ID: 1167915291

View in Genome Browser
Species Human (GRCh38)
Location 19:52735175-52735197
Sequence GAGACGCGCAGATCCCGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 57}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167915291_1167915297 18 Left 1167915291 19:52735175-52735197 CCGGGGCGGGATCTGCGCGTCTC 0: 1
1: 0
2: 2
3: 8
4: 57
Right 1167915297 19:52735216-52735238 TCTCTGTTTTCAGGTTTTGGAGG 0: 1
1: 1
2: 4
3: 83
4: 871
1167915291_1167915296 15 Left 1167915291 19:52735175-52735197 CCGGGGCGGGATCTGCGCGTCTC 0: 1
1: 0
2: 2
3: 8
4: 57
Right 1167915296 19:52735213-52735235 GCGTCTCTGTTTTCAGGTTTTGG 0: 1
1: 0
2: 1
3: 10
4: 151
1167915291_1167915293 9 Left 1167915291 19:52735175-52735197 CCGGGGCGGGATCTGCGCGTCTC 0: 1
1: 0
2: 2
3: 8
4: 57
Right 1167915293 19:52735207-52735229 CTCCCAGCGTCTCTGTTTTCAGG 0: 1
1: 0
2: 3
3: 29
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167915291 Original CRISPR GAGACGCGCAGATCCCGCCC CGG (reversed) Intergenic
901236534 1:7670288-7670310 GAGACGCTCAGAGACTGCCCTGG - Intronic
907246905 1:53114540-53114562 GAGAGGGGCAGACCCCGTCCAGG + Intronic
913186428 1:116373772-116373794 GGGGCGCGCAGCCCCCGCCCAGG - Intronic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
1065090585 10:22229224-22229246 GGGACGCGCAGAGGCCGCGCGGG - Intergenic
1067089052 10:43257423-43257445 GAGGAGCACAGGTCCCGCCCAGG + Intronic
1067749313 10:48959749-48959771 GAGACGTGCAGCTCCCTCCCTGG + Exonic
1077224515 11:1434336-1434358 CAGACACGCAGAGCCGGCCCAGG - Intronic
1094041459 12:26124858-26124880 GAGACGCACAGATCCCCCCAAGG - Exonic
1103740098 12:123085256-123085278 GAGAAGCCCAGGTCCTGCCCAGG - Intronic
1104761361 12:131299114-131299136 TGGACGCGCGGAGCCCGCCCTGG - Intergenic
1104818414 12:131661678-131661700 TGGACGCGCGGAGCCCGCCCTGG + Intergenic
1106036715 13:26050984-26051006 GAGACGCGCTGTCCGCGCCCAGG - Exonic
1106250055 13:27976319-27976341 GAGATGCACAGATCCCACCAGGG - Intergenic
1122937917 14:104968378-104968400 GGGACGAGCAGATCCTGGCCGGG + Intronic
1139546585 16:67652715-67652737 GATCCGCCCAGGTCCCGCCCCGG - Intronic
1146062506 17:29614544-29614566 GAGAAGCACAGACCCCGCCAGGG + Exonic
1147969667 17:44212597-44212619 GAGAGGCGGGGATCCCGCCTGGG + Intronic
1160870201 19:1274484-1274506 GAAACGCCCAGGTGCCGCCCGGG - Intronic
1161495045 19:4581830-4581852 GAGCCGCGCAAAACCCGGCCCGG + Intergenic
1162914240 19:13865630-13865652 GAGACGCAGAGATGCCGCCGGGG - Intronic
1167884902 19:52492673-52492695 GTGATGCACAGGTCCCGCCCCGG + Intronic
1167889342 19:52527501-52527523 AAGACGCGCAAGTCCCGCCCCGG + Intergenic
1167890464 19:52535856-52535878 GGGATGCACAGGTCCCGCCCCGG + Intronic
1167894473 19:52570131-52570153 GAGACGCACAGGTCCCGCCCCGG + Intronic
1167903390 19:52638486-52638508 GAGACTCACAGGTCCCGCCCTGG - Intronic
1167909563 19:52690620-52690642 GAGACACACAGGTCCCGCCCCGG - Intergenic
1167915291 19:52735175-52735197 GAGACGCGCAGATCCCGCCCCGG - Intergenic
1167921591 19:52786888-52786910 GAGAAGCACAGGTCCCGCCCCGG - Intronic
1167926077 19:52821767-52821789 GAGACTCACAGGTCCCGCTCCGG - Intronic
1167930261 19:52857753-52857775 GAGATGCACAGGTCCCGCTCCGG - Intergenic
1167940568 19:52942729-52942751 GAGACGCACAGGTCCCGCCCCGG - Intronic
1167987802 19:53333593-53333615 GAGACGCACGGGTCCCACCCCGG + Intergenic
1168419487 19:56191874-56191896 GAGAGCAGCAGATCCTGCCCAGG - Exonic
1168423931 19:56223655-56223677 GAGAGCTGCAGATCCTGCCCAGG - Exonic
925261282 2:2530571-2530593 AAGACGCTCAGGTCCCTCCCAGG - Intergenic
934843330 2:97645512-97645534 GAGGCGCGGAGGTCCCGGCCTGG - Intergenic
948427379 2:237896386-237896408 GAGGCGCCCAGATTCCTCCCCGG + Intronic
1175108126 20:56628767-56628789 GAGACGCCCAGTTCCCTCCGTGG - Intergenic
1175374362 20:58514483-58514505 GAGGCGCGCAGGTGCCGGCCAGG + Intronic
1175399529 20:58692728-58692750 GAGACGTGCAGGGCCCGCCCGGG - Exonic
1176014968 20:62926316-62926338 GAGAGCCGCGGATCCCGCACAGG - Intronic
1176108059 20:63398911-63398933 TAGCCGAGCAGTTCCCGCCCAGG + Intergenic
1180069484 21:45429227-45429249 GAGACTCTCAGATCCCTCCAGGG - Intronic
1181381603 22:22508826-22508848 GAGCCGCGCCGATCTCGCGCCGG - Exonic
950487549 3:13282272-13282294 GGGCCGCGCGGATCCCGCCCTGG - Intergenic
968450456 4:673869-673891 AAGCCGAGCAGACCCCGCCCCGG + Intronic
973888414 4:55346189-55346211 GGGACGCGCAGAGCCCCTCCCGG - Exonic
985559248 5:574204-574226 GAAACGCCCAGATCCTGGCCAGG + Intergenic
995462519 5:112419150-112419172 GAGACGAGCAGCTCCCGGCGGGG + Exonic
1023558444 7:41447557-41447579 GAGAGGCGCTCATTCCGCCCAGG - Intergenic
1023944167 7:44790276-44790298 GAGACCCGCACATTCCACCCAGG - Intergenic
1032391236 7:131556596-131556618 CAGCCGCGCAGACGCCGCCCAGG - Exonic
1033407833 7:141088009-141088031 GAGATGCCCAGATGCAGCCCTGG + Intronic
1049373761 8:142279641-142279663 GAGACAGGCAGAACCCTCCCTGG + Intronic
1056532240 9:87497972-87497994 GGGGGGCGCAGATCCCTCCCAGG - Exonic
1056964029 9:91151282-91151304 GAGACGAGAAGTTCCTGCCCTGG - Intergenic
1059486187 9:114628669-114628691 GTGACGGGCAGATGCCGACCTGG + Intronic
1060812675 9:126618921-126618943 GAGACGCGGGGTTCCGGCCCGGG + Intronic
1200686857 Y:6265729-6265751 TGGACCCGCAGATCCCGCACTGG + Intergenic
1200989734 Y:9336645-9336667 TGGACCCGCAGATCCCGCACTGG + Intergenic
1200992402 Y:9356978-9357000 TGGACCCGCAGATCCCGCACTGG + Intergenic
1200995054 Y:9377256-9377278 TGGACCCGCAGATCCCGCACTGG + Intronic
1200997719 Y:9397602-9397624 TGGACCCGCAGATCCCGCACTGG + Intergenic
1201000229 Y:9466136-9466158 TGGACCCGCAGATCCCGCACTGG + Intergenic
1201002890 Y:9486448-9486470 TGGACCCGCAGATCCCGCACTGG + Intronic
1201005546 Y:9506731-9506753 TGGACCCGCAGATCCCGCACTGG + Intergenic
1201008209 Y:9527061-9527083 TGGACCCGCAGATCCCGCACTGG + Intergenic