ID: 1167904622

View in Genome Browser
Species Human (GRCh38)
Location 19:52648801-52648823
Sequence GACTCCGTAGTGACTAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 59}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167904622_1167904624 8 Left 1167904622 19:52648801-52648823 CCTGCTCTAGTCACTACGGAGTC 0: 1
1: 0
2: 0
3: 6
4: 59
Right 1167904624 19:52648832-52648854 CTATGCACAGCTGAAGCTTGAGG 0: 4
1: 10
2: 13
3: 53
4: 204
1167904622_1167904625 9 Left 1167904622 19:52648801-52648823 CCTGCTCTAGTCACTACGGAGTC 0: 1
1: 0
2: 0
3: 6
4: 59
Right 1167904625 19:52648833-52648855 TATGCACAGCTGAAGCTTGAGGG 0: 1
1: 3
2: 1
3: 18
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167904622 Original CRISPR GACTCCGTAGTGACTAGAGC AGG (reversed) Intronic
902161748 1:14536027-14536049 GACTCCCTAATTACTGGAGCAGG + Intergenic
904288109 1:29466555-29466577 GTTTCTGTGGTGACTAGAGCAGG - Intergenic
905061419 1:35142874-35142896 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
907123987 1:52033187-52033209 GAATCCGGAGTCACAAGAGCTGG + Exonic
915266337 1:154720776-154720798 GACGCCGAAGTGAGGAGAGCAGG + Intronic
915835795 1:159173476-159173498 GTCTCTGTGGTGACTAGGGCGGG - Intronic
919176321 1:194023332-194023354 GTATCCCTAGTGCCTAGAGCAGG + Intergenic
922814866 1:228441381-228441403 GACTCTGTACTGACTGCAGCTGG + Intergenic
1075452627 10:122562544-122562566 AACTCGGTACTGACAAGAGCTGG - Intronic
1076856259 10:133116793-133116815 GACTCGGAACTGACCAGAGCTGG - Intronic
1082960992 11:58918766-58918788 GCTTCCAGAGTGACTAGAGCAGG + Intronic
1084390363 11:68871674-68871696 GCCTCCAGAGTGACTAGAGCAGG - Intergenic
1085572868 11:77574348-77574370 GCCTCCGGAGTGACCAGAACAGG - Intronic
1100468360 12:94869233-94869255 GGCTACTTACTGACTAGAGCGGG - Intergenic
1101286321 12:103317006-103317028 GCCACTGTGGTGACTAGAGCTGG - Intronic
1101434770 12:104655214-104655236 GACTTCGCAGAGCCTAGAGCGGG + Intronic
1102965255 12:117120666-117120688 GATTCCCTGGTGACTTGAGCTGG + Intergenic
1114574136 14:23696994-23697016 GCCTCTGGAGTGACCAGAGCAGG - Intergenic
1119153667 14:72388742-72388764 GAGCCCATAGTGAGTAGAGCTGG - Intronic
1122922862 14:104887127-104887149 GCCTGCGTAGTGGCAAGAGCGGG + Exonic
1131458164 15:92599232-92599254 GACTCTGCAGTGACTTGAGCCGG - Intergenic
1135381194 16:21997493-21997515 GGCTCCGAAGTGAGTAAAGCTGG + Intronic
1148853780 17:50567563-50567585 GACTCTGTAGGGCCCAGAGCAGG - Intronic
1152842271 17:82577697-82577719 GCCTCCAAAGGGACTAGAGCTGG + Intronic
1159396964 18:67871855-67871877 GACTTCGTTGTTACTACAGCTGG + Intergenic
1160714061 19:567493-567515 GCTTCCGGGGTGACTAGAGCAGG + Intergenic
1161776697 19:6266906-6266928 GAGTCCGTTGTGATTAGAGAAGG + Intronic
1163953795 19:20615196-20615218 GCCTCTGGAGTGACCAGAGCAGG - Intronic
1164142573 19:22486311-22486333 GCTTCCGAAGTGACCAGAGCAGG + Intronic
1164148598 19:22529186-22529208 GCCTCCGGAGTGACCAGGGCAGG - Intronic
1167904622 19:52648801-52648823 GACTCCGTAGTGACTAGAGCAGG - Intronic
1167999802 19:53436020-53436042 GCCTCCAGAGTGACCAGAGCAGG + Intronic
1168004236 19:53473397-53473419 GCCTCCAGAGTGACCAGAGCAGG + Intronic
933507951 2:83203117-83203139 GACTTAGTAGTGCATAGAGCAGG - Intergenic
934576776 2:95406922-95406944 GGCTCTGTAGAGACCAGAGCAGG - Exonic
934638995 2:96015090-96015112 GGCTCTGTAGAGACCAGAGCAGG - Intergenic
934794653 2:97090322-97090344 GGCTCTGTAGAGACCAGAGCAGG + Exonic
940860724 2:158768098-158768120 GACTGCATAGTCACTAGAGTGGG - Intergenic
946808906 2:223501367-223501389 GACACCTCAGTGACCAGAGCTGG - Intergenic
1183856008 22:40635876-40635898 TACTCCATAGTGCCTAGGGCTGG - Intronic
950668799 3:14513050-14513072 GACTCTGGTCTGACTAGAGCAGG - Intronic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
961033991 3:123629623-123629645 GACTCTGGAGAGACAAGAGCAGG + Exonic
962805136 3:138921716-138921738 AACTCAGTAGTGGCTAGGGCTGG + Intergenic
967081055 3:186049908-186049930 GACTCATTAGTGACTAAACCAGG - Intronic
969647242 4:8438909-8438931 GCCTCCGGAGTGACCAGAGCAGG - Intronic
970148928 4:13068786-13068808 GACTCTGTTGTGCCTAGAGAGGG + Intergenic
972480185 4:39489304-39489326 GCTTCTGGAGTGACTAGAGCAGG - Intergenic
979058036 4:116019010-116019032 GCTTCCGGGGTGACTAGAGCAGG - Intergenic
981902510 4:149883193-149883215 TACTAGGTAGTTACTAGAGCAGG - Intergenic
982818581 4:159918110-159918132 GAATCCCTAGTGTCTAGAACAGG - Intergenic
989998202 5:50860860-50860882 GTCTCCATAGAGACTTGAGCAGG + Intergenic
991568896 5:68034077-68034099 AACTCATTAGTGACTAGAGTGGG - Intergenic
1001130125 5:169056987-169057009 GTCTCCATAATGACAAGAGCAGG + Intronic
1002319854 5:178368609-178368631 CACACCATAGTGACTTGAGCAGG + Intronic
1004503311 6:16227755-16227777 GCCTCCGGAGTGAGCAGAGCAGG + Intergenic
1006037773 6:31227315-31227337 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1007920137 6:45599936-45599958 CACTCAGTAGTGACCAGAGAGGG + Intronic
1008583346 6:52926068-52926090 GCCTCCAGAGTGACCAGAGCAGG - Intergenic
1011299977 6:85863760-85863782 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
1025823542 7:64993250-64993272 GCTTCCGGAGTGACCAGAGCAGG + Exonic
1033152986 7:138932768-138932790 GACTCCGTAGGGTCTTGAGTGGG - Intronic
1033365065 7:140666710-140666732 GCTTCCGGAGTGACCAGAGCAGG - Intronic
1056110676 9:83391718-83391740 GACAACGCAGTGATTAGAGCAGG + Intronic
1197804633 X:130387006-130387028 GACTCCGTGGAGTCAAGAGCTGG - Intergenic
1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG + Intergenic