ID: 1167904624

View in Genome Browser
Species Human (GRCh38)
Location 19:52648832-52648854
Sequence CTATGCACAGCTGAAGCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 4, 1: 10, 2: 13, 3: 53, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167904620_1167904624 28 Left 1167904620 19:52648781-52648803 CCTGCTGCTAAAGAAGACTGCCT 0: 1
1: 0
2: 0
3: 9
4: 157
Right 1167904624 19:52648832-52648854 CTATGCACAGCTGAAGCTTGAGG 0: 4
1: 10
2: 13
3: 53
4: 204
1167904622_1167904624 8 Left 1167904622 19:52648801-52648823 CCTGCTCTAGTCACTACGGAGTC 0: 1
1: 0
2: 0
3: 6
4: 59
Right 1167904624 19:52648832-52648854 CTATGCACAGCTGAAGCTTGAGG 0: 4
1: 10
2: 13
3: 53
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167904624 Original CRISPR CTATGCACAGCTGAAGCTTG AGG Intronic
901421459 1:9154105-9154127 GTAAGCACAGCAGAAGCGTGTGG + Intergenic
901987770 1:13089786-13089808 CTACGTACAGCTGAAGGTTGAGG + Intergenic
901987775 1:13089853-13089875 CTACGCACGGCCGAAGCTTGAGG + Intergenic
901994037 1:13136914-13136936 CTACGCACGGCCGAAGCTTGAGG - Intergenic
901994042 1:13136981-13137003 CTACGTACAGCTGAAGGTTGAGG - Intergenic
902284879 1:15401209-15401231 CTATGCAAAGCTGAAGAGTCAGG + Intergenic
904252278 1:29233671-29233693 CTGTGCCCGGCTGAAGTTTGTGG + Intergenic
904503159 1:30929381-30929403 CTATGCACTGCAGACGCTGGAGG + Intergenic
905061415 1:35142843-35142865 CTACGCACGGCCGAAGCTTGAGG - Intergenic
905435765 1:37954153-37954175 CTTTGCACAGTTGAGGCTGGAGG + Intergenic
906499119 1:46328117-46328139 CCACACACAGCTGAAGCATGAGG - Intergenic
907453091 1:54559838-54559860 CCCTGCCCAGCTGGAGCTTGGGG - Intronic
910431365 1:87162518-87162540 GTCTGCACAGCTGGAGCTGGTGG + Intronic
911341961 1:96650357-96650379 CTATGAACAGGTGTAGATTGGGG - Intergenic
912980216 1:114364679-114364701 CCACGCACAGCTGAAGTATGAGG - Intergenic
913327865 1:117643198-117643220 CTAAGCCCTGCTGAGGCTTGAGG + Intergenic
913368760 1:118072673-118072695 CTATTCACAGCTGAACTGTGTGG - Intronic
913541943 1:119829694-119829716 CAAAGCATAGCTGAGGCTTGCGG + Intergenic
915354744 1:155249418-155249440 CAAGTGACAGCTGAAGCTTGGGG + Intronic
916102548 1:161405590-161405612 CTATGCACAGCCGAAGCTTGAGG - Intergenic
916545092 1:165796562-165796584 CTTTGGGAAGCTGAAGCTTGAGG + Intronic
917116017 1:171604244-171604266 CCATGCACGGCCGAAGCGTGAGG + Intergenic
918299848 1:183193179-183193201 CTAAGCACAGCTCTAGTTTGTGG + Intronic
918646987 1:186916920-186916942 CTATGCACAGCCGAAGCATGAGG - Intronic
919971938 1:202586446-202586468 CTCTGCTCAGCTGGAGCCTGAGG - Exonic
920450375 1:206056330-206056352 CCACGCACAGCTGAAGCATGAGG + Intronic
921497956 1:215863900-215863922 ATATGAACATCTGAAGGTTGGGG + Intronic
921756927 1:218868429-218868451 CCTTGCACAGCTGTGGCTTGTGG + Intergenic
922622740 1:227002810-227002832 CTAGTCACAGCTGAGTCTTGAGG + Intronic
922680552 1:227591924-227591946 CCACGCACGGCTGAAGCATGAGG - Intronic
922690356 1:227684181-227684203 CCACGCACGGCTGAAGCATGAGG + Intergenic
924379420 1:243448143-243448165 TCATCCACAGGTGAAGCTTGAGG + Intronic
924626312 1:245698901-245698923 CAATGCAAAGCTGAAGATTCTGG + Exonic
1064434664 10:15300819-15300841 CTGTGCACAGCTGCAGTGTGTGG - Intronic
1066390612 10:34974908-34974930 CCATGCACGGCCGAAGCATGAGG + Intergenic
1066461431 10:35615764-35615786 CTTTGGAAAGCTGAAGTTTGAGG + Intergenic
1067004969 10:42651935-42651957 CAATGCACAGCTGAAGCTTAAGG + Intergenic
1067004975 10:42652003-42652025 CTACGCATGGCTGAAGCTTAAGG + Intergenic
1067004979 10:42652071-42652093 CTATGCACGGCCAAAGCCTGAGG + Intergenic
1067133230 10:43585170-43585192 CTATACATGGCTGAAGCTTGAGG - Intergenic
1069604323 10:69730269-69730291 CTCTGCAGACCTGAAGCCTGGGG - Intergenic
1070017318 10:72546311-72546333 CTATGTACAGAGGAAGCTTTAGG - Intronic
1071282426 10:84114630-84114652 CTACGCACAGCCGAAACATGAGG + Intergenic
1075019466 10:118940485-118940507 CTATGTACAGCTCATGCTTAAGG - Intergenic
1076497528 10:130906724-130906746 CCATCCACAGCTGGAACTTGGGG - Intergenic
1076858361 10:133128203-133128225 CTTTGCACAGCTGCGGCTTGGGG - Intronic
1076987767 11:251810-251832 CTCTGCACAGGTGGAGCTTCTGG + Exonic
1077974631 11:7234981-7235003 CTATGCACTGGAGAAGCTTCAGG - Intergenic
1078107829 11:8369802-8369824 CTCTGCACAGCTAAGGATTGGGG + Intergenic
1079109749 11:17598646-17598668 GTATGCACAGCTGATGAGTGAGG + Intronic
1079445147 11:20549829-20549851 CTATGCATAGGTGTAGCATGTGG - Intergenic
1079445157 11:20549976-20549998 CTATGCATAGGTGTAGCATGTGG - Intergenic
1080189260 11:29525155-29525177 CTACACACAGCTGAAGCTTGAGG + Intergenic
1081512094 11:43785440-43785462 CTATGCACAGCCAAAGCTTGAGG - Intronic
1081656382 11:44860348-44860370 CTCAGCTCACCTGAAGCTTGAGG - Exonic
1083438596 11:62660763-62660785 CTATGGACAGCTGAGGCCAGGGG - Intronic
1084390365 11:68871705-68871727 CTACGCACGGCTGAAACTTGAGG + Intergenic
1085572873 11:77574379-77574401 CTACGCATGGCTGAAGTTTGAGG + Intronic
1085572877 11:77574446-77574468 CTATGCACGGCCAAAGCTTGAGG + Intronic
1087895014 11:103577254-103577276 CCATGCACAGCCAAAGCATGAGG + Intergenic
1088356828 11:108952918-108952940 CTATGCACAGCCCACGCTTTAGG - Intergenic
1091159685 11:133408692-133408714 ATATGCACAGCTGTAGGATGTGG + Intronic
1091348270 11:134870555-134870577 CTATGCACAGCCCATGCTTCAGG + Intergenic
1095451120 12:42331139-42331161 CTATGTTCATCTGAAGTTTGAGG + Intronic
1095960356 12:47830607-47830629 CTTTGCACAGGTGGAGTTTGAGG + Intronic
1098686944 12:73434095-73434117 TTAGCCACAGCTGAAGCTTCTGG - Intergenic
1102399934 12:112619983-112620005 CAAGCCACACCTGAAGCTTGAGG - Intronic
1103405336 12:120671094-120671116 CTAAGCACTGCTGATCCTTGAGG - Intergenic
1103956936 12:124582535-124582557 GAATGCACAGCTGGAGCTGGAGG + Intergenic
1106142048 13:27019726-27019748 CTGTGCACAGCTGAAGGCTGAGG + Intergenic
1106402095 13:29441069-29441091 CTAAGGACAGCAGATGCTTGTGG + Intronic
1107490312 13:40875197-40875219 CTATGCACAGCCAAAGCATGAGG - Intergenic
1110625578 13:77652021-77652043 CTATGCACAGCTCATACTTTAGG - Intergenic
1112367505 13:98767929-98767951 CTACTCACGGCCGAAGCTTGAGG + Intergenic
1114574141 14:23697025-23697047 CTACACACGGGTGAAGCTTGAGG + Intergenic
1114574143 14:23697092-23697114 CTATGCACAGCTGAAGCTTGAGG + Intergenic
1114683397 14:24506060-24506082 CCACACACAGCTGAAGATTGTGG + Exonic
1118951384 14:70439408-70439430 CTACACATGGCTGAAGCTTGAGG - Intergenic
1121208941 14:92191949-92191971 CAAAGCACAGCTAAAGCTTCTGG + Intergenic
1123681263 15:22765818-22765840 GGAAGCACAGCTGAAGCATGAGG + Intergenic
1124333474 15:28840280-28840302 GGAAGCACAGCTGAAGCATGAGG + Intergenic
1126316155 15:47372188-47372210 CTATAAACAGATGAAGCTAGAGG - Intronic
1127096093 15:55513670-55513692 CTACGCACGGCCGAAGCATGAGG - Intergenic
1127608321 15:60612434-60612456 GTATGCCCAGTTGAAGCCTGAGG + Intronic
1128600640 15:68992781-68992803 CTACACACGGCTGAAGCTTGAGG - Intronic
1128964236 15:72041576-72041598 CTATGCAGTGCTCAACCTTGCGG - Intronic
1129673736 15:77621343-77621365 CTGTGCCCAGCTGAGGTTTGGGG + Intronic
1137041426 16:35616335-35616357 CCATGCATGGCTGAAGCATGAGG - Intergenic
1138222899 16:55268074-55268096 ATTTGCACAGCTGGAGCTTCTGG + Intergenic
1139717504 16:68825327-68825349 CAAAGCACAGCAGAGGCTTGAGG + Intronic
1140338367 16:74133399-74133421 CTATGCAGAGATGAAGCTGGAGG + Intergenic
1140816564 16:78626675-78626697 CTGTGCCCAGCTCATGCTTGTGG + Intronic
1141406164 16:83795091-83795113 CTATCCAAATCTGAAGATTGCGG + Exonic
1146900646 17:36584579-36584601 CTATGGGCAGCTGAAGCAGGTGG - Intronic
1149785324 17:59429721-59429743 CTATACACAGCTGACCCTTGGGG + Intergenic
1150594661 17:66593535-66593557 ACATGCACAGCTGAAACTTGGGG + Intronic
1151805102 17:76400251-76400273 CCATGCTCAGCGGCAGCTTGGGG - Exonic
1154108580 18:11546898-11546920 CTACACACAGCCGAAGCTTGAGG - Intergenic
1155506216 18:26535868-26535890 CTATGCACAGCTGAAGGGGAAGG - Intronic
1155916456 18:31562223-31562245 CTATACACAGGTAAAGCTTTTGG + Intergenic
1156258276 18:35420595-35420617 CTGTGCCCAGCTGATTCTTGTGG - Intergenic
1156444930 18:37229406-37229428 CTATGCACACCTAAAACTTGAGG + Intronic
1156885083 18:42125908-42125930 CTATGTTCAGGTGAAGCTGGAGG + Intergenic
1157116450 18:44866769-44866791 TTATGCCCAGCTCAAGCTAGAGG + Intronic
1158292289 18:55955446-55955468 CTACGCACGGCCGAAGCATGAGG + Intergenic
1158466658 18:57696656-57696678 GTATGCACATCTGGAGCGTGAGG + Intronic
1158983040 18:62783974-62783996 CTAGGCAGAGCTGAAGCTGCTGG + Intronic
1160733987 19:653489-653511 CTCGGCACAGCTGTGGCTTGAGG - Intronic
1162297579 19:9823955-9823977 CGAGGCACAGCTGCAGCTAGGGG + Intronic
1163943011 19:20512412-20512434 CTATGCACGGCCAAAGCATGAGG - Intergenic
1163953799 19:20615227-20615249 CTATGCATGGCTGAAGCTTGAGG + Intronic
1163953804 19:20615294-20615316 CTATGCACGGCCAAAGCTTGAGG + Intronic
1164010586 19:21200366-21200388 CTACGCGTGGCTGAAGCTTGAGG - Intergenic
1164017085 19:21262709-21262731 CTACACACGGCTGAAGCTTGAGG + Intronic
1164054460 19:21610039-21610061 CTATGCACGGCTGAAGCTTGAGG + Intergenic
1164148604 19:22529217-22529239 CTACACACGGCTGAAGCTTGAGG + Intronic
1164148609 19:22529281-22529303 CTACGCACGGCCAAAGCTTGAGG + Intronic
1164900398 19:31915757-31915779 CTATGCTGAGCTAAATCTTGTGG - Intergenic
1165144753 19:33724167-33724189 CTAGGCTCATCTAAAGCTTGAGG - Intronic
1165578535 19:36842289-36842311 CTTTGCACATTTTAAGCTTGAGG - Intronic
1167904624 19:52648832-52648854 CTATGCACAGCTGAAGCTTGAGG + Intronic
1167942775 19:52960913-52960935 CTACGCACAGTGGAAGCATGAGG + Intronic
1167999792 19:53435922-53435944 CTACGCACGGCCGAAGCTTGAGG - Intronic
1167999799 19:53435989-53436011 CTATGCACAGCTGAAGCTGGAGG - Intronic
1168004218 19:53473235-53473257 CTACGCACAGCTGAAGCTTGAGG - Intronic
1168004224 19:53473299-53473321 CTATGCACAGCTGAAGCTGGAGG - Intronic
1168004233 19:53473366-53473388 CTATGCACAGCTGAAGCTGGAGG - Intronic
925591784 2:5517122-5517144 CTTTGCACAGCTGGACCTTGGGG - Intergenic
927710217 2:25320680-25320702 TTATTCACAGCTGAGCCTTGTGG - Intronic
927825234 2:26304017-26304039 CTATGCACGGCTGAAGCTTGAGG + Intergenic
930250876 2:49032813-49032835 CTATTCACAGCTGAAAATTGGGG - Intronic
930518758 2:52436954-52436976 CCGTGCACAGCTGAAGCATGAGG + Intergenic
931177069 2:59864854-59864876 CCTTCCACATCTGAAGCTTGGGG + Intergenic
932362554 2:71121123-71121145 ATGTGCCCTGCTGAAGCTTGGGG - Intronic
933935853 2:87203350-87203372 CCATGCATAGCCGAAGCATGAGG - Intergenic
935382688 2:102468575-102468597 CTATGCACAGCTGAAACCCTGGG + Intergenic
935750830 2:106232511-106232533 CTCTGCACAGCTGCTGCTAGGGG - Intergenic
936357296 2:111762480-111762502 CCATGCACAGCTGAAGCATGAGG + Intergenic
942654038 2:178195493-178195515 CTATACGCAGCAGAAGCTTTGGG - Intronic
943408303 2:187515583-187515605 CCACGCACAGCCGAAGCATGAGG + Intronic
946326788 2:218988771-218988793 CTTTGCACAGCTGAACCTCTGGG + Intergenic
946328768 2:218998206-218998228 CTATTCACATGCGAAGCTTGCGG - Intergenic
1169366715 20:4998506-4998528 CAATGCACAGCTTAACCTGGAGG + Intronic
1169983363 20:11412318-11412340 CTATGCACAGCTAATGCTTAAGG + Intergenic
1171408725 20:24931597-24931619 CCACGCACAGCCGAAGCATGAGG + Intergenic
1174728222 20:52887909-52887931 CTATGCACAACTCATGCTTATGG - Intergenic
1176346344 21:5751862-5751884 CTAAGCATGGCTGAAGCTTAAGG - Intergenic
1176353158 21:5872446-5872468 CTAAGCATGGCTGAAGCTTAAGG - Intergenic
1176498483 21:7572593-7572615 CTAAGCATGGCTGAAGCTTAAGG + Intergenic
1176540665 21:8149932-8149954 CTAAGCATGGCTGAAGCTTAAGG - Intergenic
1176559616 21:8332977-8332999 CTAAGCATGGCTGAAGCTTAAGG - Intergenic
1176875409 21:14121883-14121905 AAATGCACTGATGAAGCTTGAGG + Intronic
1176875414 21:14121951-14121973 CTACGCATGGCTGAAGCCTGAGG + Intronic
1177355109 21:19997706-19997728 CTATGCACGGCTGAAGCATGAGG - Intergenic
1177631411 21:23734116-23734138 ATATTCAAAGCTGAAGGTTGAGG + Intergenic
1179086819 21:38225692-38225714 CAACGCACGGCCGAAGCTTGAGG - Intronic
1182885876 22:33773674-33773696 ATCTGCAGAGCTGATGCTTGAGG - Intronic
1203245606 22_KI270733v1_random:66350-66372 CTAAGCATGGCTGAAGCTTAAGG - Intergenic
950321926 3:12063928-12063950 CTATGCACAGCTCACACTTAAGG - Intronic
951165830 3:19484462-19484484 CTACGCACGGCTGAAGCATGAGG - Intronic
951287044 3:20825677-20825699 CTATCAAAAGCTGAAGTTTGAGG + Intergenic
951350873 3:21605331-21605353 TTAGGCACAGCAGCAGCTTGGGG + Intronic
952568571 3:34685668-34685690 CCATGCATGGCTGAAGCTTGAGG + Intergenic
952568575 3:34685736-34685758 CTATGCACAGCCAAAGCCTGAGG + Intergenic
954757806 3:52851243-52851265 CCATGGAGAGCTGGAGCTTGTGG - Intronic
954758475 3:52856435-52856457 CTTTGCAAAGCTGAGGCGTGAGG + Intronic
957211823 3:77268854-77268876 CTATGCACTGGTGAAACCTGTGG - Intronic
959961927 3:112307085-112307107 CTATGCACGGCAGAAGCTTGAGG + Intergenic
960375287 3:116893079-116893101 CTATGCCCAGCAAAACCTTGGGG - Intronic
960604487 3:119490656-119490678 CTATCCACAGCTGAAGCCATGGG + Exonic
960760664 3:121071386-121071408 CCATGCACAACTGAAGCTTGAGG - Intronic
961361673 3:126372034-126372056 CAAGGCACAGATGAACCTTGAGG + Intergenic
961715650 3:128855721-128855743 CTATGCACAGCTGAAGCTTGAGG - Intergenic
961723978 3:128913874-128913896 CTTTGCACAGGAGAAGTTTGGGG + Intronic
963545087 3:146647050-146647072 TTCTGCACAACTGAAGCTTCTGG + Intergenic
965666385 3:171098075-171098097 CTATGCACAGCCCACACTTGAGG - Intronic
967057195 3:185839953-185839975 CTTTGGACAGCTGAAGCAGGAGG + Intergenic
969107802 4:4820990-4821012 CCATGCAGAGCTCAAGCATGGGG + Intergenic
969647251 4:8439007-8439029 CTACGCATGGCCGAAGCTTGAGG + Intronic
970973109 4:22008226-22008248 CTTTCCACAGCTGAAGCCTTTGG - Intergenic
971271341 4:25149307-25149329 CTTTGGAAGGCTGAAGCTTGTGG - Intronic
974153148 4:58036320-58036342 CTATGCACAGCCCACACTTGAGG - Intergenic
974976543 4:68901188-68901210 CTATGCACGGAAGAAGGTTGAGG - Intergenic
974988148 4:69054759-69054781 CCACGCACGGCTGAAGCATGAGG + Intronic
976969825 4:91091567-91091589 CTACGCATGGCTGAAGCATGAGG - Intronic
979058033 4:116018977-116018999 CTATGTACAGCTGAAGCTTGAGG + Intergenic
979464341 4:121019038-121019060 CTGTGCACAGCTTACACTTGAGG + Intergenic
980780347 4:137484483-137484505 CTACGCACAGCCGAAGCATGAGG + Intergenic
982236423 4:153254925-153254947 CTAAGTATAGCTGAAGCCTGGGG - Intronic
983670784 4:170235553-170235575 TTATGCACAGCAGAAGCTGCTGG + Intergenic
983778875 4:171643291-171643313 CTCTGCACAGCTGTCTCTTGTGG + Intergenic
985180341 4:187254147-187254169 CTTTGCATAGCTGAAGGTTTGGG - Intergenic
986328794 5:6702507-6702529 CTATACCCAGCAGAATCTTGAGG + Intergenic
986392253 5:7297812-7297834 GGAAGCACAGCTGAAGCATGAGG + Intergenic
991734998 5:69623718-69623740 CTATGTGGAGCTGAAGCTTGTGG + Intergenic
991779980 5:70123000-70123022 CTATGTGGAGCTGAAGCTTGTGG - Intergenic
991811432 5:70478853-70478875 CTATGTGGAGCTGAAGCTTGTGG + Intergenic
991859267 5:70998430-70998452 CTATGTGGAGCTGAAGCTTGTGG - Intronic
991872427 5:71123323-71123345 CTATGTGGAGCTGAAGCTTGTGG - Intergenic
999199746 5:149807325-149807347 CTAGGCACATCTGAATTTTGAGG + Intronic
1001058155 5:168466046-168466068 CAAAGCACAGCAGCAGCTTGGGG + Intronic
1001675019 5:173504834-173504856 CTATGCACAACCCACGCTTGAGG - Intergenic
1002184738 5:177448899-177448921 CCATGCACTGCTGCAGCCTGTGG + Intronic
1002615771 5:180454916-180454938 CTATTCACAGCTGAACCATGTGG - Intergenic
1002674509 5:180899917-180899939 CAATTCACAGAGGAAGCTTGAGG + Intronic
1003027343 6:2567151-2567173 CTATGCACAGCCCATGCTTAAGG + Intergenic
1003044170 6:2717642-2717664 CAATCCTCAGCAGAAGCTTGTGG + Intronic
1003789396 6:9526306-9526328 CTACACACAGATGAATCTTGAGG - Intergenic
1004503307 6:16227724-16227746 CTATGCATGGCTGAAGCTTGAGG - Intergenic
1007734667 6:43973089-43973111 CTCTCCACAGCTGATGCTGGAGG - Intergenic
1008534796 6:52499662-52499684 CTAAGAACCCCTGAAGCTTGGGG - Exonic
1009494743 6:64332704-64332726 CCACGCACAGCTGAAGCTTAAGG + Intronic
1010235863 6:73574148-73574170 CCATGCCCAGCTGAAGTTTTTGG - Intergenic
1010317958 6:74472059-74472081 CCATGCACAGCCGAAGCATGAGG + Intergenic
1011299972 6:85863662-85863684 CTATGCACAGCCGAAGCTTAAGG - Intergenic
1011299974 6:85863729-85863751 CTATACACAGCTGAAACTTAAGG - Intergenic
1011565557 6:88668392-88668414 CTATGCACAGCCAAAGCATAAGG + Intronic
1013411534 6:109888181-109888203 CTATGCACAGCTGAAGCTTGAGG - Intergenic
1013438380 6:110137145-110137167 ATATGCATAGCTGCAGCTTTAGG - Intronic
1014226373 6:118852567-118852589 AAGTTCACAGCTGAAGCTTGGGG - Intronic
1014546692 6:122744044-122744066 CCACGCACAGCCGAAGCATGAGG - Intergenic
1015172124 6:130265396-130265418 CCATGCACGGCCGAAGCATGAGG + Intronic
1015811763 6:137167830-137167852 CCACGCACGGCTGAAGCTTGAGG + Intronic
1015811768 6:137167898-137167920 CTATGCATGGCTGAAGCCTGAGG + Intronic
1016576786 6:145577667-145577689 CTAAGTACAGATGAAGCCTGAGG - Intronic
1019350783 7:552998-553020 CTACGCACAGATGCAGCCTGCGG + Intronic
1020004361 7:4774439-4774461 CTAGGCACTGCTGAAGGTTCTGG - Intronic
1022892415 7:34714781-34714803 CAATGCACAGCTTAAGTCTGGGG - Intronic
1024497640 7:50066778-50066800 CTATGCATGGCTGAAGCTTGAGG - Intronic
1024920576 7:54549863-54549885 CTTTGGAAATCTGAAGCTTGTGG - Exonic
1025823537 7:64993219-64993241 CCACACACGGCTGAAGCTTGAGG - Exonic
1027438396 7:78192011-78192033 CTCTGTACAGCTCAGGCTTGTGG + Intronic
1027658271 7:80958493-80958515 TTAACGACAGCTGAAGCTTGTGG + Intergenic
1029814539 7:103079309-103079331 CTTTCCATAGCTGAAGCTCGGGG + Intronic
1031500406 7:122507544-122507566 CTATTCAAAGAGGAAGCTTGAGG + Intronic
1033109156 7:138559585-138559607 CTATGCACGGCTGAAGCTTGAGG - Intronic
1033365068 7:140666741-140666763 CTACCCACGGCTGAAGCTTGAGG + Intronic
1035185883 7:157125581-157125603 CTGTTCACAGCCGCAGCTTGAGG + Intergenic
1037706028 8:21315948-21315970 CTATGCACAGATTGAGGTTGGGG - Intergenic
1039510066 8:38084697-38084719 CTATGCACGGCCGAAGCCTGAGG - Intergenic
1039510071 8:38084765-38084787 CTACGCAAGGCTGAAGCTTAAGG - Intergenic
1041008746 8:53521123-53521145 CTAAGCATGGCTGAAGCTTGAGG - Intergenic
1041809110 8:61887575-61887597 CTAGGCAGGCCTGAAGCTTGAGG + Intergenic
1042817831 8:72897608-72897630 CCATGCAAAACTGAAGCTTAGGG + Intronic
1043734328 8:83724649-83724671 CTAAGCACAGCTGCAGTTTGGGG - Intergenic
1045039624 8:98210349-98210371 CTTTGCACAGCTGCAGTTTAAGG + Intronic
1047406586 8:124590399-124590421 GCATGCACAGCAGAATCTTGTGG - Intronic
1049634087 8:143676889-143676911 CCATGCACGGCCGAAGCATGAGG + Intergenic
1049802014 8:144522241-144522263 CCATGCAGAGCTGGAGGTTGGGG + Exonic
1050100146 9:2110605-2110627 CTTTGAAGAGCTGAAGTTTGAGG + Intronic
1052902623 9:33807130-33807152 CTTTACGCAGATGAAGCTTGGGG + Intergenic
1053487959 9:38474755-38474777 CTTTACGCAGATGAAGCTTGCGG - Intergenic
1056432467 9:86541351-86541373 CTATGCAGAGCTGAAGTGTGGGG + Intergenic
1057242385 9:93422995-93423017 CCCTGCCCAGCTGAACCTTGGGG + Intergenic
1057673442 9:97116784-97116806 CTTTACGCAGATGAAGCTTGGGG - Intergenic
1060961298 9:127682680-127682702 CTGTGGACAGCAGAAGCTAGGGG + Intronic
1061794592 9:133078554-133078576 CTACGCACGGCCGAAGCTTGAGG - Intronic
1061794599 9:133078618-133078640 CAACGCACGGCTGAAGCTTAAGG - Intronic
1203461944 Un_GL000220v1:49422-49444 CTAAGCATGGCTGAAGCTTAAGG - Intergenic
1185910166 X:3973623-3973645 CTACGCATGGCTGAAGCATGAGG + Intergenic
1190425635 X:50332525-50332547 CTACGCACAGCCGAAGCATGAGG - Intronic
1191035844 X:56026004-56026026 CTACGCACGGCCGAAGCATGAGG - Intergenic
1192356191 X:70406380-70406402 CTTTGCACAGCTTAGGTTTGGGG + Intronic
1193268905 X:79506706-79506728 CCATGCACACCTGAAGCTGTTGG - Intergenic
1193680317 X:84510881-84510903 TTATGCACAGTTGATGCTTATGG + Intergenic
1194090809 X:89580720-89580742 CTACACATGGCTGAAGCTTGAGG - Intergenic
1194378397 X:93164130-93164152 ATATGCACAACTAAAACTTGGGG - Intergenic
1198703200 X:139418906-139418928 TGAGGCACAGCTGAAGCTTTGGG + Intergenic
1198970276 X:142271381-142271403 CTATGCACGGCCGAAGCATGAGG + Intergenic
1200443461 Y:3236780-3236802 CTATACATGGCTGAAGCTTGAGG - Intergenic
1200779562 Y:7201989-7202011 CTAGACACAGCTGAAGCTTGAGG + Intergenic
1200779572 Y:7202057-7202079 CTAGGCACAGCCAAAGCCTGAGG + Intergenic
1200948487 Y:8868851-8868873 CCATGCACAGCCAAAGCATGAGG + Intergenic
1201358205 Y:13117895-13117917 CTACACATGGCTGAAGCTTGAGG + Intergenic
1201378329 Y:13345343-13345365 CCAAGCACAGCTGAACCTTAGGG + Intronic
1201378335 Y:13345411-13345433 CTATGCATGGCTGAAGCCTGAGG + Intronic
1201556533 Y:15268861-15268883 CTACGCATGGCTGAAGCATGAGG + Intergenic
1201573170 Y:15434793-15434815 CTACGCATGGCTGAAGCTTGAGG + Intergenic
1201697076 Y:16837689-16837711 CTATGCATGGCCGAAGCATGAGG + Intergenic
1202037516 Y:20649394-20649416 CCATGCATGGCTGAAGCATGAGG + Intergenic
1202051944 Y:20790713-20790735 CTACCCACAGCCGAAGCTTTAGG - Intergenic
1202051948 Y:20790780-20790802 CTATGCACGACTGAAGCTTAAGG - Intergenic
1202071321 Y:20994442-20994464 CTATGCACTGCTGAAGCTTGAGG + Intergenic
1202095247 Y:21243048-21243070 CTACACATGGCTGAAGCTTGAGG - Intergenic