ID: 1167904651

View in Genome Browser
Species Human (GRCh38)
Location 19:52648994-52649016
Sequence CAGGGCATGAAAACTGTCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167904651_1167904659 10 Left 1167904651 19:52648994-52649016 CCAGCGACAGTTTTCATGCCCTG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1167904659 19:52649027-52649049 GACCTTTCCCTTCTCCCGCCGGG 0: 1
1: 0
2: 1
3: 14
4: 179
1167904651_1167904658 9 Left 1167904651 19:52648994-52649016 CCAGCGACAGTTTTCATGCCCTG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1167904658 19:52649026-52649048 CGACCTTTCCCTTCTCCCGCCGG 0: 1
1: 0
2: 1
3: 12
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167904651 Original CRISPR CAGGGCATGAAAACTGTCGC TGG (reversed) Intronic
902361230 1:15943632-15943654 CGGGGTCTGCAAACTGTCGCTGG + Exonic
902791812 1:18774183-18774205 CAGGGCATGAAAATTGTTGAAGG - Intergenic
907585249 1:55611102-55611124 CAGGGCCTGAAATCTGTCAGTGG + Intergenic
908371881 1:63490566-63490588 CAGGGCAGGAAAACTCTCAGAGG + Intronic
909317803 1:74246452-74246474 AAGGGAATGAAAACTGTGACTGG + Intronic
909325121 1:74341809-74341831 CAGGGCATTGAATCTGTGGCTGG + Intronic
912171281 1:107102634-107102656 AAGGACATGAAAACAGGCGCTGG + Intergenic
913370551 1:118094402-118094424 CAATGCATGATAACTGTCCCTGG - Intronic
918407588 1:184226035-184226057 CAGGGGATGAGAACTTTCGCTGG - Intergenic
918414333 1:184291030-184291052 TAGGGCAGGAAAACTGTAGATGG - Intergenic
924102788 1:240621714-240621736 TAGAGCATGAAACCTGTCTCTGG - Intergenic
1064562116 10:16604084-16604106 CAGGGCATAAAATCTGAAGCAGG - Intronic
1070345666 10:75539211-75539233 CAGAGCATGAAAACTGGAGATGG + Intronic
1070664916 10:78336173-78336195 CAGGGCATGGAAACTTGGGCAGG - Intergenic
1078594008 11:12671346-12671368 AAGGGCATGAAATCTGGAGCTGG + Intergenic
1097867056 12:64567656-64567678 CAGGGCATGTCAACTGTCGTAGG - Intergenic
1117758284 14:58999040-58999062 CAGGCCATGAAAACAGTTGCAGG + Intergenic
1119861941 14:77942291-77942313 CAGGGCTTGAAAGCTGTCAGAGG + Intergenic
1121656578 14:95601431-95601453 CATGGGATCAAAACAGTCGCTGG - Intergenic
1129152969 15:73700575-73700597 CAGGGCATGAGAACTGGCCTGGG + Intronic
1135110525 16:19687346-19687368 CAGGGCAGCAAAACTGCAGCTGG - Intronic
1142480743 17:216720-216742 CAAGAGATGAAAACTGTCCCTGG - Intronic
1143888309 17:10083491-10083513 CAGGGCATGCTATCTGCCGCAGG + Intronic
1148663976 17:49361532-49361554 CAGGGCAGGAGAACGCTCGCAGG + Intronic
1148689703 17:49520185-49520207 CAGGGCAGGAAGACTGTGGAGGG - Intergenic
1151890513 17:76948373-76948395 CAGACCATGAAAGCTGTCCCAGG + Intronic
1153265668 18:3266482-3266504 AAGGGCATGAAAATTGTTGAGGG + Intronic
1160354333 18:78214337-78214359 TTGGGAATGAAAACTGTGGCCGG + Intergenic
1160458796 18:79021814-79021836 CAGGGCCTGCAAACTGCTGCAGG + Intergenic
1160827289 19:1086478-1086500 CAGGGCCTGAATACTGGCCCTGG + Exonic
1161179128 19:2867580-2867602 CAGGGAATGAAGACTGGGGCAGG - Intronic
1165102974 19:33449837-33449859 CAGGGAATGAAATCTGTCCGGGG + Intronic
1166879179 19:45916736-45916758 CAGGATATGGAAACTGTGGCTGG + Intergenic
1167904651 19:52648994-52649016 CAGGGCATGAAAACTGTCGCTGG - Intronic
1168722176 19:58560153-58560175 CAGGGCAGGGAAACTGGCCCAGG + Intergenic
928517211 2:32054813-32054835 CTGGGCATGAAAGCTGAGGCAGG + Intergenic
932112710 2:69014992-69015014 CAGTGCATGAAAACAGTCGGAGG + Intronic
946202952 2:218081655-218081677 CAGGGCAAGTAAACTGGCTCAGG + Intronic
947385313 2:229585303-229585325 CAGGGCTGGAACACAGTCGCTGG + Intronic
1180981683 22:19881073-19881095 CAGTGAATGAAAACGGTAGCAGG - Intronic
1181630129 22:24146745-24146767 CTGGAGATGAAAACTGTCTCCGG - Intronic
952711731 3:36438680-36438702 CAGAGCAAGAAAAATGTGGCAGG + Intronic
954826320 3:53376790-53376812 TAGGGGAGGAAAACTGTCACTGG - Intergenic
960429281 3:117548864-117548886 CAGGGCTTGAAAAATGTTGAAGG + Intergenic
962455839 3:135564883-135564905 CAGGAGGTGAAAGCTGTCGCTGG + Intergenic
969116799 4:4875328-4875350 CAGGGCATGAAAACAGCCATGGG + Intergenic
970503164 4:16699363-16699385 CAGGGAATGAAGTCTGTAGCAGG - Intronic
972747040 4:41944901-41944923 AAAAGCATAAAAACTGTCGCAGG - Exonic
974439323 4:61896792-61896814 AAGGACATAAAAACTGTGGCAGG - Intronic
978368640 4:108008307-108008329 CAAGGCATGAAAACGCTCCCAGG - Intronic
978995445 4:115145211-115145233 CAGAGAAAGAAAACTGTGGCTGG - Intergenic
981805776 4:148713330-148713352 CAAACCATGAGAACTGTCGCTGG + Intergenic
982297152 4:153840957-153840979 CAAGGCAAGAAAAATGTGGCTGG - Intergenic
984695244 4:182772333-182772355 CAGGGCAGGAAAACAGTGACAGG - Intronic
986349875 5:6867419-6867441 CAGGGCATGAATACAGGAGCAGG + Intergenic
995485592 5:112637016-112637038 CAGGGCATAAAAACAGACACTGG - Intergenic
996285582 5:121787414-121787436 CAGAGCATGGAAATTGTAGCTGG + Intergenic
996680484 5:126224513-126224535 CAGGACATTAAAACAGTTGCAGG + Intergenic
997758363 5:136421571-136421593 CAGGGCATGACATCTGTTGGTGG - Intergenic
1000101892 5:158024271-158024293 CAGAGCTTGAAGACTGTCTCAGG - Intergenic
1002671339 5:180870211-180870233 GAGGGTAAGAAAACTGTCCCAGG + Intergenic
1003057992 6:2840741-2840763 CAGGGCAAGAACACTTTCCCAGG + Intronic
1005142128 6:22644426-22644448 CAGGTCATTAAAACTGTAGGTGG + Intergenic
1013449594 6:110266565-110266587 GTGGTCATGAGAACTGTCGCAGG - Intronic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1019156464 6:170042252-170042274 CAGGGGCTGAAAACTGGCCCAGG - Intergenic
1022814856 7:33904704-33904726 CAGGGCATGAAAAGTTGCGGGGG + Intergenic
1025590379 7:62852167-62852189 CAGAGCATGAAATCTGTCTTTGG + Intergenic
1025597825 7:62953131-62953153 CAGGGAATTAAAACTTTCGTTGG + Intergenic
1033399056 7:141004509-141004531 CAGAGAAAGAAAACTGTGGCTGG + Intergenic
1035700426 8:1634533-1634555 CAGAGCATGAGAACTGGCCCAGG - Intronic
1037577156 8:20218183-20218205 CAAGCCATGAAAGCTGTCGTTGG + Exonic
1052451915 9:28641357-28641379 CAGTGCATAAAAACTGTCGGAGG - Intronic
1053100937 9:35371862-35371884 AAGGGCATGAAAACTTTCAGAGG - Intronic