ID: 1167908288

View in Genome Browser
Species Human (GRCh38)
Location 19:52680443-52680465
Sequence GACTCCTCCATGATGTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 145}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167908288 Original CRISPR GACTCCTCCATGATGTTTTG TGG (reversed) Intronic
900004797 1:37828-37850 GACTCTTCGTTGATATTTTGTGG + Intergenic
901655224 1:10765431-10765453 AAATCCTCCATGATGTGTTGTGG + Intronic
901786996 1:11631262-11631284 CACTCTTCCATGAGGTTTTAAGG - Intergenic
903445523 1:23420166-23420188 GACTCATCCATGTTGTCTCGTGG + Intronic
904846894 1:33426568-33426590 AACTCATCCACCATGTTTTGAGG - Intronic
907752553 1:57276881-57276903 GACTTCTCCATAATCTTCTGTGG + Intronic
908434576 1:64092483-64092505 GACACCTCCATGAATCTTTGAGG - Intronic
909802837 1:79834520-79834542 GACTGCTGCATAATGTTCTGTGG + Intergenic
912960420 1:114191062-114191084 GTCTTCTCCATGAGGTTGTGGGG + Intergenic
917759428 1:178140620-178140642 GTTTCCTCCATGACTTTTTGTGG + Intronic
917810906 1:178657696-178657718 GACACATCCATGGTGTTGTGTGG - Intergenic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
919110776 1:193216552-193216574 CCCTCCTCCTTGATTTTTTGGGG - Intronic
920412927 1:205776105-205776127 GACTCCTTCTTGATTTGTTGTGG + Intergenic
922700163 1:227754566-227754588 GGTTCCTCCTTGATTTTTTGAGG + Intronic
924591549 1:245409098-245409120 TATTCCTCAGTGATGTTTTGGGG - Intronic
924842872 1:247732782-247732804 GATTCATCCATGTTGTTGTGTGG - Intergenic
924922910 1:248649641-248649663 GGCTACTCCATGATTTTTAGTGG + Intergenic
1062820051 10:528082-528104 GACTGCTCCATGAGGTATTCAGG - Intronic
1065741361 10:28799983-28800005 GATTCCTCCAAGATCTTTTGAGG + Intergenic
1068813042 10:61278016-61278038 GACTCTTCTATGATGCTATGAGG + Intergenic
1070344686 10:75530514-75530536 GACTCATCCCTGATGTTTCCTGG + Intronic
1071309745 10:84331219-84331241 CACTACTCCATGGTGCTTTGGGG + Intronic
1075950693 10:126475218-126475240 GTCTCATTCAAGATGTTTTGTGG - Intronic
1076445443 10:130510828-130510850 GCCTCCTCCATCATGTTCTAGGG + Intergenic
1077201689 11:1310555-1310577 GTCTCCCCCGTGATGTTTTTTGG + Intergenic
1078813177 11:14792290-14792312 GACTCTTCCTTGATGTTTTCTGG + Intronic
1078923005 11:15848451-15848473 CACTCCTCCATGCTATTATGTGG - Intergenic
1083922761 11:65789355-65789377 GGCTCCTCCAGGATGTGTGGCGG + Intronic
1087234737 11:95705539-95705561 AGCTCTTTCATGATGTTTTGAGG - Intergenic
1091378208 12:39879-39901 GACTCTTCGGTGATATTTTGTGG + Intergenic
1092820388 12:12348395-12348417 GATTCCTCCATGTCTTTTTGTGG - Intronic
1092851035 12:12626927-12626949 GGCTCCTCCATGACTTTTCGTGG - Intronic
1095700190 12:45183744-45183766 GACTCTTCCATTATGCCTTGGGG + Intergenic
1102583056 12:113904035-113904057 GACTCCTACATTCTGTCTTGGGG + Intronic
1102762841 12:115403980-115404002 AACTCTTACATGGTGTTTTGAGG - Intergenic
1103872870 12:124103325-124103347 GGATCCTGCAGGATGTTTTGTGG + Intronic
1104391266 12:128392415-128392437 TGCTCCTCCATGACGTTCTGGGG - Intronic
1104678526 12:130732195-130732217 GCCTCATCCATGGTGTTGTGGGG - Intergenic
1106830776 13:33580235-33580257 GGTTCCTCCATGATTTTTTGTGG - Intergenic
1107815232 13:44238834-44238856 AACTGGTCCATGATGGTTTGGGG - Intergenic
1108706676 13:52994920-52994942 GACTCCAGCCTGATGCTTTGGGG - Intergenic
1109110618 13:58314482-58314504 GACACCCCCAGGATGTTTGGTGG + Intergenic
1109216372 13:59594266-59594288 GAATCCTCCCTGATTTTATGAGG + Intergenic
1109775722 13:67038975-67038997 CTCTCCTCCCTGGTGTTTTGAGG - Intronic
1110379097 13:74829040-74829062 TACTACTTCATGATGTTTGGTGG - Intergenic
1111161592 13:84401663-84401685 GACCTCTCCATGATCTTTTATGG - Intergenic
1111824527 13:93251052-93251074 GTTTCCTCCATACTGTTTTGTGG - Intronic
1111908597 13:94284339-94284361 AACTCCTCCAATATTTTTTGAGG - Intronic
1114320307 14:21541677-21541699 GTTTCCTACATGCTGTTTTGTGG + Intergenic
1115140278 14:30162942-30162964 GAATCCTCCATACAGTTTTGAGG - Intronic
1117140315 14:52784537-52784559 GCCTTCTCCAGGATGTGTTGGGG + Exonic
1117153758 14:52916391-52916413 GTTTCCTCCATGTTTTTTTGTGG - Intronic
1118281264 14:64430893-64430915 CACTCCTCCTCGCTGTTTTGAGG + Intronic
1118389676 14:65285563-65285585 GGCACCTCCATGAAGTTTTTAGG - Intergenic
1118946080 14:70388606-70388628 TACTCCTCCATGATTTTCTCAGG - Exonic
1121300992 14:92870819-92870841 GTCTCCTTCATGTTGTTTCGTGG - Intergenic
1121301191 14:92872600-92872622 GTCTCCTTCATGTTGTTTCGTGG - Intergenic
1121301324 14:92873750-92873772 GTCTCCTTCATGTTGTTTCGTGG - Intergenic
1121773255 14:96571671-96571693 GACTCCTGAGTAATGTTTTGAGG - Intergenic
1125135240 15:36333502-36333524 GGCATCTCCATGAAGTTTTGTGG - Intergenic
1126380327 15:48039952-48039974 GACAAGTCCATGATTTTTTGGGG + Intergenic
1127702557 15:61515081-61515103 GACTCCTCCTTGGTGTTTAGAGG - Intergenic
1130865137 15:87927062-87927084 GACTCCTCTTTGATATTTTCTGG + Intronic
1130865614 15:87930877-87930899 GACTCCCCCATGCTGTCTTCAGG + Intronic
1131101717 15:89696280-89696302 GATTCATCCATGTTGTTGTGTGG + Intronic
1131738188 15:95357063-95357085 AACACCTCGATGATGTTTTTAGG + Intergenic
1132448713 15:101953116-101953138 GACTCTTCGTTGATATTTTGTGG - Intergenic
1132895591 16:2227995-2228017 GACTCCTCCATGCTAATTTGGGG - Intronic
1135896360 16:26408195-26408217 GTTTTCTCCATGATATTTTGTGG - Intergenic
1137651183 16:50121966-50121988 TCCCCCTCCAGGATGTTTTGTGG - Intergenic
1140867745 16:79078731-79078753 GACTCAACCATGATGATTTCTGG + Intronic
1141479501 16:84296951-84296973 GACTCCTCCATGCTCTTCTCTGG + Intronic
1141883507 16:86875410-86875432 GACTCAGCAATGATGTTTTGTGG + Intergenic
1143813389 17:9490911-9490933 GCCGCCTTCATGATGTTGTGTGG + Intronic
1149011645 17:51863114-51863136 AACTTCTCGATGAGGTTTTGGGG + Intronic
1149825785 17:59826790-59826812 GAAGACTCCAAGATGTTTTGAGG + Intronic
1152501413 17:80712470-80712492 GACTCCTCCGTGTCTTTTTGTGG + Intronic
1159183585 18:64942787-64942809 TACTCCTCCATGAAGTTAAGGGG + Intergenic
1160636549 19:79437-79459 GACTCTTCGTTGATATTTTGTGG + Intergenic
1162532175 19:11242289-11242311 GACTCTCCCATGATGTTCTCTGG + Intronic
1163609505 19:18293557-18293579 GGCTCCTCTCTGATGTTTTCAGG - Intergenic
1164565551 19:29323622-29323644 GGCTCCCCCAGGATGTTTGGGGG + Intergenic
1165558579 19:36658055-36658077 AACTCCTCCTTGATGTTTAAGGG - Intronic
1167908288 19:52680443-52680465 GACTCCTCCATGATGTTTTGTGG - Intronic
1167919940 19:52774722-52774744 CAATCCTCCATAATGTTTTGTGG - Intronic
926681540 2:15667571-15667593 AACTGCTCCGTGATGTTTTCTGG + Intergenic
928504125 2:31931058-31931080 GTCTCATTTATGATGTTTTGAGG - Intronic
930035720 2:47083941-47083963 CACTCCTACATGATTTTCTGGGG - Intronic
934847246 2:97669754-97669776 GGCTTCTCCATGATGGTTTATGG + Intergenic
935313403 2:101807395-101807417 CACTCCTGTATGATGATTTGAGG + Intronic
936564931 2:113575603-113575625 GACTCTTCGGTGATATTTTGTGG - Intergenic
941161472 2:162040399-162040421 GATTCCTCCATGTCTTTTTGTGG - Intronic
943593131 2:189822385-189822407 GCCTTCTCCAGGATGTGTTGGGG - Intronic
945718977 2:213394739-213394761 GAGTCATCCAAGATGTTGTGTGG + Intronic
1170503394 20:16998386-16998408 CATTCCTCCACCATGTTTTGGGG - Intergenic
1171166848 20:22979594-22979616 GACACCTTCATGACATTTTGGGG - Intergenic
1175929934 20:62489086-62489108 GACAGCTGCAGGATGTTTTGTGG + Intergenic
1178308462 21:31509842-31509864 GACTCATCCCTGAAGTTCTGCGG - Intronic
1179074888 21:38111625-38111647 GGCTCCTCCATGTCTTTTTGTGG + Intronic
1180170024 21:46053271-46053293 GATTCCTCCTTGCTGCTTTGCGG + Intergenic
1182375573 22:29845151-29845173 GGCACATACATGATGTTTTGAGG + Intergenic
1184760259 22:46539640-46539662 GACTCCACCATAACGTTTAGAGG + Intergenic
951457102 3:22904831-22904853 AACACCCCCATCATGTTTTGTGG + Intergenic
953880210 3:46687496-46687518 GAGTCCTCCAGGATGAGTTGTGG + Intronic
956035428 3:65085493-65085515 GATTCCTTCATGGTTTTTTGTGG + Intergenic
958763438 3:98335848-98335870 GACTCCTCCAAAATTTTATGAGG - Intergenic
959498748 3:107080983-107081005 AACTCATCCATTATGTTCTGAGG + Intergenic
959858764 3:111192624-111192646 GAACCCCCCATGATGTTCTGTGG - Intronic
960035734 3:113101502-113101524 GCCTCCTCCATGTCTTTTTGTGG + Intergenic
961520604 3:127465491-127465513 GCCTGGTCCATGCTGTTTTGAGG + Intergenic
962425001 3:135261923-135261945 GACTCCACCATTGTGTTTTCTGG - Intergenic
963017637 3:140840940-140840962 AATTCCTCCATGATTTTTAGTGG + Intergenic
963388635 3:144629329-144629351 GATTTCTCCATGGTATTTTGTGG + Intergenic
963572225 3:147012691-147012713 TACTTCTTCATGTTGTTTTGAGG - Intergenic
964505394 3:157393358-157393380 AACTTCTTCATGATGTTGTGAGG + Intronic
968693609 4:2009222-2009244 GGCGCCGCCATGATGTTTTACGG - Exonic
968745933 4:2360071-2360093 GAGGCCTCCATGATGTCTAGGGG + Intronic
968861819 4:3177953-3177975 GACACCTCCACTGTGTTTTGGGG + Intronic
974189698 4:58488826-58488848 AACTCCTTCATGCTGGTTTGGGG + Intergenic
982550692 4:156795321-156795343 AAATCCTCCATGATTTTATGAGG - Intronic
982922509 4:161293322-161293344 GATTCCTCCATGACTTTTTGTGG + Intergenic
984523933 4:180833759-180833781 GGTTCCTCCATGATTTTTTATGG + Intergenic
989406055 5:41062285-41062307 GATTCATCCATGTTGTTCTGTGG - Intronic
990919866 5:60950986-60951008 GTTTCCTCCATGTTTTTTTGTGG + Intronic
991629381 5:68639783-68639805 GTCTCCTCCATGTTATTTTGTGG + Intergenic
992350950 5:75928674-75928696 GACTCCATCACGAAGTTTTGAGG - Intergenic
1000569296 5:162892135-162892157 GATTCATCCATGATATTTTGAGG + Intergenic
1001146464 5:169188770-169188792 GACCTCTCCATGTTGTTGTGAGG - Intronic
1003417426 6:5924098-5924120 GACTCCAGCAGTATGTTTTGAGG + Intergenic
1003828309 6:9976521-9976543 AACTCAACCATGGTGTTTTGAGG - Intronic
1008771506 6:54984251-54984273 GGCTCCTCCATGTTGTTCTGTGG - Intergenic
1011278075 6:85649267-85649289 GATTCCTCCATGTCTTTTTGTGG - Intergenic
1013005013 6:106064466-106064488 GACTCAAACCTGATGTTTTGAGG + Intergenic
1015160298 6:130145376-130145398 TACTCCTCCCAGATGTTTTTGGG - Exonic
1018813276 6:167313144-167313166 GCCTCCTCCATTCTGTTTTGTGG + Intronic
1019840193 7:3434371-3434393 GTGTCCTCCCTGTTGTTTTGAGG + Intronic
1023540949 7:41265232-41265254 AACTCCTCCATGTTTTTGTGTGG + Intergenic
1024774684 7:52769888-52769910 GACTCATCCATGTTGTTTCAAGG - Intergenic
1027608210 7:80326766-80326788 GACTCCTCCCTAACATTTTGAGG + Intergenic
1028530352 7:91831781-91831803 CACTCCTGGATGATGTTGTGGGG - Intronic
1029853987 7:103494780-103494802 GAGTCCTCCTTAATTTTTTGAGG + Intronic
1038118460 8:24584417-24584439 GACTCCAACATTATATTTTGAGG + Intergenic
1043133176 8:76487686-76487708 GCCACCACCTTGATGTTTTGGGG - Intergenic
1043306029 8:78797093-78797115 GCATCCCCCATGATTTTTTGTGG - Intronic
1045108244 8:98914686-98914708 GGCTCCACCATCCTGTTTTGAGG - Intronic
1045796433 8:106050548-106050570 GACTCCTCCCAGATGGTTTGGGG + Intergenic
1048023649 8:130564158-130564180 GCTTCCTTCATGATGTTCTGAGG - Intergenic
1049073593 8:140376217-140376239 TACTACTTCATGAAGTTTTGAGG - Intronic
1049887491 9:37610-37632 GACTCTTCGTTGATATTTTGTGG + Intergenic
1050659641 9:7869304-7869326 GAATCATCCAGGATGTTTTGTGG - Intronic
1052332908 9:27288696-27288718 GATTCCTCCATGTTTTCTTGTGG - Intronic
1052340003 9:27355455-27355477 GACTCCTTCATCATCCTTTGAGG + Intronic
1055611013 9:78024292-78024314 CACTCCTCTTTGCTGTTTTGTGG - Intronic
1061096822 9:128462563-128462585 TACTCTTCTATGATGTTTTTAGG - Intronic
1187437420 X:19285401-19285423 GATTCCCCCATGATGTTCTTAGG + Intergenic
1188701871 X:33274810-33274832 GCCTCCTCCAGGAAGATTTGAGG + Intronic
1190083603 X:47376089-47376111 GGTTCCTCCATGTTTTTTTGTGG + Intronic
1197033818 X:121851069-121851091 GTTTCCTCCATGTTTTTTTGTGG + Intergenic
1199051327 X:143240135-143240157 GACTCCTCCATGATGATTGTGGG + Intergenic
1199146415 X:144374134-144374156 CACATCTCTATGATGTTTTGAGG - Intergenic
1202016383 Y:20411048-20411070 CACTCCTCAATGCTCTTTTGAGG - Intergenic