ID: 1167906176

View in Genome Browser
Species Human (GRCh38)
Location 19:52662622-52662644
Sequence GTGGCTTTTTCTATACGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167906176_1167906180 3 Left 1167906176 19:52662622-52662644 CCATCTCGTATAGAAAAAGCCAC No data
Right 1167906180 19:52662648-52662670 CTATTTGGCCAATCATTTCAGGG No data
1167906176_1167906181 4 Left 1167906176 19:52662622-52662644 CCATCTCGTATAGAAAAAGCCAC No data
Right 1167906181 19:52662649-52662671 TATTTGGCCAATCATTTCAGGGG No data
1167906176_1167906179 2 Left 1167906176 19:52662622-52662644 CCATCTCGTATAGAAAAAGCCAC No data
Right 1167906179 19:52662647-52662669 ACTATTTGGCCAATCATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167906176 Original CRISPR GTGGCTTTTTCTATACGAGA TGG (reversed) Intronic