ID: 1167911561

View in Genome Browser
Species Human (GRCh38)
Location 19:52707676-52707698
Sequence GGCACCATGGCACTCCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28004
Summary {0: 1, 1: 3, 2: 102, 3: 2336, 4: 25562}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167911561_1167911564 8 Left 1167911561 19:52707676-52707698 CCAGCTTGGAGTGCCATGGTGCC 0: 1
1: 3
2: 102
3: 2336
4: 25562
Right 1167911564 19:52707707-52707729 TCACTGCAGCCTCTGCCTCCTGG 0: 3353
1: 55709
2: 114269
3: 163455
4: 120431
1167911561_1167911565 9 Left 1167911561 19:52707676-52707698 CCAGCTTGGAGTGCCATGGTGCC 0: 1
1: 3
2: 102
3: 2336
4: 25562
Right 1167911565 19:52707708-52707730 CACTGCAGCCTCTGCCTCCTGGG 0: 2096
1: 34981
2: 115298
3: 189871
4: 214728

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167911561 Original CRISPR GGCACCATGGCACTCCAAGC TGG (reversed) Intronic
Too many off-targets to display for this crispr