-80243774 GAGAAGGAATAGAGGAAAACAGG - Intergenic
1027738239 7:81963368-81963390 TAGAAGGGAGAGAGGGAAGAGGG + Intronic
1028018686 7:85744737-85744759 GAGAACTGAGCGAGGGAAGATGG + Intergenic
1028232489 7:88322267-88322289 GAGAGGCAATAGAGGAAGGAAGG + Intergenic
1028281550 7:88936032-88936054 AGGAAGAAAGAGAGGGAAGAGGG - Intronic
1028384488 7:90239273-90239295 GTGAAGTAAAAGGGAGAAGACGG + Intergenic
1028967630 7:96820363-96820385 GAGAAGGAAGAGAGGAAGGAAGG - Intergenic
1029300801 7:99580931-99580953 GGGAAGGAAGAGAGGGAAGGAGG - Intronic
1030031089 7:105370203-105370225 GAGATGTAGTAGAGATAAGATGG - Intronic
1030097901 7:105917335-105917357 GAGAACTATTAGAGGGAGGTAGG - Intronic
1030161960 7:106518395-106518417 GAGAAATAGGAGAGGCAAGAAGG - Intergenic
1030543771 7:110867030-110867052 GATAAGTTATTGAGTGAAGATGG - Intronic
1031116129 7:117670702-117670724 GAGAAGGAAAAGAGGATAGAGGG - Intronic
1031313319 7:120227160-120227182 GGGAAGACACAGAGGGAAGATGG - Intergenic
1031345779 7:120664456-120664478 GAGAAGAAATGAAGGGAGGAAGG + Intronic
1031360803 7:120846094-120846116 GAGGAGTAAGAGAGAGAAGGGGG + Intronic
1031363131 7:120871121-120871143 GAGAAAGAAAAGAAGGAAGAGGG + Intergenic
1031418766 7:121524347-121524369 GAGAAGGAAAAGGGGAAAGAGGG - Intergenic
1032012027 7:128352891-128352913 GAGAAGTAGGAGAAGGAAGAGGG - Intronic
1032152369 7:129440395-129440417 GAGAAGGAATATGGAGAAGATGG - Intronic
1032340553 7:131068780-131068802 GAGAAAAACTAGAGGGCAGAAGG - Intergenic
1032736294 7:134695617-134695639 GAAAAGAAAGAGAAGGAAGAAGG - Intergenic
1032904180 7:136345433-136345455 AAGAAGTGGTCGAGGGAAGAAGG - Intergenic
1033041994 7:137927376-137927398 GAGAAGGAAGGGAGGGAAGGAGG + Intronic
1033084563 7:138330255-138330277 AAGGAGGAATAGAGGGTAGAAGG - Intergenic
1033905714 7:146199718-146199740 GAGAAATTAGAGAGGGTAGAAGG + Intronic
1033926244 7:146464573-146464595 GAAGAGAAAAAGAGGGAAGAAGG - Intronic
1033950201 7:146775541-146775563 AGGAAGTAAGAAAGGGAAGAAGG + Intronic
1034068198 7:148156837-148156859 GAGAAGAAAGAAAGGGAAGAAGG - Intronic
1034551708 7:151824848-151824870 CAGAAGAAAGAGAGGGAAGGGGG - Intronic
1035067116 7:156114334-156114356 AAGAAAGAATAGAAGGAAGAAGG + Intergenic
1036098417 8:5750695-5750717 GGGAAGTAATTGAGGCAGGAGGG + Intergenic
1036628806 8:10496123-10496145 GAGAAGAAAGAGAAGGAAAAAGG + Intergenic
1037035489 8:14161930-14161952 GAGAAGCAATAGGAGGAAGAAGG + Intronic
1037305544 8:17499394-17499416 GAGAGAGAATGGAGGGAAGAGGG - Intronic
1037457342 8:19076774-19076796 GAGAAGGAAGGGAGGGAGGAAGG - Intronic
1037900957 8:22689497-22689519 GAGAAGGTTTAGAGGGGAGAAGG + Exonic
1038228417 8:25678263-25678285 GAGAAAGAAAAGAGGGGAGAGGG - Intergenic
1038307620 8:26419062-26419084 GAGAAGGAAAAAAGGGAGGAAGG + Intronic
1039438811 8:37580434-37580456 GAAAAGTAATGCAGGGCAGATGG + Intergenic
1039903878 8:41772430-41772452 GAGAAGAAATGGAGGGGAGGAGG - Intronic
1040500014 8:47997639-47997661 GAGAAATCAGAGAGGGAAAAGGG + Intergenic
1040509289 8:48079652-48079674 AAGAAGTAAGAAAGGGAAGGAGG + Intergenic
1040736959 8:50519846-50519868 GAGAATCAATAGAGTGAAAATGG + Intronic
1040974154 8:53171264-53171286 GAGAAATAATATAGGGCATATGG + Intergenic
1041048832 8:53913616-53913638 AGGCAGTCATAGAGGGAAGAAGG + Intronic
1041231359 8:55756539-55756561 AAGAGGAAAGAGAGGGAAGAAGG - Intronic
1041392409 8:57358778-57358800 GAGAAGAAAGAGAGGGAAGGGGG - Intergenic
1041605487 8:59778309-59778331 GAGAAGGAGGAGAGGGAAAATGG - Intergenic
1041754960 8:61303903-61303925 AAAAAGTAATAGAGGACAGATGG + Intronic
1041870151 8:62624799-62624821 GAGAAGCAAGAGAGAAAAGATGG - Intronic
1042721627 8:71832870-71832892 GAGAAATCATAGTTGGAAGAGGG + Intronic
1043045062 8:75312781-75312803 GAGAAGGAATGGAAGGAAGGAGG + Intergenic
1043148683 8:76685129-76685151 GAAAAGTCATAAAGGCAAGAAGG + Intronic
1043206832 8:77454848-77454870 GAGAAATAAGAGAGGGACCATGG + Intergenic
1043270569 8:78328743-78328765 GAGAGTTAAGAGAGGGAACATGG - Intergenic
1043322664 8:79009389-79009411 GAGAAGGGAGGGAGGGAAGAGGG - Intergenic
1043418798 8:80078328-80078350 GACAAGTAATACAGACAAGAAGG - Intronic
1043930569 8:86086114-86086136 GAGCAGAAAGAGAGGGAGGAGGG + Intronic
1044206909 8:89501402-89501424 GAAAAGAAATAGAAGGAAAAAGG + Intergenic
1044281827 8:90365507-90365529 GAGAAGAAAAAGAGAGAGGAAGG - Intergenic
1044320775 8:90798451-90798473 GGGGACTAATAGAGGGAAGAGGG - Intronic
1045035010 8:98170068-98170090 GAGACTTTATAGAGGGAAGGAGG + Intergenic
1045170599 8:99663453-99663475 GTGAGGTAATAGACTGAAGAAGG + Intronic
1046037765 8:108864601-108864623 GAAAATTAACAGAGGGATGAAGG + Intergenic
1046112987 8:109749296-109749318 GGGATGTAAAAGAGGTAAGAGGG + Intergenic
1046130987 8:109968634-109968656 GGGAAGGAAGAGAGAGAAGAGGG - Intronic
1046319190 8:112548225-112548247 GAGAAGAAATGGAGGAAAGCCGG - Intronic
1046470589 8:114668524-114668546 GAGAGGTCAAAGATGGAAGATGG + Intergenic
1046806200 8:118481446-118481468 AAGAAGGAAAAGAGGGAGGAAGG + Intronic
1047060624 8:121220580-121220602 GAAAAGTAATAGGGTGAGGAGGG + Intergenic
1047083753 8:121493754-121493776 GGAAAGTAATACAGAGAAGATGG + Intergenic
1047620114 8:126597620-126597642 GAGAAGTCAAAGAAGAAAGATGG - Intergenic
1048007693 8:130432178-130432200 GAGAAGGGAGAGAGGGAGGAAGG + Intronic
1048053956 8:130846487-130846509 AAGAAGGAAGAGAGGGAGGAAGG - Intronic
1048250351 8:132861513-132861535 GAAAAATAATGGAGGGCAGAAGG - Intergenic
1048392422 8:133980301-133980323 GAGGAGAAATAGAGTGTAGATGG - Intergenic
1048557750 8:135497096-135497118 AAGGAGTAAGAGAGGGAAGTTGG + Intronic
1048680602 8:136837366-136837388 AAGAAAGAAAAGAGGGAAGAGGG - Intergenic
1049952576 9:659691-659713 CAGGAGAAAAAGAGGGAAGAAGG + Intronic
1050055337 9:1647215-1647237 GAGAAGTATAAGAGCAAAGAGGG + Intergenic
1050436453 9:5615500-5615522 TAAAAGTAAGAGAGGGAAGAAGG - Intergenic
1050664953 9:7925459-7925481 AAGAAGGAAGAGAGGGAAGGAGG + Intergenic
1051044002 9:12851664-12851686 AAGAAGGAAAAGAGGGAAGTGGG + Intergenic
1052252134 9:26410913-26410935 GAGAATAAATTGTGGGAAGATGG - Intergenic
1053288976 9:36867695-36867717 GAGAGATAAAAGAGGGAGGAAGG - Intronic
1053461134 9:38272360-38272382 TTGAAGGAATAGAGGGAACAAGG + Intergenic
1055354740 9:75426342-75426364 GAGAAGGGAGGGAGGGAAGAAGG - Intergenic
1055429479 9:76229026-76229048 GAGAAGGAAAAGAGGAAAGAAGG + Intronic
1055722240 9:79188292-79188314 AAGGAGAAAGAGAGGGAAGAGGG - Intergenic
1055896690 9:81185363-81185385 GAAAAGTAATAAATGGAAAATGG + Intergenic
1055904319 9:81275229-81275251 GAGAAGGAAGAGAGCGAAAAGGG + Intergenic
1056032454 9:82567246-82567268 AGGAAGAAAGAGAGGGAAGAAGG + Intergenic
1056165540 9:83937382-83937404 GAGAAGAAAAAGAGGGGGGAGGG + Intergenic
1056917128 9:90755786-90755808 GACAAGTGATGGAGGGAGGATGG - Intergenic
1057196052 9:93116014-93116036 GGGAAGGAATTGAGGGAGGAGGG + Intergenic
1057541029 9:95970284-95970306 TAAAAGTACTAGTGGGAAGAGGG - Intronic
1057955676 9:99405835-99405857 GAGAAGTAAGAAAGGCCAGAGGG - Intergenic
1058556995 9:106179777-106179799 GAGAAGAAATAAAAGGAAAAGGG - Intergenic
1058979555 9:110156508-110156530 GAGAAGTGAAAGAGGAAAGGAGG - Intronic
1059055051 9:110970663-110970685 GAGAAGGAGGAGAGGGAAAAAGG - Intronic
1059172048 9:112134593-112134615 GAGGACAAATAGAGGGAGGAGGG + Intronic
1059303397 9:113333957-113333979 GAGAAGGAGGAGAAGGAAGAAGG - Intronic
1059370018 9:113822641-113822663 TAGAAGAAAAAGATGGAAGAAGG + Intergenic
1059388297 9:113982416-113982438 GAGAAGTTACAGAGGAGAGAAGG - Intronic
1059635275 9:116164277-116164299 GAGTAGGAAGAGAGAGAAGAAGG - Intronic
1059669312 9:116477977-116477999 GAGAAGAAACAGAGGGCAGAGGG + Intronic
1059869886 9:118561233-118561255 GAGAAGTAGTAGAGAGAATGTGG - Intergenic
1060052078 9:120384755-120384777 GACAAGTAATATAGTGAATAGGG - Intergenic
1060446138 9:123690027-123690049 GGGAAGAAAAGGAGGGAAGAAGG + Intronic
1061278808 9:129585346-129585368 GAGAAGAAAGAGTGAGAAGAGGG + Intergenic
1061772803 9:132939756-132939778 TAGAAGTATTCTAGGGAAGAAGG + Intronic
1062201695 9:135306193-135306215 GGGAAGGGAGAGAGGGAAGAAGG - Intergenic
1062712048 9:137980666-137980688 GGGGAGTACTAGAGGGAGGAGGG - Intronic
1203461065 Un_GL000220v1:38386-38408 GAGAAGTAGTAGAAGGTTGAGGG - Intergenic
1185602298 X:1348746-1348768 GAAAAGAAAGAGAGGAAAGAAGG - Intronic
1185683027 X:1904229-1904251 GAGAAGAGAAAGAGGGAAAAAGG + Intergenic
1185834144 X:3329334-3329356 GAGAAGGAAGAAAGGAAAGAAGG + Intronic
1185872473 X:3675448-3675470 GAGAAGGAAGAGATGGAGGAGGG - Intronic
1185880649 X:3736948-3736970 GAGAAGAAAATGAGAGAAGATGG + Intergenic
1186047091 X:5548477-5548499 GAGAAGTAAAAGAGGAGGGAGGG - Intergenic
1186410534 X:9342098-9342120 GGGAAGTGAAAGAGGGAGGAGGG - Intergenic
1186490751 X:9970337-9970359 AAGAAGAGAAAGAGGGAAGAAGG - Intergenic
1186684119 X:11906548-11906570 CAGAAGTAATGGAGGCTAGATGG - Intergenic
1186858236 X:13646311-13646333 GAGAAGAAATGGAGCAAAGAGGG - Intergenic
1187264431 X:17718445-17718467 GAGAAGGAAGAAAGGAAAGAAGG + Intronic
1187270792 X:17777364-17777386 GAGAAATAAAAGAGTAAAGATGG - Intergenic
1188029914 X:25252801-25252823 GAGGAGACATACAGGGAAGAAGG + Intergenic
1188154649 X:26725881-26725903 AGAAAGTGATAGAGGGAAGATGG - Intergenic
1188634908 X:32417537-32417559 GAGAAATGATACAGTGAAGAAGG + Intronic
1188705634 X:33326115-33326137 TAGTAATATTAGAGGGAAGAAGG + Intronic
1189224159 X:39398598-39398620 GAAAAGGAAAAGAGGGAGGAAGG - Intergenic
1189424624 X:40886986-40887008 GAGGACTACTAGAGGGAGGAGGG - Intergenic
1189610555 X:42729520-42729542 GGGAAGAAAAAGAGGGAAAAAGG + Intergenic
1190110739 X:47587480-47587502 GAGAAGTAGGGGAGGGAGGATGG - Intronic
1190579737 X:51880841-51880863 GAGAAGTATTTGAAGTAAGAGGG - Intronic
1191128759 X:56985740-56985762 GAGAAGTCAGAGAGGAAATAAGG - Intronic
1192158873 X:68768133-68768155 GAGAAGAAAGAAAGGAAAGAAGG - Intergenic
1192188574 X:68976036-68976058 CAGAAGTAATAGAAGCCAGAAGG - Intergenic
1192272063 X:69590309-69590331 GAGAAGACAAAGAGGAAAGATGG + Intergenic
1192337516 X:70234554-70234576 GGGAAGGACAAGAGGGAAGAGGG + Intergenic
1192725099 X:73741673-73741695 CTGAAGTCATAGTGGGAAGAAGG - Intergenic
1193503959 X:82316889-82316911 GAGAGGTAATAGAGAGAGAAAGG + Intergenic
1193847490 X:86492605-86492627 GGGGACTACTAGAGGGAAGAGGG - Intronic
1193971751 X:88063778-88063800 GAAAATTACTAGAGGGAAGTGGG + Intergenic
1194070978 X:89325873-89325895 GAGAACAAAGAGAGAGAAGAAGG - Intergenic
1194834310 X:98662003-98662025 GGGAAGAAAAAGACGGAAGAGGG + Intergenic
1195496446 X:105540514-105540536 GGGGACTACTAGAGGGAAGAGGG + Intronic
1195671344 X:107472749-107472771 CAGAAGTGATAAAGGGAAAAAGG - Intergenic
1195946792 X:110222800-110222822 GAAAAGTAAGAGAGAGGAGAGGG + Intronic
1196097781 X:111818064-111818086 GGGAAATGATAGAGGGCAGAAGG - Intronic
1197268629 X:124402353-124402375 TAGAAGTGATATAGAGAAGAGGG + Intronic
1197282009 X:124548279-124548301 GAGAAATGATATAGGGAACAGGG + Intronic
1197654102 X:129097647-129097669 GTAAAATAATACAGGGAAGATGG + Intergenic
1197958931 X:131982808-131982830 GATAAGGGATAGTGGGAAGAAGG - Intergenic
1198134076 X:133729282-133729304 GAGGAATAATGGAGGGAATAGGG - Intronic
1198451336 X:136769014-136769036 GAGGAGGAAGAGAGGGAAGGAGG + Intronic
1198649593 X:138847142-138847164 GAGAAGCCATGGAGGGGAGAAGG + Intronic
1198692731 X:139302012-139302034 AAGAAGTCATAGAGGCTAGATGG + Intergenic
1199316543 X:146385336-146385358 AAGTAGGAATAGAGAGAAGATGG + Intergenic
1199392360 X:147295855-147295877 GAGAAGAAACAGAGGGCACAGGG - Intergenic
1199614538 X:149646515-149646537 GAAAAGTAAGAGAGGGGTGAGGG - Intergenic
1199749164 X:150798274-150798296 GAGAACAAAGGGAGGGAAGAAGG + Intronic
1199773098 X:150987023-150987045 GAGAAGTCATAGTGGTAGGAGGG + Intronic
1200695775 Y:6357891-6357913 GAGAAGGGAGGGAGGGAAGAAGG - Intergenic
1200725208 Y:6661614-6661636 GAGAACAAAGAGAGAGAAGAAGG - Intergenic
1200784510 Y:7248409-7248431 GAGAAGAAAATGAGAGAAGATGG - Intergenic
1201016505 Y:9608226-9608248 AAGAATTAAAAGAGTGAAGATGG + Intergenic
1201039502 Y:9816819-9816841 GAGAAGGGAGGGAGGGAAGAAGG + Intergenic
1201349663 Y:13025825-13025847 AAGAAGGAAAAGAGGGAAGGAGG - Intergenic
1201887717 Y:18904040-18904062 GAGAAGAAATAGAGAGAGGAAGG + Intergenic
1202198611 Y:22323727-22323749 AAGAATTAATAGAGTGAAGGAGG - Intronic