ID: 1167903843

View in Genome Browser
Species Human (GRCh38)
Location 19:52642121-52642143
Sequence GACTCAGGTGTACAGAGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 2, 2: 1, 3: 30, 4: 236}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167903843 Original CRISPR GACTCAGGTGTACAGAGGGA CGG Intronic
900707543 1:4089936-4089958 GAGTCCTCTGTACAGAGGGAGGG - Intergenic
901302367 1:8209095-8209117 GACTCAGGTGCCCAGGGGCAGGG + Intergenic
904084349 1:27894152-27894174 GACTCAGGTTTGCAAAGGGGAGG - Intronic
904442566 1:30541217-30541239 GACTCAGGTCTCCAGAGAGGGGG - Intergenic
905296524 1:36957868-36957890 GACTCAGGGGCACAGAGTCACGG - Intronic
909889185 1:80981530-80981552 GAATCTGGTGTACACAGGGAGGG + Intergenic
911046245 1:93631200-93631222 GACACAGGTGTAGAGGGAGAAGG - Intronic
913075563 1:115338288-115338310 GACTCAGGAGTACGGGAGGAGGG - Intergenic
916380116 1:164200422-164200444 GAATCATGTGGACACAGGGAGGG + Intergenic
918720105 1:187841723-187841745 GTCTCAGGTGACCAGAAGGATGG + Intergenic
919136031 1:193508922-193508944 GACACATGTACACAGAGGGAGGG - Intergenic
920090552 1:203450000-203450022 AACTCAGGTGTACAGGATGAAGG - Intergenic
921620818 1:217324414-217324436 GACTCAGGTTTCCAGATGGCTGG - Intergenic
921790404 1:219283469-219283491 GACCCAGGTGTGGAAAGGGATGG + Intergenic
922237303 1:223731720-223731742 GACAGAGGTGTGCAGAGGCACGG + Intronic
924634477 1:245772814-245772836 GACTCAGGAGCACAGAGGGTAGG + Intronic
924901607 1:248407311-248407333 GAAGCAGGTGAAAAGAGGGAAGG - Intergenic
1063204502 10:3818204-3818226 AACTCAAGTCTATAGAGGGATGG - Intergenic
1065704946 10:28464156-28464178 GGCTCAGGAGAACAGAGGAATGG + Intergenic
1067709572 10:48637328-48637350 GACACAGGTATACAGATGGATGG + Intronic
1068276283 10:54802307-54802329 GGCTCAGTTTTCCAGAGGGAGGG + Intronic
1071461722 10:85903116-85903138 GAGTCTGGAGTTCAGAGGGAGGG - Intronic
1072693309 10:97585408-97585430 GACCCATGTGTAAAGAGAGATGG - Intronic
1074483773 10:113853956-113853978 GAGTCAGGTGGACAGAGGGCTGG - Exonic
1075464966 10:122644398-122644420 GACTCAGGTGGACATAAAGACGG - Intergenic
1076122241 10:127945411-127945433 GACACAGGTGTCCACAGGCAAGG - Intronic
1076411009 10:130250811-130250833 GACTCAGGTGGACACAGGGCAGG - Intergenic
1077231401 11:1459575-1459597 GCCTCCAGTGGACAGAGGGATGG - Intronic
1077738246 11:4815246-4815268 GTCTCAGGTGAGCAAAGGGATGG + Intronic
1083949315 11:65945380-65945402 GACTCCCCTGTACAGATGGATGG + Intergenic
1085324050 11:75593156-75593178 GACTGAAGTGTCCAGAGGGCAGG + Intronic
1086308527 11:85509183-85509205 GACTCAGGTGTAGATAGGCATGG - Intronic
1087049551 11:93871658-93871680 GACACAGGTGTGAAGTGGGATGG - Intergenic
1087551779 11:99659664-99659686 GACTGAGGTTTCCAGAGGAAGGG - Intronic
1088035698 11:105311488-105311510 GTCTCAGGTGTAATGAGGAAAGG - Intergenic
1093281940 12:17204981-17205003 GAGTCAGGTGTAGAGTGGCAAGG - Intergenic
1094798214 12:34000754-34000776 AACTCAGGAGTACAGAGCCAAGG + Intergenic
1095254355 12:40017060-40017082 GACTAAGTAGGACAGAGGGAAGG + Intronic
1096080841 12:48831365-48831387 GACACAGGAGTTCAGAGGAATGG + Intronic
1096161845 12:49385418-49385440 GATTCAGATGTAGTGAGGGAAGG + Intronic
1097494665 12:60315658-60315680 GTCTCAGGTGAGCAGAGGGATGG + Intergenic
1098867676 12:75781339-75781361 GACTCAGATGAAAAGATGGAGGG + Intergenic
1100538192 12:95531768-95531790 GAGGCAGGTGTGCAGGGGGAAGG + Intronic
1103282109 12:119767202-119767224 CAGTCAGGTGTGCAGAGGGCAGG + Intronic
1104117608 12:125764664-125764686 TCCTCAGGTGTGCAGAAGGATGG - Intergenic
1104745623 12:131208509-131208531 GACATATGTGGACAGAGGGAAGG - Intergenic
1104788723 12:131468600-131468622 GACGTATGTGGACAGAGGGAAGG + Intergenic
1104807661 12:131599790-131599812 GAGTCAGCCCTACAGAGGGAAGG - Intergenic
1104814285 12:131637093-131637115 GACTCAGCTGAACACAGTGAGGG + Intergenic
1104823214 12:131690575-131690597 GCCTGGGGTGTACAGAGGTAAGG - Intergenic
1104858095 12:131911233-131911255 CAGTCAGATGGACAGAGGGACGG - Intronic
1105287422 13:19016749-19016771 GTCTCAGGTGAGCAGAGAGATGG - Intergenic
1107632769 13:42359134-42359156 GAGGCAGGTGTATAAAGGGACGG - Intergenic
1108621295 13:52186699-52186721 GAGTCAGGGGCACAGAGAGATGG - Intergenic
1108665642 13:52627540-52627562 GAGTCAGGGGCACAGAGAGATGG + Intergenic
1109406239 13:61903568-61903590 GACTCTGGTGTCCAGAGGAGGGG - Intergenic
1109798544 13:67345972-67345994 GTATCAGGGGTAAAGAGGGAGGG - Intergenic
1110536307 13:76654509-76654531 GACTTAGGTCTACAGAAGGTGGG + Intergenic
1110657349 13:78015914-78015936 GACTCAGGGGAAAAGTGGGAGGG - Intergenic
1111667761 13:91291308-91291330 GGTACAAGTGTACAGAGGGATGG - Intergenic
1112382995 13:98910867-98910889 GACTGAAGTATGCAGAGGGAGGG - Intronic
1113750011 13:112770513-112770535 GACCAAGGAGGACAGAGGGATGG + Intronic
1115272102 14:31564302-31564324 GACTACTGTGCACAGAGGGAAGG - Intronic
1117036839 14:51739039-51739061 GAGGCTGGTGTTCAGAGGGAGGG + Intergenic
1118974138 14:70663039-70663061 GACTCAGGTGACCAGAGTGGAGG - Intronic
1119701815 14:76761080-76761102 AACTGAGGCCTACAGAGGGAAGG + Intergenic
1119736298 14:76984906-76984928 GTCTCTGGTGTGCAGAGGGGAGG - Intergenic
1119776616 14:77253130-77253152 GACCCAGGGGGACAGAGAGAAGG - Intronic
1121426542 14:93856334-93856356 CACTCAGCTTTACAGAGGCAGGG + Intergenic
1121696864 14:95920705-95920727 GGCTCATGTGCACAGGGGGAGGG + Intergenic
1122680468 14:103457444-103457466 GGCTCAGTTGTAAAAAGGGAAGG - Intronic
1122927340 14:104911331-104911353 GACAGACATGTACAGAGGGAAGG + Intergenic
1126917950 15:53486859-53486881 GAGTCAGGTATACAGTGGGATGG - Intergenic
1127790352 15:62392755-62392777 GGGTTAGGTGTGCAGAGGGAGGG + Intronic
1129288063 15:74541411-74541433 GAGGCAGGTGTAGAGAGAGAGGG + Intronic
1129392267 15:75226351-75226373 GAGGCAGATGGACAGAGGGAGGG + Intergenic
1129472127 15:75761814-75761836 GAGGCAGATGGACAGAGGGAGGG - Intergenic
1130347506 15:83062016-83062038 GACTGAGGAGTACAAAGGTAAGG + Intronic
1130732754 15:86516184-86516206 GTCTCAGGTGAACGGAGGGTTGG + Intronic
1131709176 15:95034197-95034219 GAGTCATGTGTTCAGAGGAAAGG - Intergenic
1133581604 16:7149726-7149748 GAGGCGGGTGTAGAGAGGGAAGG - Intronic
1135056676 16:19237841-19237863 GACACGGGAGAACAGAGGGAGGG - Intronic
1136290553 16:29268919-29268941 GACATAGATGCACAGAGGGATGG - Intergenic
1137781458 16:51101090-51101112 GACTCAGTTGCAGAGAGAGAAGG + Intergenic
1139309317 16:66014904-66014926 GACACAGGAGCAGAGAGGGATGG + Intergenic
1139432771 16:66919928-66919950 TAATCAGATGTACAGTGGGAAGG - Intergenic
1139473988 16:67193335-67193357 GACTCAGGTCCACCGGGGGAGGG - Intronic
1141093558 16:81147140-81147162 GCCTGAGGTATACAGAGGGAGGG + Intergenic
1141354782 16:83334947-83334969 GACTCAGGTGTAAAAAGTAAGGG + Intronic
1141812149 16:86382879-86382901 GGCTCAGGAGGACACAGGGAGGG - Intergenic
1142096432 16:88242439-88242461 GACATAGATGCACAGAGGGATGG - Intergenic
1142115105 16:88352423-88352445 GCTGCAGGTGCACAGAGGGAGGG + Intergenic
1143647429 17:8240032-8240054 GGCTCAGGTACACAGAGGCATGG + Intronic
1144753892 17:17668105-17668127 GGCCCAGGTGTAAGGAGGGAGGG - Intergenic
1144771866 17:17763963-17763985 GAGACAGGTGTACAGATGCATGG + Intronic
1144960759 17:19042712-19042734 GAATCAGGGGGACAGACGGAAGG - Intronic
1144974401 17:19131812-19131834 GAATCAGGGGGACAGACGGAAGG + Intronic
1145978618 17:28998417-28998439 GACCCAGGGGTAGGGAGGGATGG + Intronic
1146632337 17:34479748-34479770 AACCCAGGTGGACAGAGGGGAGG + Intergenic
1146787518 17:35732272-35732294 GACCCAGGTGTCCAGACGCAGGG + Intronic
1147523586 17:41198741-41198763 GACTCAGGGGAAAAGATGGAAGG + Intronic
1148716001 17:49716381-49716403 GACTGAGGTGTAAAGTGGCAAGG + Intronic
1149752821 17:59162542-59162564 GAGTCAGGATTACAGAGGGGTGG - Intronic
1151517199 17:74604271-74604293 TGCTCAGGTGTAGACAGGGAGGG - Intergenic
1151536219 17:74740383-74740405 GACACAAGTACACAGAGGGACGG + Intronic
1157107498 18:44788274-44788296 GAGGCAGGGGTAGAGAGGGAAGG + Intronic
1158254220 18:55527296-55527318 AAATCAGGTGAGCAGAGGGAGGG + Intronic
1158270597 18:55710796-55710818 GAATCAGGTGTGAAGTGGGAAGG - Intergenic
1159773291 18:72574549-72574571 GAATCCAGTGTACAGATGGAGGG + Intronic
1160690522 19:459014-459036 GACTCAGATGCACAGAGGAGCGG - Intronic
1160877623 19:1304598-1304620 GACACAGGGGTACACAGGCATGG - Intergenic
1161981826 19:7633938-7633960 GAGGCAGGTGCAGAGAGGGAGGG - Intronic
1162028060 19:7905336-7905358 GACTCAGGTCAGGAGAGGGAGGG - Intronic
1162771045 19:12949452-12949474 GACTCTGGTGCCCACAGGGAAGG - Intronic
1163221114 19:15921966-15921988 TCCTCAGGTGGGCAGAGGGAGGG - Intronic
1165047571 19:33117782-33117804 GAGTCAGGGATACAGAGGCAAGG - Intronic
1165257564 19:34588947-34588969 AGCTGGGGTGTACAGAGGGAGGG + Intergenic
1165450137 19:35877725-35877747 GACCCAGGTGTTCAGAGTGGAGG - Exonic
1165774257 19:38395604-38395626 GACGCAGGTGGACAGGGCGAGGG - Exonic
1165794194 19:38509192-38509214 AACTGAGGTCTAGAGAGGGAAGG - Intronic
1166644967 19:44524933-44524955 GGGTCAGGGGTAAAGAGGGAGGG - Intronic
1166973459 19:46587954-46587976 GTCTCAGGTGAGAAGAGGGATGG - Intronic
1167893931 19:52565567-52565589 GACTCAGGTGTGCAGAGGGATGG - Intronic
1167903843 19:52642121-52642143 GACTCAGGTGTACAGAGGGACGG + Intronic
1167932487 19:52877501-52877523 GACTCAGGTGTGCAGAGGGATGG + Exonic
1167993953 19:53387405-53387427 ATCTCAGGTGTGCAGAGGGATGG - Intronic
925908145 2:8551852-8551874 GAAGCAGGTGTTCAGAGGGAAGG - Intergenic
925930871 2:8706799-8706821 GACTGATGGGTGCAGAGGGATGG - Intergenic
925968833 2:9092774-9092796 GACTCAGCTCTACAAAGGCAGGG - Intergenic
926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG + Intergenic
926300124 2:11596428-11596450 GACGCAGGTGTGCACAGTGAGGG + Intronic
926300212 2:11596755-11596777 GGCGCAGGTGTACACAGTGAGGG + Intronic
927060592 2:19415920-19415942 GTCACAGGTGTGCAGAGAGATGG - Intergenic
927953083 2:27187246-27187268 GAGACAGGTGTTGAGAGGGATGG - Intergenic
928389612 2:30899052-30899074 CACTGAGGTGTGCAGATGGAGGG - Intergenic
929759954 2:44798499-44798521 GACTGAGGAAGACAGAGGGAAGG - Intergenic
930726716 2:54688739-54688761 GACTCAGGAGTAGGGAGAGAAGG - Intergenic
931632704 2:64315753-64315775 CACTCAGGAGTGCAGAGGAATGG - Intergenic
934869997 2:97854920-97854942 GACTTAGGTGTGCACAGGGAAGG - Intronic
936653877 2:114461876-114461898 GAGACAGGTGGAGAGAGGGAGGG + Intronic
937631588 2:124108080-124108102 GTCTCAGGTGAGCAGAGCGATGG + Intronic
938086580 2:128405929-128405951 CACACTGGTGTTCAGAGGGAGGG + Intergenic
939639241 2:144619211-144619233 CCTTCAGGTGTGCAGAGGGAAGG - Intergenic
940241292 2:151565864-151565886 GACACAGGCTTACAGAGGGCAGG + Intronic
943371571 2:187023045-187023067 TAGTGAGGAGTACAGAGGGAGGG - Intergenic
944300328 2:198116915-198116937 GAGTCAGTTATACTGAGGGATGG + Intronic
946102315 2:217336425-217336447 GACAGATGTGTACAGATGGACGG - Intronic
947267520 2:228299957-228299979 GTCTCCCCTGTACAGAGGGAGGG + Intergenic
947964945 2:234272220-234272242 GTCTCAGCTGGGCAGAGGGATGG + Intergenic
1169400953 20:5279720-5279742 GACCCAGGTATACAAGGGGAAGG - Intergenic
1173765169 20:45600700-45600722 GATTCAGGGGTAGAGAGAGAGGG - Intergenic
1173898172 20:46566503-46566525 GACTGAGGTGCAGAGAGGGGAGG + Intronic
1174787020 20:53442452-53442474 GGCTTAGGTAGACAGAGGGAAGG + Intronic
1175595039 20:60224217-60224239 GACACAGCTGTTCAAAGGGATGG - Intergenic
1181659661 22:24334896-24334918 GACTGAGGTGTTCAGAGGAAGGG - Intronic
1182029740 22:27148607-27148629 GATGCATGTGTACAGAGGAAAGG + Intergenic
1182812715 22:33131271-33131293 GACTCAGGGACAGAGAGGGATGG - Intergenic
1183293464 22:37016879-37016901 GACTGAGGTGCACAGAGGCAGGG - Intronic
1183310445 22:37106818-37106840 GACTCAGCTGCACAAAGGCAGGG - Intronic
1183993309 22:41613748-41613770 GACTCAGGAGTACAGCTGGCAGG + Intronic
1184725966 22:46346640-46346662 TACTCTGGAGCACAGAGGGAGGG - Intronic
950815293 3:15695038-15695060 AAATCATGTGTACAGAGGAAAGG - Intronic
951886921 3:27533399-27533421 GACTCAGTTGGAGACAGGGAGGG + Intergenic
952848190 3:37706161-37706183 GACTCATGTGTGCAGGGGGAAGG - Intronic
958055401 3:88404548-88404570 GACTGAGGCTTAAAGAGGGAAGG - Intergenic
959350856 3:105261061-105261083 GAATCAGGTCCAGAGAGGGAAGG + Intergenic
960996807 3:123345589-123345611 GGCTCAGGTTTAAAGTGGGAAGG - Intronic
961077732 3:123997481-123997503 GACACAGGTGTCAAGAAGGAAGG - Intergenic
961324940 3:126104377-126104399 GACTCAGGACCTCAGAGGGACGG - Intronic
961385108 3:126518743-126518765 GAAACAGGTGGAGAGAGGGATGG + Intergenic
961455687 3:127022849-127022871 GAGGCAGGTGAACAGCGGGAGGG + Intronic
961648763 3:128407186-128407208 CACTCAGGTGTTCAGCTGGAGGG + Intronic
963123277 3:141794005-141794027 GACTCAGGTGCAGGGAGGGCTGG - Intronic
964022350 3:152028290-152028312 GACTCAGAGGGAGAGAGGGAAGG + Intergenic
966331726 3:178822209-178822231 GACTCACATGAACAAAGGGATGG - Intronic
966484621 3:180453638-180453660 GACACAGGGATACAGAGCGAAGG + Intergenic
967940937 3:194766068-194766090 GACTCAGATGCAGGGAGGGAGGG + Intergenic
968254439 3:197254041-197254063 GACTCAGGTGGGCAAAGGAATGG + Intronic
968478368 4:823401-823423 GACAAGGGTGTACAGAGGGCAGG - Intronic
968928319 4:3561903-3561925 GTCTCAGGGGAGCAGAGGGATGG + Intergenic
969488668 4:7486346-7486368 GAACCAGGTGGACAGATGGAGGG + Intronic
969652048 4:8473824-8473846 GGCTCAGGTGTTAAGAGGGGCGG + Intronic
970363137 4:15330325-15330347 GACTCAGGAGCAAAGAAGGAAGG + Intergenic
976515111 4:85955932-85955954 GAATAAAGTGTAAAGAGGGAGGG - Intronic
978390553 4:108220730-108220752 GGCTCAGTTGAAAAGAGGGAAGG - Intergenic
978779721 4:112537942-112537964 GTCTCAGATCTACAGCGGGATGG - Intergenic
980140047 4:128904534-128904556 CACTCAGGAGAAGAGAGGGAAGG - Intronic
980736401 4:136895246-136895268 GAATCAGGAGCACAGAGGGGAGG - Intergenic
982358346 4:154492209-154492231 GAGTCAGGCCTGCAGAGGGACGG - Intergenic
984140900 4:176002487-176002509 GAGGCAGGTGGAAAGAGGGAGGG - Intronic
984946525 4:184972938-184972960 GAGTGAGGTGTTCAGAGTGAGGG - Intergenic
985489969 5:173441-173463 GACTCGGCTGTGCTGAGGGAGGG + Intronic
987853613 5:23389077-23389099 GACTAAGGTATTCAGATGGAAGG + Intergenic
994537672 5:101051780-101051802 GACTCACATTGACAGAGGGATGG + Intergenic
994934310 5:106234246-106234268 GACTCAGGGGTACAGGTGTAGGG - Intergenic
995787916 5:115850453-115850475 GACTAAGTTCTACAGATGGATGG - Intronic
997978520 5:138454397-138454419 GACTCAGGAGGACAGAGGCCTGG + Intergenic
998358026 5:141557879-141557901 GAGTCTGGTTTGCAGAGGGAGGG - Intronic
999246092 5:150155563-150155585 GGCTCAGGAGAACAGAGGGATGG + Exonic
1004490460 6:16110149-16110171 GACTCAAGAGTACAGAGGGCTGG + Intergenic
1005201901 6:23355977-23355999 GACACAGATGCACACAGGGAAGG + Intergenic
1005313831 6:24585498-24585520 GTCTCAGGTGAGCAGAGGGATGG - Intronic
1006437483 6:34033475-34033497 GACTCAGGGGCACAGAGAGGGGG - Intronic
1006645272 6:35511247-35511269 GTCTCAGGAGGAGAGAGGGAGGG - Intronic
1009960540 6:70515594-70515616 GGCTCTGGGGGACAGAGGGAGGG + Intronic
1010418105 6:75638738-75638760 TACTCACCTGTACAGAGGAAAGG - Intronic
1011784435 6:90828159-90828181 GAATCACGTGAACAGAGGAATGG + Intergenic
1014142816 6:117963966-117963988 CTGTCAGGGGTACAGAGGGAAGG - Intronic
1017042607 6:150319589-150319611 GTCTCAGGTGAGCAGAGGGAGGG + Intergenic
1017065616 6:150526505-150526527 GTCTCAGGTGAGCAGAGGGATGG - Intergenic
1019073696 6:169370184-169370206 GCCTCAGGGGGACAGAGGCAGGG - Intergenic
1019160928 6:170066501-170066523 GAATGGGGTGGACAGAGGGATGG - Intergenic
1020179077 7:5907312-5907334 GCATCAGGTCTGCAGAGGGATGG + Intronic
1020303857 7:6817557-6817579 GCATCAGGTCTGCAGAGGGATGG - Intronic
1022743814 7:33149211-33149233 GGATCAGGTGTGCAGATGGAAGG + Intronic
1024744862 7:52394299-52394321 GACTTAGGGGGAAAGAGGGAGGG - Intergenic
1024941313 7:54765896-54765918 GACACAGATGTACAGAAAGAAGG + Intergenic
1028636176 7:92992210-92992232 GACTCTGCTGTACAAAGGGAAGG + Intergenic
1031232216 7:119122956-119122978 GGTGCAAGTGTACAGAGGGATGG + Intergenic
1031839344 7:126718277-126718299 TACTCAGTTTTCCAGAGGGAAGG + Intronic
1031960766 7:127987665-127987687 GACTGAGGTGTAAAGACAGAAGG - Intronic
1033259297 7:139828632-139828654 GACTAAAGTGGACAGAGAGATGG - Intronic
1033285671 7:140038831-140038853 GACTCAGTTGCGCAGAGGCATGG - Intronic
1034626853 7:152500109-152500131 GTCTCAGGTGAGCAGAGGGACGG - Intergenic
1034712374 7:153204946-153204968 CAGTCAGGAGTACAGAGAGAAGG - Intergenic
1034902896 7:154918477-154918499 TACTCAGGTGTAAAGTGTGAGGG + Intergenic
1035204821 7:157288431-157288453 GTCTCAGGGGAGCAGAGGGATGG + Intergenic
1035438185 7:158875038-158875060 GAGTCTGGGTTACAGAGGGAGGG - Intronic
1039195993 8:35032358-35032380 GAGGCAGGTGTACACATGGAGGG - Intergenic
1041845572 8:62323942-62323964 GATTTTGGGGTACAGAGGGAGGG + Intronic
1042367938 8:67957975-67957997 TACTGTGGTGTACAGAGGAAAGG + Intronic
1042902879 8:73746494-73746516 GACACAGGTGTCCTGAGGGGAGG - Intronic
1044027898 8:87196392-87196414 TACTCAGATGTACAAAGGAAAGG - Intronic
1045354288 8:101371631-101371653 GACCCTGGTGCAGAGAGGGAAGG - Intergenic
1046122702 8:109865554-109865576 GACTCCTGTGTAAGGAGGGAGGG - Intergenic
1046932850 8:119858312-119858334 GACTGTGGTATACAGATGGAGGG - Intergenic
1047391546 8:124456041-124456063 GTCTGAGGTGGGCAGAGGGATGG + Intronic
1048449918 8:134524160-134524182 GACAGATGTGTACAGAGGGGAGG - Intronic
1049783335 8:144438949-144438971 GTCTCAAGTGGGCAGAGGGATGG - Intronic
1050169687 9:2802375-2802397 GAATCAGGTGTACAGCCGGGTGG + Intronic
1050555516 9:6786147-6786169 AACACAGGTGTAGACAGGGAAGG + Intronic
1052349027 9:27439191-27439213 GACTGAGGAGTAAAGAGGAAAGG + Intronic
1053803202 9:41777045-41777067 GTCTCAGGGGAGCAGAGGGATGG + Intergenic
1054142059 9:61538079-61538101 GTCTCAGGGGAGCAGAGGGATGG - Intergenic
1054191494 9:61988355-61988377 GTCTCAGGGGAGCAGAGGGATGG + Intergenic
1054646875 9:67599357-67599379 GTCTCAGGGGAGCAGAGGGATGG - Intergenic
1054834760 9:69665482-69665504 AACTCAGGTGTAAAGAATGAGGG - Intronic
1056513468 9:87328167-87328189 GACTCAGGAATACAGAGGGAAGG + Intergenic
1061733704 9:132637415-132637437 GACCTAGGAGTACAGATGGAAGG + Intronic
1062327218 9:136018049-136018071 GTCTCAGCTGTGCAGAGGGAGGG + Intronic
1062339341 9:136087061-136087083 GACACAGATGCACAGAAGGAAGG + Intronic
1062482989 9:136761039-136761061 GACACAGATGCACAGAAGGAAGG + Intronic
1187715246 X:22096104-22096126 GAGTCATGTGTGCAGTGGGAAGG + Intronic
1187716027 X:22103454-22103476 GACTCAGGGGGAGAGTGGGAGGG - Intronic
1187760473 X:22578496-22578518 TTCTCTGGTTTACAGAGGGAAGG + Intergenic
1190689009 X:52898049-52898071 GTCTCATGTTTAGAGAGGGAGGG + Exonic
1190696974 X:52957743-52957765 GTCTCATGTTTAGAGAGGGAGGG - Intronic
1193552284 X:82910457-82910479 TACTCAGCAGTAAAGAGGGATGG + Intergenic
1195101049 X:101553831-101553853 GACTCAGCTGTGCAGATGGCTGG + Exonic
1198935971 X:141903270-141903292 GACTCAGATGCATAGAGGCAGGG + Intergenic
1198963949 X:142208170-142208192 GACTCAGATGCACAGAGGCAGGG - Intergenic
1199398420 X:147367702-147367724 GTCTCAGGTGAGCAGAGGGATGG + Intergenic
1199606589 X:149584014-149584036 GCCTCAGGTCAACAGAGGGAGGG - Intronic
1199607012 X:149585805-149585827 GACTCAGGTCCACAGAGGGGTGG - Intronic
1199622882 X:149714963-149714985 GCGTCAGGTCAACAGAGGGAGGG + Intronic
1199627924 X:149757887-149757909 GACTCAGGTCCGCAGAGGGATGG - Intergenic
1199632111 X:149783563-149783585 GACTCAGGTCCACAGAGGGGTGG + Intronic
1199632534 X:149785354-149785376 GCCTCAGGTCAACAGAGGGAGGG + Intronic
1199716027 X:150507889-150507911 AACACAGTTGTACAGAGGTAGGG - Intronic
1200018060 X:153180521-153180543 GCCTCAGGGGAGCAGAGGGAGGG + Intronic