ID: 1167916407

View in Genome Browser
Species Human (GRCh38)
Location 19:52743502-52743524
Sequence ATGTATGTCAGGGAGCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 865
Summary {0: 3, 1: 2, 2: 17, 3: 327, 4: 516}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167916407_1167916410 0 Left 1167916407 19:52743502-52743524 CCACTCTGCTCCCTGACATACAT 0: 3
1: 2
2: 17
3: 327
4: 516
Right 1167916410 19:52743525-52743547 GCTTATCTGAGTGCCTCCTTTGG No data
1167916407_1167916413 28 Left 1167916407 19:52743502-52743524 CCACTCTGCTCCCTGACATACAT 0: 3
1: 2
2: 17
3: 327
4: 516
Right 1167916413 19:52743553-52743575 CTAATCAGAAACTCAAAAGAAGG 0: 11
1: 15
2: 12
3: 39
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167916407 Original CRISPR ATGTATGTCAGGGAGCAGAG TGG (reversed) Intergenic
900693151 1:3993871-3993893 ATGTATGTAGGGCAGGAGAGTGG + Intergenic
900999066 1:6138549-6138571 ATGCCTGTGAGAGAGCAGAGAGG + Intronic
902622572 1:17659080-17659102 CAGTGTGTCAGGGAGTAGAGAGG + Intronic
902641463 1:17768883-17768905 AATTGTGTCAGGAAGCAGAGCGG + Intronic
902662588 1:17915463-17915485 ATCTATCTCAGTGAGCAGAGAGG - Intergenic
902943500 1:19816812-19816834 ATTTGTCTCAGTGAGCAGAGAGG - Intergenic
902969928 1:20040791-20040813 ATTTATCTCAGTGAGCAGATGGG - Intronic
903117526 1:21190506-21190528 ATTTATTTCAGTGAGCAGAGGGG - Intergenic
903499198 1:23792352-23792374 CTGTAGGGCAGGGGGCAGAGGGG - Intronic
904870543 1:33615095-33615117 ATATATTTCAGGGGGCAGGGTGG + Intronic
905059827 1:35130439-35130461 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
905271943 1:36793044-36793066 ATGTATGTCCTGGAGACGAGAGG + Intergenic
905378960 1:37546153-37546175 GTGTATGGCAGGGAGCGGGGGGG - Intronic
906072291 1:43025844-43025866 ATGTATGTGAAGGCACAGAGTGG - Intergenic
906521462 1:46469324-46469346 ATGTAAAGCAGGTAGCAGAGTGG + Intergenic
906559417 1:46745071-46745093 AAGGATGTCAGGGCCCAGAGTGG + Intergenic
908880153 1:68722929-68722951 ACTTATCTCAGTGAGCAGAGGGG - Intergenic
909050016 1:70755130-70755152 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
909576338 1:77180813-77180835 ATTTATCTCAGCGAGCAGAGGGG + Intronic
910535644 1:88294589-88294611 AAGCATGTCAAGGGGCAGAGCGG - Intergenic
910652766 1:89587819-89587841 AAGTAAGTCAGGCAGCAGTGAGG + Intronic
911296616 1:96125224-96125246 TTGTATCTCAGGGAGTAGAGAGG - Intergenic
911317245 1:96370178-96370200 ATTTATCTCAGTGAGTAGAGGGG + Intergenic
911683897 1:100750757-100750779 ATAGATCTCAGGAAGCAGAGAGG - Intergenic
911910547 1:103628765-103628787 ATCCATCTCAGTGAGCAGAGGGG + Intergenic
911917963 1:103722890-103722912 ATCCATCTCAGTGAGCAGAGGGG + Intronic
912074516 1:105855750-105855772 ATTTATTTCAGTGAGCAGAGGGG - Intergenic
912468402 1:109889884-109889906 ATGTATGGCAGGCAGCACTGAGG + Intergenic
912661412 1:111534381-111534403 AGGAATGTCAGGGAGAGGAGAGG + Intronic
912731188 1:112107007-112107029 TTGTATGTCAGGAAACAGGGAGG + Intergenic
912861652 1:113219008-113219030 ATTTATCTCAGTGAGCATAGGGG - Intergenic
913024479 1:114823273-114823295 ATTTATCTCAGTGAGCAAAGAGG - Intergenic
913304578 1:117413826-117413848 ATAAATATCAGGGAGCAGATGGG - Intronic
913471695 1:119194090-119194112 AGGTATTTCAGGGGGCAGATGGG + Intergenic
913487782 1:119349237-119349259 ATCTATCTCTGTGAGCAGAGGGG + Intergenic
915046454 1:153021381-153021403 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
915103932 1:153520610-153520632 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
915511106 1:156387610-156387632 ATTTCAGTCAGGGAGCACAGAGG + Intergenic
915745840 1:158157008-158157030 ATCTATCTTAGTGAGCAGAGGGG - Intergenic
915983133 1:160435288-160435310 ATTTATCTCAGTGAGAAGAGGGG + Intergenic
916077886 1:161213251-161213273 ATGTCAGTCAGTAAGCAGAGAGG - Intronic
916260093 1:162833332-162833354 ATCTATCTCAGTGAGCAGAGGGG - Intronic
917099363 1:171430134-171430156 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
917119363 1:171632244-171632266 ATTTATCTCGGTGAGCAGAGGGG - Intergenic
917310696 1:173674724-173674746 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
917312601 1:173692456-173692478 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
917314633 1:173711518-173711540 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
918315022 1:183316320-183316342 ATTTATGTCAGGGAGGAGTTGGG - Intronic
918540924 1:185632208-185632230 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
919363811 1:196631377-196631399 CAGTATGTCTGGGAGTAGAGAGG + Intergenic
919739599 1:200973851-200973873 ATGGGTGCCAGGGAGCAGAAGGG - Exonic
919775008 1:201188856-201188878 ATGTATGACACAGCGCAGAGAGG + Intergenic
920193587 1:204211540-204211562 ATTTAGGTCAGGGAAGAGAGTGG - Intronic
920834106 1:209491994-209492016 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
921343689 1:214159775-214159797 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
921366516 1:214379641-214379663 ATTTATCTCAGTGAGCAGAGGGG - Intronic
921398721 1:214696318-214696340 TTGGATGTCAGGGAATAGAGAGG - Intergenic
922057486 1:222055255-222055277 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
922214452 1:223509140-223509162 AGGTGAGACAGGGAGCAGAGAGG - Intergenic
922813689 1:228433810-228433832 ATTTATCTCAGGGAGCAGAGGGG - Intergenic
922820071 1:228478581-228478603 ATCTATTTCAGTGAGCAGACGGG + Intergenic
923245458 1:232126845-232126867 ATTTACCTCAGTGAGCAGAGGGG + Intergenic
923334742 1:232958412-232958434 CTGAATGTCAAGGAGCAGAGAGG - Intronic
924522130 1:244814617-244814639 ATCTATCTCAGTGAGCAGAGGGG + Intergenic
924929193 1:248712489-248712511 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1063139933 10:3247112-3247134 ATGTCTTTCAGTGAGGAGAGGGG - Intergenic
1064994574 10:21285333-21285355 ATCTATCTCAGTCAGCAGAGGGG - Intergenic
1065402725 10:25324359-25324381 TTGTGTGTCAGGGAATAGAGAGG + Intronic
1065490904 10:26280549-26280571 ATTTATCTCAGTGAGCAGAGGGG + Intronic
1065810828 10:29441737-29441759 ATTTATGTCAGTGAGCAGAGGGG + Intergenic
1065858100 10:29847026-29847048 GTTTATCTCAGTGAGCAGAGGGG + Intergenic
1066164142 10:32767367-32767389 ATATATTTCAGGGAGCCAAGTGG + Intronic
1066217355 10:33300656-33300678 ATTTATCTCTGTGAGCAGAGGGG - Intronic
1066242429 10:33551347-33551369 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1066365013 10:34768532-34768554 ATTTATCTCTGTGAGCAGAGGGG + Intronic
1067119082 10:43458453-43458475 ATTTATCTTAGTGAGCAGAGGGG + Intronic
1067801457 10:49362015-49362037 ATGACTGTGAGAGAGCAGAGAGG + Intergenic
1068380545 10:56248377-56248399 ATTTATCTCAGTGAGCAGAGAGG + Intergenic
1070251134 10:74773980-74774002 ATTTATCTCAGTGAGCAGAAGGG + Intergenic
1070252386 10:74784371-74784393 ATTTCTCTCAGTGAGCAGAGGGG + Intergenic
1070581246 10:77721452-77721474 ATTCATCTCAGTGAGCAGAGGGG + Intergenic
1070936028 10:80295909-80295931 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1071871833 10:89804005-89804027 ATGTATCTCAGGGAATAGGGAGG + Intergenic
1072489724 10:95892710-95892732 ATTTATCTCAGTGAGTAGAGGGG + Intronic
1073868790 10:107836978-107837000 ATTTATCTCAGTGAGGAGAGGGG + Intergenic
1074649765 10:115507207-115507229 ATTTATCTTAGTGAGCAGAGGGG + Intronic
1075243822 10:120802231-120802253 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1076393403 10:130120671-130120693 ATTTATTTCATTGAGCAGAGGGG - Intergenic
1076536470 10:131181108-131181130 ACGTAGATCAGGGAGCAGCGCGG - Intronic
1077534050 11:3110666-3110688 ATTTATCTCAGTGAGCAGAGGGG - Intronic
1077534730 11:3118271-3118293 ATTTATCTCAGTGAGCAGAGGGG - Intronic
1077859437 11:6161875-6161897 ATTTATCTCAGTAAGCAGAGGGG + Intergenic
1078222755 11:9365097-9365119 ATTTATGTTAGTGAGCAGAGGGG - Intergenic
1079317747 11:19423716-19423738 AGCTACTTCAGGGAGCAGAGAGG + Intronic
1080765591 11:35293920-35293942 ATGTATGTCAAGGCTCAGAGCGG + Intronic
1081182369 11:39999755-39999777 ATTTATCTTAGTGAGCAGAGGGG - Intergenic
1081238669 11:40677858-40677880 CTGTATTTCAGGAAGCAGATTGG - Intronic
1081587917 11:44399968-44399990 AGCTATGCCAGGGAGAAGAGAGG - Intergenic
1081797863 11:45834167-45834189 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1082949158 11:58791705-58791727 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1082949661 11:58799104-58799126 ATTTATCTCAGTGAGCAGAGTGG + Intergenic
1082950580 11:58810866-58810888 ATTTATCTCAGTGACCAGAGGGG - Intergenic
1083055653 11:59816601-59816623 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1084248846 11:67880184-67880206 ATTTATCTCAGTGAGCAAAGGGG - Intergenic
1084352464 11:68612235-68612257 ATGTAAGTAAGTGAGCAGAGTGG + Intronic
1084823972 11:71715292-71715314 ATTTATCTCAGTGAGCAAAGGGG + Intergenic
1084947633 11:72647216-72647238 ATGCATGTCAGGCAGCAGACAGG - Intronic
1085240489 11:75050051-75050073 ATCCATGTCAGTGAGCAGAGGGG - Intergenic
1085360554 11:75881487-75881509 ATCTATCTCAGTGAGCAGAGGGG + Intronic
1085573884 11:77585266-77585288 TTTTATCTCAGTGAGCAGAGGGG - Intronic
1086127988 11:83369430-83369452 ATTTATTTTAGTGAGCAGAGGGG + Intergenic
1086154914 11:83655064-83655086 ATGGATGTGTGGGAGCACAGAGG - Intronic
1086350202 11:85936514-85936536 ATTTATCTCAGTGAGTAGAGGGG + Intergenic
1087013112 11:93531831-93531853 ATTTATCTCAGGGAGCAGAGGGG - Intronic
1087047715 11:93857137-93857159 ATTTATCTCAGTAAGCAGAGGGG + Intergenic
1087047881 11:93858866-93858888 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1087048068 11:93860869-93860891 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1087050198 11:93879114-93879136 ATTTATCTCAGTGAGCAGAAGGG + Intergenic
1087665711 11:101045027-101045049 TTGTATCTCAGGGAACAGGGAGG + Intronic
1087993138 11:104770621-104770643 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1088190150 11:107219625-107219647 ATTTGTCTCAGTGAGCAGAGAGG - Intergenic
1088618618 11:111659521-111659543 ATGTGTCTCAAGAAGCAGAGAGG - Intronic
1089076142 11:115740383-115740405 ATGGATGTCAGGAAGTAGAAGGG + Intergenic
1089647301 11:119888792-119888814 AAGAATGCCAAGGAGCAGAGAGG + Intergenic
1089741931 11:120590471-120590493 CTGGATGTCAGGGTGCAGGGAGG - Intronic
1089991429 11:122864876-122864898 AAGTATGTCAAGAAGCCGAGAGG - Intronic
1090096071 11:123742646-123742668 ATTTATCTCAGTGAGCAGAGAGG + Intergenic
1090212140 11:124928630-124928652 ATTTATCTCAGTGAGCAGAGGGG - Intronic
1090379863 11:126318916-126318938 AGCTTTGGCAGGGAGCAGAGAGG + Intronic
1090462332 11:126902692-126902714 AAGTATGTTAGGAAGCAGACAGG + Intronic
1090864798 11:130690176-130690198 ATGTATGTCTTGGGGCAGTGAGG + Intronic
1092419126 12:8315597-8315619 ATTTATCTCAGTGAGCAAAGGGG - Intergenic
1092830523 12:12440255-12440277 GTGTATGTGAGGGAGAAGAACGG + Intronic
1093971342 12:25378652-25378674 ATCTATCTCAGTGAGCAAAGGGG - Intergenic
1094037289 12:26084752-26084774 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1094071009 12:26412743-26412765 AGGTAAGGCAGGGAGCAAAGGGG + Intronic
1095209624 12:39477097-39477119 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1095541353 12:43311952-43311974 ATTTATCTCAGTGAACAGAGGGG - Intergenic
1095823783 12:46509794-46509816 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1095856708 12:46867591-46867613 ATTCATCTCAGTGAGCAGAGGGG + Intergenic
1096831536 12:54318265-54318287 ATTTATGTTAGGGAGAAAAGAGG - Intronic
1096835936 12:54351409-54351431 ATGCATGTCGGGGAGCTGAGGGG - Intronic
1097164028 12:57072584-57072606 ATCTACTTGAGGGAGCAGAGAGG + Intronic
1097252086 12:57640783-57640805 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1097758465 12:63433861-63433883 TTGTATCTCAGGGAATAGAGAGG - Intergenic
1097794750 12:63849546-63849568 TTGTATGTCAGGCTGCAGAGTGG - Intronic
1098171273 12:67749639-67749661 ATGTAAGTCAGTGGGCTGAGTGG + Intergenic
1098403996 12:70104694-70104716 ATTTATCTCAGTGAGCAAAGAGG + Intergenic
1099157052 12:79191004-79191026 ATGTGAGTCTTGGAGCAGAGAGG + Intronic
1100077924 12:90810081-90810103 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1100079837 12:90835258-90835280 ATTTATCTCAGTGAGCGGAGGGG - Intergenic
1100549009 12:95629225-95629247 ATTTATCTCAGTGAACAGAGGGG + Intergenic
1101489602 12:105198860-105198882 AAGTATTTCTGTGAGCAGAGAGG - Intronic
1102161281 12:110771048-110771070 GTTTATCTCAGTGAGCAGAGGGG - Intergenic
1102433678 12:112903411-112903433 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1102441623 12:112967999-112968021 GTGTATGCCTGGGAGCAGGGCGG + Exonic
1102540165 12:113613099-113613121 CTGTTTTTCAGGGAGAAGAGTGG - Intergenic
1103111755 12:118286033-118286055 ATTTACCTCAGTGAGCAGAGGGG + Intronic
1103211716 12:119171947-119171969 ATCTCAGTCAGTGAGCAGAGGGG + Intergenic
1103228057 12:119304977-119304999 ATTTATTTCAGTGAGCAGAAGGG + Intergenic
1103610427 12:122120825-122120847 CTGTCTGTCAGGGAGTAGGGAGG + Intronic
1103877791 12:124142054-124142076 ATCTATCTCAGTGAGCAGACGGG + Intronic
1104030240 12:125059831-125059853 ATTTATCTCAGTGAGCAGCGGGG + Intergenic
1104180337 12:126373583-126373605 ATCTATCTCAGTGAGCAGAGGGG + Intergenic
1104187972 12:126450536-126450558 ATCTATCTCTGTGAGCAGAGGGG + Intergenic
1104298235 12:127538652-127538674 ATTTATCTCAGTAAGCAGAGGGG - Intergenic
1104321597 12:127756626-127756648 ATTTATCTCAGTGAGCAGATGGG - Intergenic
1104453703 12:128892137-128892159 ATTTATCTCAGTGAGCAGAGGGG + Intronic
1104538825 12:129643670-129643692 ATTTATCTCAGTGAGCAGAGGGG - Intronic
1104844189 12:131838641-131838663 AGGTCTGGCAGGGAGCAGCGTGG - Exonic
1104973141 12:132540474-132540496 AGGTGTGCCAGGGACCAGAGTGG - Intronic
1105744728 13:23366648-23366670 GTGTACTTTAGGGAGCAGAGAGG + Intronic
1106331270 13:28741735-28741757 ATGAATGACAGTGGGCAGAGGGG + Intergenic
1106439243 13:29750911-29750933 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1106542081 13:30699120-30699142 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1106570274 13:30920871-30920893 AAGGTTGTGAGGGAGCAGAGAGG + Intronic
1106670968 13:31904725-31904747 ATGTATATCTGGGGGCATAGAGG - Intergenic
1107879846 13:44823333-44823355 ATCTATGTCAGCGAGCAGAGGGG + Intergenic
1108083147 13:46757979-46758001 ATGTATTTCAGGGAGAAGGAAGG + Intergenic
1108379554 13:49843010-49843032 ATTCATCTCAGTGAGCAGAGGGG - Intergenic
1108432866 13:50371815-50371837 ATGTGTGGCATGGAGTAGAGTGG + Intronic
1109142115 13:58726906-58726928 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1109300979 13:60589939-60589961 ATTTGTCTCAGTGAGCAGAGGGG - Intergenic
1109828479 13:67754936-67754958 ATCTATTTCAGTGAACAGAGGGG + Intergenic
1109901705 13:68781175-68781197 ATGTATTTGCGGAAGCAGAGTGG - Intergenic
1110212137 13:72986298-72986320 ATGAATGTCAGAAAGCAGAGTGG + Intronic
1110333364 13:74298280-74298302 TTGTGTGTCAGGGAGAAGAAAGG + Intergenic
1110425641 13:75363428-75363450 ATCTATCTCAGTGAGCAGAGGGG - Intronic
1110551786 13:76818886-76818908 ATGAATGACAGGGAAGAGAGAGG + Intergenic
1110921282 13:81089228-81089250 ATTTATGTCAGTGGGCAGAGGGG + Intergenic
1111135524 13:84037403-84037425 ATCTATGTCAGTGGGCAGAGGGG + Intergenic
1111280337 13:86014550-86014572 ATTTATTTCAGTGAGCAGAGGGG + Intergenic
1111484073 13:88872068-88872090 GTTTATCTCAGTGAGCAGAGGGG + Intergenic
1111648938 13:91065757-91065779 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1111654935 13:91140509-91140531 ATTTACCTCAGTGAGCAGAGGGG - Intergenic
1112013110 13:95308477-95308499 ATCTATCTCTGTGAGCAGAGGGG - Intergenic
1112447256 13:99475573-99475595 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1113478429 13:110602341-110602363 ATTTATCTCAGTCAGCAGAGGGG - Intergenic
1114052737 14:18935256-18935278 ATCTATCTCAGTGAGCAGAGGGG - Intergenic
1114053216 14:18941371-18941393 ATCTATCTCAGGGAGCAGAGGGG - Intergenic
1114109342 14:19460555-19460577 ATCTATCTCAGGGAGCAGAGGGG + Intergenic
1114109821 14:19466670-19466692 ATCTATCTCAGTGAGCAGAGGGG + Intergenic
1114147546 14:19994672-19994694 ATTTATTTCAGTGAGCAGAGGGG - Intergenic
1114504565 14:23199394-23199416 ATCTATCTCAGTGAGCACAGGGG + Intronic
1114509999 14:23250939-23250961 ATGTATCTCAGTGAGCAGAAGGG + Intronic
1115697595 14:35917090-35917112 ATGTAAGTGAGAAAGCAGAGAGG - Intronic
1117187421 14:53254675-53254697 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1117188067 14:53261935-53261957 AATTATCTCAGTGAGCAGAGGGG + Intergenic
1117388197 14:55237625-55237647 ATTTATCACAGGGAGCAGAGGGG + Intergenic
1117419306 14:55528475-55528497 ATTTATGTCAGTGAGCACAGGGG - Intergenic
1118110507 14:62712956-62712978 ATGGAAGGCAGGGAGCAGGGAGG + Intronic
1118510394 14:66465617-66465639 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1118510866 14:66471687-66471709 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1118597074 14:67443968-67443990 ACTTATCTCAGTGAGCAGAGGGG - Intergenic
1118790895 14:69091764-69091786 ATGGATGTCATAGAGCACAGGGG + Exonic
1118898950 14:69970711-69970733 AAGCAAGTCAGGGAGCAAAGGGG - Intronic
1118938912 14:70314595-70314617 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1119090342 14:71774990-71775012 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1119247767 14:73127678-73127700 ATCCATGTCAGTGAGCAGCGGGG - Intergenic
1119400505 14:74359213-74359235 ATGTATGTCAGGGGGTTTAGAGG + Exonic
1119615000 14:76093095-76093117 AGCTAGGTCAGGAAGCAGAGGGG + Intergenic
1119903877 14:78284195-78284217 ATCTATCTCAGCGAGCAGAGGGG - Intronic
1120084490 14:80254653-80254675 TTGTGTCTCAGGGAACAGAGAGG - Intronic
1120169943 14:81238079-81238101 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1120344414 14:83266704-83266726 TTCTATGTCAGGGAGGAGGGTGG + Intergenic
1120409527 14:84134799-84134821 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1120466229 14:84861023-84861045 ATCTATCTCAGTGAGCAGAATGG + Intergenic
1120523159 14:85547982-85548004 ATTTATCTCAGTGAGCAGAGTGG + Intronic
1120593764 14:86408076-86408098 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1120966449 14:90171767-90171789 ATCTATCTCAGTGAGCAGAGGGG + Intronic
1121119702 14:91368967-91368989 ATGAATGTCAGGGAGGAAGGAGG - Intronic
1121967588 14:98324920-98324942 ATCTATGTCATTGGGCAGAGGGG - Intergenic
1122809752 14:104282075-104282097 ATGGATGACAGGGACAAGAGAGG - Intergenic
1124103253 15:26714637-26714659 ATTTATCTCAGTGAGAAGAGGGG + Intronic
1125115886 15:36091217-36091239 ATATATCTCCGGGAGTAGAGGGG + Intergenic
1125679380 15:41521252-41521274 AAGTAGTTAAGGGAGCAGAGAGG - Intronic
1126202721 15:46005949-46005971 ATGTAAGGCAGGGGGCACAGAGG - Intergenic
1126707169 15:51416342-51416364 ATCTGTCTCAGTGAGCAGAGGGG + Intergenic
1126708332 15:51428595-51428617 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1126708403 15:51429129-51429151 ATCTATCTCACTGAGCAGAGGGG - Intergenic
1127862543 15:63006458-63006480 AGGTGTCTAAGGGAGCAGAGAGG + Intergenic
1127972295 15:63971151-63971173 ATTTATTTCAGGGAGCAGGGGGG - Intronic
1127981564 15:64038884-64038906 ATTTATCTCAGTGAGCAGAGGGG - Intronic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1129004447 15:72360427-72360449 ATTTTTGTCAGCGAGGAGAGGGG - Intronic
1129859770 15:78851457-78851479 ATGTATGGCCTGGAGCAGCGGGG - Intronic
1129941955 15:79505748-79505770 ATGAATGTCAGGTAGGGGAGAGG - Intergenic
1130010445 15:80149065-80149087 CTGTATTTCTGGGAGCAGAGTGG + Intergenic
1130074293 15:80675426-80675448 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1130247682 15:82267389-82267411 ATTTATCTCAGTGAGCAGAGTGG + Intronic
1130452462 15:84070121-84070143 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1130664822 15:85860858-85860880 GTGCATGTCAGGGGGCTGAGGGG + Intergenic
1131374271 15:91910733-91910755 ATGTGTATCAGGTGGCAGAGAGG - Intronic
1131432818 15:92400412-92400434 ATGTACTTTTGGGAGCAGAGAGG - Intronic
1133091445 16:3407308-3407330 ATGTGTGTCAGGGGACAGGGGGG + Intronic
1133358596 16:5155630-5155652 ATTTATCTCAGTGAGCAAAGGGG - Intergenic
1133414345 16:5594685-5594707 ATTTATGTCATTGAGCAGAGAGG + Intergenic
1133560333 16:6944716-6944738 ATGTATGTCAAGGGGCAGAAAGG - Intronic
1133820885 16:9235540-9235562 ATTTATCTCAGTGAGCAAAGGGG + Intergenic
1134785924 16:16943108-16943130 ATTTATCTCAGTGAGTAGAGGGG + Intergenic
1135265022 16:21017388-21017410 ATTCATCTCAGTGAGCAGAGGGG - Intronic
1135676098 16:24416256-24416278 ATGCTTGGCAGGGAGCAGGGTGG + Intergenic
1135831316 16:25776328-25776350 ATTTATCTCAGTGAGCAGAGGGG - Intronic
1136045362 16:27610814-27610836 ATTTATCTCAGTGAGCAGAGAGG - Intronic
1137063842 16:35815806-35815828 ATCTATCTCAGCGAGCAGAGGGG + Intergenic
1138531132 16:57635012-57635034 CTGGATGGGAGGGAGCAGAGGGG + Intronic
1139119545 16:63998796-63998818 ATTTATCTCAGTGGGCAGAGGGG - Intergenic
1140116505 16:72046242-72046264 ATTTATCTCAGTGAGCAGAGGGG + Intronic
1140396193 16:74628640-74628662 ATGTATGACAGGGAGACCAGTGG + Exonic
1140419973 16:74811363-74811385 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1140459654 16:75129486-75129508 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1140874829 16:79141114-79141136 ATTTATCTCAGTGAACAGAGGGG - Intronic
1141009941 16:80387857-80387879 TTGTATGTCAGCGTGCAGTGGGG + Intergenic
1141429032 16:83961448-83961470 ATCTATCTCAGGGAGCAGAGGGG + Intronic
1141878719 16:86844145-86844167 ATATATTTCATGGAGAAGAGCGG + Intergenic
1141899273 16:86979820-86979842 ATTTATGTCAGTGAGAAAAGGGG + Intergenic
1203141053 16_KI270728v1_random:1766200-1766222 ATCTATGTCAATGAGCAGAGAGG + Intergenic
1142885215 17:2908436-2908458 ATGCATGGCAGGGAACAGAGTGG + Intronic
1143095212 17:4475245-4475267 ATCTAAGTCAGGGTGCAGGGAGG + Intronic
1144615337 17:16766261-16766283 ATTTATCTTAGTGAGCAGAGAGG + Intronic
1144897365 17:18549401-18549423 ATTTATCTTAGTGAGCAGAGAGG - Intergenic
1145135007 17:20396320-20396342 ATTTATCTTAGTGAGCAGAGAGG + Intergenic
1145170386 17:20651462-20651484 AGGTAAGTCAGGTAGCAAAGGGG - Intergenic
1146322915 17:31860408-31860430 ATGTAGATTAGGGAGCAAAGAGG - Intergenic
1146468733 17:33107826-33107848 AGGAATGTCAGGAAGCAGGGAGG - Intronic
1147512923 17:41087552-41087574 ATTTATCTCAGTGAGCAGAGGGG - Intronic
1147513601 17:41095420-41095442 ATTTATCTCTGTGAGCAGAGGGG - Intronic
1147514981 17:41107590-41107612 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1147515705 17:41115710-41115732 ATTTAACTCAGTGAGCAGAGGGG - Intergenic
1148457801 17:47820309-47820331 ATGTAGAGCAGGGAGCAGGGTGG + Exonic
1150004078 17:61458934-61458956 AGGCCTGCCAGGGAGCAGAGAGG - Intronic
1150554806 17:66244780-66244802 ATCTATCTCAGTGAGCAGAGGGG - Intronic
1151119809 17:71780104-71780126 TTGTATTTCAGGGAGTAGAGAGG - Intergenic
1151136384 17:71949835-71949857 ATTTAGCTCAGTGAGCAGAGGGG - Intergenic
1151242556 17:72769513-72769535 ATCTATCTCAGTGAGCAGAGGGG - Intronic
1151533607 17:74724373-74724395 ATCTATCTCAGTGAGCAGATGGG + Intronic
1152022253 17:77786309-77786331 ATGTATCTCAGAGAGCAAAGGGG + Intergenic
1152095808 17:78270956-78270978 ATGAATGTGAGGAAGCTGAGTGG + Intergenic
1152636751 17:81433317-81433339 GTGTATGGCAGAGAGCAGACAGG + Intronic
1153150917 18:2092038-2092060 ATAGATCTCAGTGAGCAGAGGGG - Intergenic
1153404776 18:4724972-4724994 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1153473612 18:5472913-5472935 ATGCTTGTAAGGGACCAGAGAGG - Intronic
1153949863 18:10049370-10049392 GTGTGTGTCAGACAGCAGAGAGG + Intergenic
1153977991 18:10286393-10286415 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1154253281 18:12762307-12762329 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1155586383 18:27370883-27370905 ATTGATCTCAGGGAGCAGAGGGG - Intergenic
1155857987 18:30858858-30858880 ATGTATGTGAAGAAGCAAAGGGG + Intergenic
1157717299 18:49896791-49896813 AGGGATGTCAGGGAGTTGAGTGG + Intronic
1157947941 18:52002209-52002231 ATTTATCTCAATGAGCAGAGGGG - Intergenic
1158693214 18:59680270-59680292 ACTTATCTCAGGGAGCAGAGGGG + Intronic
1158907462 18:62027623-62027645 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1159097612 18:63921987-63922009 ATAAATGTCTGGGAGCAAAGAGG - Intronic
1159711481 18:71765481-71765503 ATCTATCTCAGTGAGCAGAGGGG - Intronic
1159918426 18:74205702-74205724 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1160375374 18:78407509-78407531 ATGGAAGTTAGGAAGCAGAGTGG + Intergenic
1160654494 19:256980-257002 ATTTATCTCAGTGAGCAGATGGG - Intergenic
1161901075 19:7120094-7120116 AGGTATCTCAGTGAGCAGAGTGG - Intronic
1162395880 19:10417868-10417890 AGGTAGGAGAGGGAGCAGAGTGG + Intronic
1162786334 19:13037190-13037212 CTGTGTGTCAGGGAGAAGAGGGG + Intronic
1163250509 19:16123992-16124014 ACCTATTTCAGGGAGCTGAGGGG - Intronic
1164392922 19:27841279-27841301 ATGTATCTCTGTGAGCAGAGGGG - Intergenic
1164960670 19:32426575-32426597 TTGTGTCTCAGGGAGCAGAGAGG + Intronic
1165387532 19:35519623-35519645 ATGTCTGGCAAGGAGCAGAAGGG - Intergenic
1165511292 19:36268157-36268179 ATGGATGTCAGGGAGCCAAAGGG + Intergenic
1165595957 19:37011472-37011494 ATGAATGTCAGGGAGCCAAAGGG + Intronic
1166515646 19:43444799-43444821 ATTTATCTCAGTGAGCAGAGCGG + Intergenic
1167524543 19:49975483-49975505 ATCTATCTCAGTGAGCAGAGGGG - Intergenic
1167886024 19:52500730-52500752 ATGTATGTCAGGGAGCAGAGGGG + Intronic
1167888052 19:52518111-52518133 ATGTATGTCAGGGAGCAGAGCGG + Intergenic
1167916407 19:52743502-52743524 ATGTATGTCAGGGAGCAGAGTGG - Intergenic
1167920545 19:52779690-52779712 ATCTATGTCAGGGAGCAGAGGGG - Intronic
1167922374 19:52792369-52792391 ATCTATGTCAGGGAGCAGAGGGG - Intronic
1167927636 19:52834421-52834443 ATCTATATCAGGGAGCAGAGGGG - Intronic
924973207 2:150322-150344 AACTATCTCAGTGAGCAGAGGGG - Intergenic
925144788 2:1574005-1574027 AAGTATTTCTGGGAGCAGAAAGG + Intergenic
925173335 2:1766218-1766240 ATGTATCTCAGTGAGCAGAGGGG + Intergenic
925656813 2:6158039-6158061 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
925907370 2:8547508-8547530 ATGTATGTGAGGGGGCGGTGTGG - Intergenic
925930420 2:8702895-8702917 ATTTATTCCAGTGAGCAGAGAGG + Intergenic
926819477 2:16836928-16836950 TTGGAGATCAGGGAGCAGAGAGG - Intergenic
927189419 2:20506840-20506862 ATGTAGGGCAGGGCACAGAGTGG + Intergenic
927505820 2:23614041-23614063 ATCTATCTCAGTGAGCAGAGTGG - Intronic
927673034 2:25084855-25084877 ATTTATCTCAGTGAGCAGAGAGG + Intronic
927755324 2:25703942-25703964 TTGTATGTCAGGGAATAGGGAGG - Intergenic
927860876 2:26559201-26559223 CTGAATCTCAGGAAGCAGAGAGG + Intergenic
928347409 2:30513706-30513728 ATTTATCTCAGTTAGCAGAGGGG - Intronic
928428394 2:31198140-31198162 ATCTATCTCAGTGAGCAGAGGGG - Intronic
928834629 2:35529302-35529324 CTTTATCTCAGTGAGCAGAGGGG + Intergenic
928858102 2:35824329-35824351 ATTTATCTCAGTGAACAGAGGGG + Intergenic
929226242 2:39514351-39514373 ATGGATGTCAGGGAGAGGTGAGG + Intergenic
929534731 2:42773916-42773938 ATTTATCTCAGTGAGCAGAGGGG - Intronic
929535657 2:42782670-42782692 ATTTATGCCAGTGAGCAGAGGGG - Intronic
929895672 2:45958620-45958642 ATATATGGCAGGGAGCATAGGGG - Intronic
930414612 2:51075885-51075907 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
930494683 2:52126408-52126430 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
930495107 2:52131494-52131516 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
930510583 2:52338982-52339004 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
931668376 2:64625946-64625968 ATGTATGCCAGTGAGCATGGGGG + Intergenic
932353466 2:71049941-71049963 AGGTGTTTGAGGGAGCAGAGGGG - Intergenic
932597915 2:73105727-73105749 ATCCATGTCAAGGAGAAGAGAGG + Intronic
932619993 2:73259598-73259620 ATGAATGGCAAGGAACAGAGTGG + Intronic
932641712 2:73454357-73454379 ATGTATGACAGAGAGTAAAGAGG + Intronic
932948871 2:76269815-76269837 ATGTCTGCCAGAGGGCAGAGGGG + Intergenic
933052552 2:77617841-77617863 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
933196845 2:79400205-79400227 ATTTATCTCAGTGAGCAGAGGGG + Intronic
933228045 2:79773551-79773573 ATCTATCTCAGTAAGCAGAGGGG + Intronic
933718305 2:85378626-85378648 ATTTATCTCAGTGAGCAGAGGGG + Intronic
933718909 2:85384144-85384166 GTTTATCTCAGTGAGCAGAGGGG + Intronic
933727043 2:85433047-85433069 ATGCACGGCAGGGAGCAGAAAGG - Intronic
934108401 2:88717556-88717578 ATTTATCGCAGTGAGCAGAGGGG + Intronic
934108941 2:88724012-88724034 ATTTATCACAGTGAGCAGAGGGG + Intronic
934547321 2:95228882-95228904 ATCTATCTCAGTGAGCAGAGGGG - Intronic
934619703 2:95796693-95796715 CTGTATGGCTGGGAACAGAGAGG - Intergenic
934619823 2:95797268-95797290 CTGTATGGCTCGGAGCAGAGAGG - Intergenic
934641065 2:96027289-96027311 CTGTATGGCTCGGAGCAGAGAGG + Intronic
934641185 2:96027864-96027886 CTGTATGGCTGGGAACAGAGAGG + Intronic
935024933 2:99267931-99267953 ATTTATCTCAGTGAGCAGAGGGG - Intronic
935152757 2:100452800-100452822 ATTTATCTCAGTGAACAGAGTGG - Intergenic
935153363 2:100460234-100460256 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
936370846 2:111901024-111901046 ATGTGTGTTGGGGGGCAGAGGGG - Intronic
936477157 2:112849213-112849235 ATTTATCACAGTGAGCAGAGGGG - Intergenic
936572168 2:113626382-113626404 ACCTATCTCAGTGAGCAGAGGGG - Intergenic
936940124 2:117876109-117876131 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
937614820 2:123909085-123909107 ATTTATGTAAGGGAAAAGAGAGG - Intergenic
938065039 2:128277303-128277325 ATGGATGTCAGGGTGCTGTGGGG - Intronic
938471193 2:131563904-131563926 TTCTATCTCAGGGAGCAGAGGGG - Intergenic
939155006 2:138514376-138514398 ATTTAGCTCAGTGAGCAGAGGGG + Intronic
939286562 2:140138518-140138540 ATTTATCTCAGTGAGCAGGGTGG + Intergenic
939339629 2:140877603-140877625 ATTGATCTCAGTGAGCAGAGGGG - Intronic
940081493 2:149807882-149807904 ATCTATCTCAGTGAGCAGAGGGG + Intergenic
940158565 2:150685886-150685908 ATGTAAGTCAGATAGCAGTGAGG - Intergenic
940639311 2:156330780-156330802 CTGTATTTCAGGGAGGAGATTGG - Exonic
940988341 2:160072461-160072483 ATTTATCTCAGTGAGCAGAGCGG + Intergenic
941540145 2:166771970-166771992 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
942193813 2:173497646-173497668 ATGTACTTCAGGGAGTAGAGAGG - Intergenic
942534130 2:176945571-176945593 TTGTGTCTCAGGGAACAGAGAGG - Intergenic
943034493 2:182725243-182725265 TTGTATCTCAGGGAGTAGGGAGG - Intronic
943253975 2:185569188-185569210 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
943256462 2:185599578-185599600 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
943557707 2:189426322-189426344 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
943598108 2:189881314-189881336 ATTTATTTCAGTGAGCAGACGGG - Intronic
943616558 2:190099348-190099370 TTGTATCTCAGGGATCAGGGAGG + Intronic
943676180 2:190718273-190718295 ATCTATCTCAGTGAGCAGAGGGG - Intergenic
943680778 2:190765519-190765541 ATGTATGCCAAGGAGTGGAGAGG - Intergenic
944250568 2:197576968-197576990 ATTTATCTCAGTGAGCAGAGGGG - Intronic
944303742 2:198156055-198156077 ATCTATCTCAGTGAGCAGAGGGG - Intronic
944512169 2:200475562-200475584 ATTTATCTCAGTGAGCAGAGGGG + Intronic
944726790 2:202479530-202479552 ATGCATGTGTGGGAGCAGAGGGG - Intronic
944869068 2:203891885-203891907 AGGTAGGTCAAGGAGCAGAGAGG - Intergenic
945759040 2:213888718-213888740 TTGTATGTCAGGTAACTGAGTGG + Intronic
945869655 2:215213438-215213460 ATTTATCTCAGTAAGCAGAGGGG - Intergenic
946701230 2:222416304-222416326 ATTTATCTCAGTCAGCAGAGGGG - Intergenic
947295488 2:228626186-228626208 ATTTATCTCAGTGAGCAGAGAGG + Intergenic
947772797 2:232684310-232684332 ATGGTTGTCAGCGAGGAGAGAGG + Intergenic
947928075 2:233938700-233938722 ATTTATCTCGGTGAGCAGAGGGG + Intronic
948809258 2:240466526-240466548 ATGTATTTCAGGGACCTCAGGGG + Exonic
948955389 2:241286380-241286402 ATTTATCTCAGTGAACAGAGGGG - Intronic
949028853 2:241778938-241778960 ATTTATCTCAGTGAGCAGAGGGG + Intronic
949029658 2:241786959-241786981 ATTTGTCTCAGTGAGCAGAGGGG - Intronic
949030289 2:241792859-241792881 ATTTATCTCAGTGAGCAGAGGGG - Intronic
949060794 2:241956017-241956039 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1168797784 20:622998-623020 ATGTATGTGGGGAAGCAGAGTGG + Intergenic
1169452918 20:5727492-5727514 ATGTTTCTCAGGTAGTAGAGAGG + Intergenic
1169998610 20:11588047-11588069 ATATATGTCAGGGATCATACTGG - Intergenic
1170683841 20:18550930-18550952 AAGTATGTCAGGAAGAAAAGGGG + Intronic
1171544574 20:25990451-25990473 ACGGATGTCAGGGAGCCGAGGGG + Intergenic
1171774072 20:29349578-29349600 AAGAAAGTCAGGGGGCAGAGAGG + Intergenic
1171816073 20:29787132-29787154 AAGAAAGTCAGGGGGCAGAGAGG + Intergenic
1172639044 20:36430071-36430093 CTGTCTGCCATGGAGCAGAGAGG - Intronic
1172832185 20:37845429-37845451 ATGTTTGTCAGGGAACAGCACGG - Intronic
1174053220 20:47781581-47781603 ACAGATGTCATGGAGCAGAGGGG - Intronic
1174150093 20:48480214-48480236 AAGGTTGTCAGGGAGCAGATAGG - Intergenic
1174319987 20:49734103-49734125 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1175646102 20:60673159-60673181 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1176294735 21:5065426-5065448 CTGTCTGTCAGGGAGCAGGTGGG - Intergenic
1176421873 21:6522676-6522698 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1176429756 21:6568359-6568381 ATGCATACCAGGGAGCAGTGGGG - Intergenic
1177281055 21:18983825-18983847 ATTCATCTCAGTGAGCAGAGGGG + Intergenic
1177550191 21:22611010-22611032 ATCTATGTCAGTAAGCAGAGGGG + Intergenic
1177699685 21:24621987-24622009 TTGTGTCTCAGGGAACAGAGAGG - Intergenic
1178357303 21:31919722-31919744 ATGGACGTGCGGGAGCAGAGGGG + Intronic
1178387050 21:32160987-32161009 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1178674153 21:34616455-34616477 ATCTGTCTCAGTGAGCAGAGGGG - Intergenic
1178842806 21:36151451-36151473 ATTTATCTCAGTGAGCAGAGTGG - Intergenic
1178961657 21:37072095-37072117 ATGAGTGTCAGGGAGCACGGTGG - Intronic
1179304133 21:40139520-40139542 ATCTATCTCAGTGAGCAGAGGGG + Intronic
1179466091 21:41574356-41574378 GTGCATGTCGGGGAGGAGAGGGG - Intergenic
1179651598 21:42813038-42813060 ATCTATCTCAGTGAGCAGAGGGG + Intergenic
1179669660 21:42937710-42937732 ATTTACCTCAGTGAGCAGAGGGG - Intergenic
1179697363 21:43130992-43131014 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1179705150 21:43175821-43175843 ATGCATACCAGGGAGCAGTGGGG - Intergenic
1179862316 21:44196700-44196722 CTGTCTGTCAGGGAGCAGGTGGG + Intergenic
1180319526 22:11307696-11307718 AAGAAAGTCAGGGTGCAGAGAGG + Intergenic
1180471211 22:15657630-15657652 ATCTATCTCAGTGAGCAGAGGGG - Intergenic
1180471690 22:15663746-15663768 ATCTATCTCAGGGAGCAGAGGGG - Intergenic
1180732000 22:17989135-17989157 ATGGATGTCAGGGTACAGTGTGG - Intronic
1180743438 22:18070212-18070234 GGGTAAGTCAGGGTGCAGAGTGG + Intergenic
1181076464 22:20381163-20381185 ATTTATCTCAGTGAGCAGAGGGG + Intronic
1181117790 22:20644262-20644284 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1181516686 22:23418127-23418149 ATGGATGTCAGGGTACAGTGTGG - Intergenic
1182876013 22:33691576-33691598 ATGTATGGATGTGAGCAGAGAGG - Intronic
1183796801 22:40125411-40125433 AAGTATGGCAGTGAGCAAAGCGG - Intronic
1184530586 22:45052718-45052740 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1184851154 22:47121994-47122016 GTGCATGTCAGCGAGCTGAGGGG - Intronic
1184917256 22:47578433-47578455 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1185405377 22:50645212-50645234 ATCTATCTCAGTGAGCAGACGGG - Intergenic
1185428024 22:50784498-50784520 ACCTATCTCAGTGAGCAGAGGGG + Intergenic
949836659 3:8277608-8277630 ATTTATCTCAGTGAGCAGAAGGG - Intergenic
949842873 3:8339244-8339266 AAGTATTTTAAGGAGCAGAGAGG - Intergenic
950599903 3:14024641-14024663 ATTTATCTCAGTGAGCAGAGGGG + Intronic
950600752 3:14033291-14033313 ATTTATCTCAGTGAGCAGAGGGG + Intronic
950657697 3:14447360-14447382 ATGGATGGCAGGGGGCAGGGGGG - Intronic
951297784 3:20960507-20960529 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
951558838 3:23945975-23945997 ATGTGGGTCAGGGAGCCGAGCGG - Intronic
952462820 3:33547315-33547337 ATGGATGTCAGCAGGCAGAGAGG - Intronic
952809921 3:37392588-37392610 AGGTATGTCAGGGAGAGGAAAGG + Intronic
953211868 3:40883001-40883023 TTGTGTCTCAGGGAGTAGAGAGG + Intergenic
953912531 3:46900176-46900198 ATGTATGTCGAGGGGCAGGGAGG - Intronic
954587960 3:51753293-51753315 ATTTATTTCAGTGAGCAGAGAGG + Intergenic
955281585 3:57599282-57599304 GTTTATCTCAGTGAGCAGAGGGG + Intergenic
955534675 3:59910345-59910367 ATTTATCTCAGTGAGCAGAGGGG + Intronic
956657970 3:71570460-71570482 CCGTGTGTCAGGGAGCTGAGTGG - Intronic
956719760 3:72107471-72107493 AGTTGTGACAGGGAGCAGAGGGG - Intergenic
957063111 3:75498335-75498357 ATTTATCTCAGTGAGCAAAGGGG - Intergenic
957842248 3:85686744-85686766 ATTTATTTCGGTGAGCAGAGGGG - Intronic
958953592 3:100442633-100442655 ATTTATCTCAGTGAGCAGAGGGG + Intronic
959745111 3:109767116-109767138 GTGCATGTGTGGGAGCAGAGGGG - Intergenic
959773291 3:110125641-110125663 ATTTATCTCAGTGAGCAGAGTGG - Intergenic
959969795 3:112396776-112396798 AATTATCTCAGTGAGCAGAGGGG - Intergenic
961290289 3:125841242-125841264 ATTTATCTCAGTGAGCAAAGGGG + Intergenic
961346275 3:126265430-126265452 ATCTATCTCAGTGAGCAGAAGGG - Intergenic
962199055 3:133386501-133386523 ATGTGTGACAGGAAGAAGAGGGG - Intronic
962407371 3:135111539-135111561 ATGTATGTGAGAGAGAGGAGGGG + Intronic
963318510 3:143786593-143786615 CTGTATTTCTGGCAGCAGAGAGG - Intronic
964478436 3:157118511-157118533 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
964483890 3:157167553-157167575 ATGTTTGTTAGTGAGCAGACAGG - Intergenic
964535015 3:157711292-157711314 TTGTGTCTCAGGGAGCAGTGAGG - Intergenic
964596957 3:158443891-158443913 TTGTGTCTCAGGGAACAGAGAGG + Intronic
964860855 3:161199362-161199384 ATCTGTGTCAGTGAGCAGAGGGG - Intronic
964941813 3:162167173-162167195 GTGTGTGTGAGTGAGCAGAGGGG - Intergenic
965114090 3:164465574-164465596 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
965217783 3:165885799-165885821 ATTTATCTTAGTGAGCAGAGGGG + Intergenic
965281171 3:166754794-166754816 ATATATGACAAGGAGCATAGAGG - Intergenic
965901382 3:173645278-173645300 ATGTCTGTGAGGGAGGGGAGAGG - Intronic
966227489 3:177613512-177613534 TTGTATGTCTGTGAGCAGATTGG - Intergenic
966465322 3:180225296-180225318 ATGTGGGTTAGGGAGCATAGTGG - Intergenic
967296959 3:187974616-187974638 ATGTAACTCAAGGGGCAGAGAGG + Intergenic
968042891 3:195602667-195602689 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
968043732 3:195611692-195611714 ATCTATCTCAGTAAGCAGAGGGG - Intergenic
968295639 3:197574634-197574656 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
968807227 4:2782280-2782302 ACTTATGTCAGTGAGCAGAGGGG + Intergenic
969006997 4:4028348-4028370 ATTTATCTCAGTGAGCAAAGGGG - Intergenic
969049248 4:4360961-4360983 ATTTATCTCAGTGAGCAGAGGGG - Intronic
969279567 4:6160977-6160999 ATGGAGGTCAGGGAGGTGAGTGG - Intronic
969279637 4:6161282-6161304 GTGGAGGTCAGGGAGCTGAGTGG - Intronic
969357462 4:6638688-6638710 ATCTATCTCAGTGAGCAGATGGG + Intergenic
969465467 4:7353718-7353740 GTGTTTGTCAGGGAGCCCAGGGG + Intronic
969579039 4:8053158-8053180 ACTTATCTCAGTGAGCAGAGGGG - Intronic
969663987 4:8546439-8546461 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
969727045 4:8926180-8926202 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
969727871 4:8934726-8934748 ATTTATCTCAGTGAACAGAGAGG - Intergenic
970376288 4:15460591-15460613 ATGTATGTCAAAGAGCACAAGGG - Intergenic
970756659 4:19435540-19435562 ATGTATGGCAGCAGGCAGAGAGG - Intergenic
970882032 4:20943921-20943943 ATGAATGTCAGAGAGAAGAATGG + Intronic
972734147 4:41823873-41823895 ATTTTTGTCAGGGAGAAGAAAGG + Intergenic
973150486 4:46881435-46881457 ACCTATCTCAGTGAGCAGAGGGG + Intronic
973193569 4:47414489-47414511 ATTTATCTCAGTAAGCAGAGGGG + Intronic
974160913 4:58137706-58137728 GTGTATGTCAGGCATCAGAGTGG - Intergenic
974536152 4:63178518-63178540 ATCTATCTCAGTGGGCAGAGGGG - Intergenic
974789084 4:66662785-66662807 ATCTATCTCAGTGAGCAGAGGGG - Intergenic
974948542 4:68558834-68558856 ATTTATCTCAGTGAGCAGAGGGG - Intronic
974957573 4:68661237-68661259 ATTTATCCCAGTGAGCAGAGGGG - Intronic
975323993 4:73039435-73039457 ATGTATACAAGGGAGTAGAGAGG + Intergenic
976815437 4:89142493-89142515 ATGGGAGTCAGGGAGAAGAGAGG - Intergenic
977863193 4:101991709-101991731 ATGTATATCTGGGGGCAGTGGGG + Intronic
978032021 4:103947068-103947090 CTCTATCTCAGTGAGCAGAGGGG - Intergenic
978032588 4:103953419-103953441 ATCTATCTCAGTGAGCAGAGGGG - Intergenic
978701587 4:111653052-111653074 ATTTATCTCAGTGAGCAGAGTGG + Intergenic
979023986 4:115544385-115544407 ATTTATCTCAGTGAGCAGAGAGG + Intergenic
979667600 4:123329365-123329387 TTGTATGTAAGGGAACAGGGAGG - Intergenic
979803356 4:124939270-124939292 CTTTATGTCATGGAGCAGAGTGG + Intergenic
980072087 4:128254077-128254099 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
980154372 4:129086915-129086937 ATGTGTGTCAGGCAGAAAAGTGG - Intronic
980259736 4:130432986-130433008 ATTCATCTCAGTGAGCAGAGGGG + Intergenic
980270281 4:130575044-130575066 ATTTATCTCAGTGAGCAGAAGGG + Intergenic
980505627 4:133716557-133716579 ATCTATCTCAGTGAGCAGAGGGG + Intergenic
981193688 4:141893176-141893198 ATCTATCTCAGTGAGCAGAGGGG + Intergenic
981241792 4:142485884-142485906 ATGTGTGTAAAGGAGCAAAGGGG - Intronic
981935597 4:150235900-150235922 AGCTGTGTCAGGGAGCACAGGGG + Intronic
982164497 4:152602681-152602703 GTGAACGTCAGGGAGCAGAGGGG + Intergenic
982505618 4:156213710-156213732 ATCTATCTCAGTGAGCAGAGGGG + Intergenic
982509382 4:156262307-156262329 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
982803626 4:159735500-159735522 ATCTATCTCAGTGAGCAGAGGGG + Intergenic
982921941 4:161286921-161286943 AAATATGTCAGGGAGCTAAGTGG - Intergenic
982951617 4:161704112-161704134 ATTTATCTCAGTGAGCAGAGGGG - Intronic
983317716 4:166153290-166153312 ATGTTTGTAGGGGAGAAGAGAGG + Intergenic
983453266 4:167932391-167932413 ATTTATCTCAGTGTGCAGAGAGG - Intergenic
983663237 4:170153671-170153693 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
983705538 4:170654068-170654090 ATTTATCTCAGTGAGCAGAGAGG - Intergenic
984093205 4:175401661-175401683 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
984171005 4:176359112-176359134 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
985227290 4:187775479-187775501 ATCTATCTCATGAAGCAGAGGGG + Intergenic
987040689 5:14059474-14059496 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
987051013 5:14146139-14146161 ATGTCTAGCAGGGGGCAGAGAGG + Intronic
987056708 5:14200199-14200221 ATGGATGGCAGGGAGGGGAGGGG - Intronic
987207815 5:15645315-15645337 ATCTATCTCAGTGAGCAGAGGGG - Intronic
987460151 5:18198950-18198972 ATTGATCTCAGTGAGCAGAGGGG - Intergenic
987474071 5:18369225-18369247 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
987762350 5:22181822-22181844 ATGGATGGCATGGGGCAGAGAGG - Intronic
987858434 5:23451913-23451935 ATTGATCTCAGTGAGCAGAGGGG + Intergenic
988144927 5:27292973-27292995 ATTGATCTCAGTGAGCAGAGGGG + Intergenic
988185714 5:27859053-27859075 ATTTATCTCAGTGGGCAGAGGGG + Intergenic
989458755 5:41671647-41671669 AGGCATGTCAGGAAGCAGTGAGG + Intergenic
989717174 5:44478120-44478142 ATTTATTTCAGTTAGCAGAGGGG - Intergenic
989742050 5:44784914-44784936 ATTTATCTCAGTGACCAGAGAGG - Intergenic
989842732 5:46100444-46100466 ATGAATTTCAGAGAGCAAAGCGG + Intergenic
990120042 5:52440183-52440205 ATGTATACCAGGGAGCCAAGAGG - Intergenic
990706000 5:58530564-58530586 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
990836675 5:60029317-60029339 ATCTATCTCAGTGAGCAGAGGGG - Intronic
990849690 5:60188577-60188599 AGGTAGGGCAGGGAGGAGAGTGG + Intronic
992037245 5:72792276-72792298 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
992177863 5:74168381-74168403 TTGTATTTAAGGGATCAGAGTGG + Intergenic
992292969 5:75299295-75299317 ATTTATCTCAATGAGCAGAGGGG - Intergenic
992446556 5:76839413-76839435 ATTTGTCTCAGTGAGCAGAGGGG - Intergenic
992538129 5:77732874-77732896 TTGTGTCTCAGGGAGTAGAGAGG - Intronic
992605355 5:78450271-78450293 ATGTATGTAAGGGCGCTAAGAGG + Intronic
992895420 5:81240978-81241000 ATGAATGTCAGGAACCTGAGAGG - Intronic
993275974 5:85859281-85859303 ATGTGTCTCAGGGAATAGAGAGG + Intergenic
993689432 5:90981324-90981346 ATTTATCTCAGTGAGCAGAGGGG + Intronic
995075110 5:107973494-107973516 AGGTATGACAGTTAGCAGAGTGG - Intronic
996125181 5:119717997-119718019 ATGAAGGTCAGGGAGCTGGGAGG - Intergenic
996351965 5:122553864-122553886 TTGTATGTCAGGGAATAGGGAGG - Intergenic
997158758 5:131585457-131585479 ATTTATCTCAGTGAGCAGAGGGG - Intronic
997271210 5:132539828-132539850 CTGTATGTCAGGGGTCAGAGGGG + Intergenic
997294941 5:132763294-132763316 ATTTATGTCAGGGAGGAAGGGGG + Intronic
997577288 5:134990437-134990459 ATTTATCTCAGTGAGCAGAGGGG + Intronic
1000465322 5:161568746-161568768 AGGTAGGTCAGGACGCAGAGGGG - Intronic
1000574161 5:162955049-162955071 ATCTATCTCAGTGAGCAGAGGGG + Intergenic
1000821267 5:165987290-165987312 TTGTATCTCAGGGAATAGAGAGG - Intergenic
1001609090 5:172985310-172985332 ATGTATCCCAGGGAGCAAAAGGG - Intronic
1001760936 5:174207564-174207586 ATGTATGTCAGATAGCATAATGG + Intronic
1001856739 5:175018318-175018340 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1002031269 5:176432492-176432514 GTGTATGTCAGTGAGCAGAGGGG + Intergenic
1002071137 5:176679612-176679634 ATGTATGTCTTGAAGCAGAGGGG - Intergenic
1002453663 5:179333233-179333255 GTGTCAGTGAGGGAGCAGAGGGG - Intronic
1002703782 5:181147034-181147056 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1003495696 6:6661348-6661370 CTGTCTGTCTGAGAGCAGAGGGG - Intergenic
1004646027 6:17561451-17561473 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1004646822 6:17570237-17570259 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1005573137 6:27166346-27166368 ATGTATGTAAGGCAGCATAAAGG + Intergenic
1005577111 6:27200204-27200226 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1005595748 6:27377453-27377475 ATCTATCTCAGTGAGCAGAGGGG - Intronic
1005876780 6:30016792-30016814 GTTTATCTCAGTGAGCAGAGGGG + Intergenic
1007095317 6:39209323-39209345 AGGTATGCCAGGAAGCAGACAGG + Intronic
1007306730 6:40912576-40912598 ATCTAAGTCACTGAGCAGAGAGG - Intergenic
1007634845 6:43293157-43293179 AGGTCTGCCAGGGACCAGAGAGG - Intergenic
1007745804 6:44042379-44042401 ATTTCTGGGAGGGAGCAGAGGGG + Intergenic
1008172367 6:48224211-48224233 ATTTATCTCAGAGAGCAGAGGGG - Intergenic
1008651042 6:53563082-53563104 ATTTATCTCAGTGAGCAGAGGGG - Intronic
1009379785 6:63012665-63012687 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1010496117 6:76535452-76535474 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1010564280 6:77390460-77390482 ATTTATCTCAGTGAGCAGAGAGG - Intergenic
1010606975 6:77902667-77902689 ATTTATCTCAGTGAGCAGAGGGG - Intronic
1011134691 6:84087358-84087380 ATTTATCTCAGTGAGCAGAGGGG + Intronic
1011939491 6:92825510-92825532 ATTTATTTCAGTGAGCAGAGGGG - Intergenic
1011940153 6:92832999-92833021 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1012211185 6:96520947-96520969 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1013631939 6:111994199-111994221 ATGGGTGTAAGGGAGCAGTGAGG - Intergenic
1014110157 6:117611963-117611985 ATTTATCTTAGTGAGCAGAGGGG - Intergenic
1014235657 6:118951455-118951477 ATTTATCTCAGTGAGCAGGGGGG - Intergenic
1014866400 6:126535761-126535783 ATCAATGTCATGGAGCAGTGCGG + Intergenic
1014887464 6:126799005-126799027 GTTTATCTCAGTGAGCAGAGGGG + Intergenic
1015236153 6:130973631-130973653 ATTTATCTCAGTGAGCAGAGGGG - Intronic
1015256503 6:131184294-131184316 AGATATGTCGGGGAGCAGGGGGG + Intronic
1015978886 6:138818996-138819018 ATCTTTGTCAGAGAGGAGAGGGG + Intronic
1016048589 6:139506068-139506090 ATCTATATCAGGGAGCAGAGGGG + Intergenic
1016472484 6:144389267-144389289 ATTTATCTCAGCGAGCAGAGGGG + Intronic
1017348260 6:153409418-153409440 ATTTATATCAGTGAGCAGAGGGG + Intergenic
1017386074 6:153885259-153885281 GTTTATCTCAGTGAGCAGAGGGG + Intergenic
1017386263 6:153887844-153887866 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1018138418 6:160802169-160802191 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1018542270 6:164895042-164895064 ATTGATCTCAGGGAGCAGAGGGG - Intergenic
1018713737 6:166515823-166515845 ATTTATCTCAGTGAGCAGAGGGG - Intronic
1018813512 6:167314645-167314667 ATTTCTCTCAGTGAGCAGAGGGG - Intronic
1019030685 6:169008255-169008277 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1019099939 6:169622029-169622051 ATTTATCTCAGTGAGCAGAGGGG - Intronic
1019122940 6:169819272-169819294 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1019123190 6:169821732-169821754 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1019441295 7:1048608-1048630 ATGAATGTCTGTGAGCAGTGAGG - Intronic
1020026736 7:4904903-4904925 GGGCATGACAGGGAGCAGAGGGG + Intergenic
1020327497 7:6986468-6986490 ATTTATCTCAGTGAGCAAAGGGG - Intergenic
1020340937 7:7110354-7110376 ATGCATCTCAGTGAGCAGAGGGG - Intergenic
1020718850 7:11716035-11716057 ATGTCAGTGAGAGAGCAGAGAGG + Intronic
1020756343 7:12208505-12208527 ATGTAAGTCAGGTGGCACAGCGG + Intergenic
1020908555 7:14097991-14098013 CAGGATGTCAGGGAGCTGAGAGG - Intergenic
1020977548 7:15025484-15025506 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1021055990 7:16046858-16046880 ATGGGTGGCAGGGAGCAGACAGG + Intergenic
1021147445 7:17106517-17106539 GTTTATCTCAGTGAGCAGAGGGG - Intergenic
1021802093 7:24317175-24317197 ATCTATCTCAGTGAGCAGAGGGG - Intergenic
1021892006 7:25195155-25195177 ATTCATGTCAGTGAGCAGAGGGG - Intergenic
1022501079 7:30882771-30882793 ATGGATGTCAGGGATGAGGGTGG + Intronic
1022881770 7:34595233-34595255 ATCTACCTCAGTGAGCAGAGGGG - Intergenic
1023200035 7:37687070-37687092 TTCTTTATCAGGGAGCAGAGTGG - Intronic
1023289990 7:38658742-38658764 ATGTATGTCAGGCACTAGACTGG + Intergenic
1023761736 7:43470436-43470458 AAGGATGACAGGGAGCACAGTGG + Intronic
1023868228 7:44249012-44249034 ATGTAGGCCAGGGAGAAGGGAGG - Intronic
1024013426 7:45290366-45290388 ATCTATCTCAGTGAGCAGAGGGG - Intergenic
1024702274 7:51917220-51917242 ACTTATGTCAGCTAGCAGAGGGG - Intergenic
1024719166 7:52115721-52115743 ATTTATCTCAGAGAGCAGGGGGG - Intergenic
1024876809 7:54035213-54035235 ATGGATGTCTGGTAACAGAGAGG - Intergenic
1024938802 7:54740734-54740756 ATATATCTCAGTGAGCAGAGGGG - Intergenic
1025003277 7:55336100-55336122 ATCTGTCTCAGTGAGCAGAGGGG + Intergenic
1025017769 7:55453519-55453541 TTGTGTGTCAGGGAAGAGAGTGG + Intronic
1025112778 7:56233664-56233686 ATTTATCTTAGTGAGCAGAGGGG - Intergenic
1025115945 7:56258203-56258225 ATCTATCTCAGTGAGCAGAGGGG + Intergenic
1025295959 7:57775516-57775538 ACGAATGTCAGGGAACCGAGAGG + Intergenic
1026142537 7:67718517-67718539 ATTGATCTCAGTGAGCAGAGGGG - Intergenic
1026244966 7:68611806-68611828 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1026329229 7:69337441-69337463 ATCTATCTCAGTGAGCAGAGGGG - Intergenic
1026509641 7:71017373-71017395 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1026528782 7:71179177-71179199 ATTTATCTCAATGAGCAGAGGGG - Intronic
1026967546 7:74450028-74450050 TTGGCTCTCAGGGAGCAGAGAGG + Intergenic
1027224025 7:76232883-76232905 ATGAAGGTCTGGGAGCAGGGAGG + Intronic
1027573447 7:79901646-79901668 TTGTATCTCAGGGAACAGGGAGG - Intergenic
1027812664 7:82925148-82925170 ATGAATGGCCAGGAGCAGAGCGG - Intronic
1029615582 7:101654964-101654986 CTTTATCTCAGTGAGCAGAGGGG + Intergenic
1030236774 7:107272220-107272242 ATTTATCTCAGTGAGCAGAGGGG - Intronic
1030992975 7:116323568-116323590 TTGTGTCTCAGGGAGTAGAGAGG - Intronic
1031227215 7:119054839-119054861 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1031336343 7:120538161-120538183 TTGTGTCTCAGGGACCAGAGAGG + Intronic
1031453321 7:121949251-121949273 ATTTATCTCAGTGAGCAGAGGGG + Intronic
1032115743 7:129115696-129115718 ATCCATATCAGGGAGCAGAAAGG + Intergenic
1032144528 7:129367082-129367104 ATTTATCTCAGTGAGCAGAGGGG + Intronic
1032327411 7:130943348-130943370 ATTTATATCAGGCAGCAGAAAGG + Intergenic
1032406879 7:131662715-131662737 ATTCATCTCAGTGAGCAGAGGGG + Intergenic
1032431355 7:131864641-131864663 AGGCATGCCAGGGACCAGAGGGG - Intergenic
1032700384 7:134373813-134373835 ATTTATCCCAGTGAGCAGAGGGG + Intergenic
1032717488 7:134522361-134522383 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1033462113 7:141556219-141556241 ATTTATGTCAGTGAGCAGAGGGG + Intronic
1034243723 7:149628551-149628573 ACTTATCTCAGTGAGCAGAGGGG + Intergenic
1034557685 7:151860397-151860419 GTGGATGCCAGGGAGGAGAGGGG - Intronic
1034670082 7:152851371-152851393 ATGTATGTCAGAGGCCACAGTGG - Intronic
1034819821 7:154206288-154206310 ATTTATGTAAGAGAGCACAGAGG - Intronic
1035919706 8:3663578-3663600 GTTTATCTCAGTGAGCAGAGGGG - Intronic
1035959872 8:4125263-4125285 ATTTATCTCAGTGAGCAGAGGGG - Intronic
1036039821 8:5063906-5063928 CTGTGTCTCAGGGAACAGAGAGG - Intergenic
1036061202 8:5323340-5323362 ATTTATTTCAGTGAACAGAGAGG - Intergenic
1036145818 8:6253722-6253744 GTTTATCTCAGTGAGCAGAGGGG - Intergenic
1036212473 8:6853620-6853642 ATTCATCTCAGTGAGCAGAGGGG + Intergenic
1037502307 8:19497800-19497822 ATTTATCTCAGGGAGCAGAGGGG - Intronic
1037583687 8:20261930-20261952 AAGGATGTCAGGGAGCAGGAGGG - Intronic
1037647245 8:20803667-20803689 ATTTATTTCAGTGAGCAGAGGGG - Intergenic
1038674191 8:29608649-29608671 CTCTATCTCAGTGAGCAGAGGGG + Intergenic
1039057781 8:33550402-33550424 GTGGTTGTCTGGGAGCAGAGCGG - Intronic
1039244784 8:35596807-35596829 ATTTATCTCAGTGAGCAGAGGGG + Intronic
1039953921 8:42192998-42193020 AATGCTGTCAGGGAGCAGAGAGG - Intronic
1040842987 8:51804290-51804312 ATATATCTCAGTGAGCAGAGGGG + Intronic
1040944428 8:52868825-52868847 ATTTATCTCAGTGATCAGAGAGG + Intergenic
1041535732 8:58923514-58923536 ATGAATGACAGGGAGAAGTGGGG - Intronic
1042103772 8:65301993-65302015 ATGTTTGTTTGGGAGCAGGGTGG - Intergenic
1042184381 8:66122247-66122269 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1042204302 8:66312962-66312984 ATGTGCTTCAGAGAGCAGAGAGG - Intergenic
1043235564 8:77861595-77861617 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1043360520 8:79466545-79466567 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1043561115 8:81494424-81494446 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1044580176 8:93818581-93818603 CTGTAAGTCAAGGAGCAGTGAGG + Intronic
1044659344 8:94579774-94579796 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1045036199 8:98178345-98178367 ATGGATGTCAGGGATTACAGAGG - Intergenic
1045486481 8:102635557-102635579 ATCTATGTCAGCGAGGAGAGGGG - Intergenic
1046729339 8:117708442-117708464 ATTTGTCTCAGTGAGCAGAGGGG - Intergenic
1046919968 8:119717582-119717604 CTTTATCTCAGTGAGCAGAGAGG - Intergenic
1047135564 8:122074282-122074304 ATTTATCTCAGTGAGAAGAGGGG - Intergenic
1047219393 8:122907459-122907481 ATCTATCTCAGTGAGCGGAGGGG + Intronic
1047252252 8:123189574-123189596 ATCTATCTCAGTGAGCAGAGCGG - Intronic
1047372649 8:124268692-124268714 ATGTCTGTCAGGGACCAAAGGGG - Intergenic
1048520153 8:135146338-135146360 ATTTATCTCAGTGAGCAGAGAGG + Intergenic
1048797494 8:138164551-138164573 ATTTATCTCAGTGAGCAGAGGGG - Intronic
1049374567 8:142282936-142282958 CTGTCTGTCAATGAGCAGAGGGG + Intronic
1049374762 8:142284134-142284156 GTGTCTGTCAATGAGCAGAGTGG + Intronic
1049449465 8:142652545-142652567 ATTTATCTCAATGAGCAGAGGGG + Intergenic
1049965636 9:776519-776541 ATGCATGCCAGGGAGCTGCGTGG - Intergenic
1051130832 9:13858527-13858549 ATGTAAGAAAGGAAGCAGAGGGG - Intergenic
1052206493 9:25847659-25847681 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1052206957 9:25854201-25854223 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1052704995 9:31983834-31983856 ATGTATGTGAGGAAAAAGAGAGG + Intergenic
1053159280 9:35802310-35802332 ATGTATGTAATGGAGGAGTGGGG + Intronic
1054839419 9:69719993-69720015 TTGTATCTCAGGGAACAGGGAGG - Intronic
1054933368 9:70660286-70660308 ATTTATCTCAGTAAGCAGAGGGG - Intronic
1055229501 9:74044727-74044749 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1055540370 9:77298466-77298488 ATGTATTTGAGGCAGCAGTGAGG + Intronic
1055559792 9:77511284-77511306 GTGTATCCCAGGGAGCAAAGTGG - Intronic
1055568926 9:77596760-77596782 ATTTATCTCAGTGAGCAGAGGGG - Intronic
1055789995 9:79913476-79913498 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1055917211 9:81416831-81416853 ATGTTTGTGAGGGAAGAGAGAGG - Intergenic
1056138812 9:83654713-83654735 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1057026916 9:91740977-91740999 GTGATTGTCAGGGAGGAGAGAGG + Intronic
1057098040 9:92330124-92330146 AGTTATGTGAGGGAGCAGAACGG + Intronic
1057258148 9:93567491-93567513 CTGCTTGTCAGGGAGCAGAGAGG - Intergenic
1057349397 9:94282557-94282579 ATCTATGTCAGTGAGCAGAGAGG + Intronic
1057467091 9:95324026-95324048 ATTTATTTCAGTGAGCAGAGAGG + Intergenic
1057467930 9:95332532-95332554 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1057690202 9:97277153-97277175 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1057910264 9:99014935-99014957 ATTTATCTCCGTGAGCAGAGGGG + Intronic
1057912988 9:99034687-99034709 ATAAATGTCATGGAACAGAGAGG + Intronic
1058324323 9:103676863-103676885 GTGTATGGCAGGGAGCAAGGAGG + Intergenic
1058383749 9:104409029-104409051 GTTTATCTCAGTGAGCAGAGGGG - Intergenic
1058384312 9:104415640-104415662 ATTTATGTCAGTGAGCAGAAGGG - Intergenic
1058997457 9:110314100-110314122 ATTTATCTCAGTGAGCAGAGGGG - Intronic
1059888183 9:118769906-118769928 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1060137872 9:121174941-121174963 ATGTATGTGAGGAAGCTGAGCGG + Intronic
1060314511 9:122496809-122496831 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1060399588 9:123340510-123340532 AAGGAGGTCAGAGAGCAGAGAGG - Intergenic
1061454949 9:130690916-130690938 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1062005044 9:134234828-134234850 GTGTATGCCAAGGTGCAGAGGGG - Intergenic
1062030010 9:134358018-134358040 AGGGATGTCGGGGAGCACAGTGG - Intronic
1203780869 EBV:100188-100210 ATGTTTAACAGGGAGCAGAGGGG + Intergenic
1185681364 X:1891189-1891211 ATCTATCTGAGTGAGCAGAGGGG + Intergenic
1185702960 X:2245159-2245181 ATCTATCTCAGTGAGCACAGGGG - Intronic
1185773111 X:2780894-2780916 ATCTGCCTCAGGGAGCAGAGGGG + Intronic
1185782883 X:2864442-2864464 ATTTATCTCAGTGAGCAGAGGGG + Intronic
1185795750 X:2962819-2962841 ATCTATCTCAGTGAGCAAAGGGG - Intronic
1185811475 X:3114430-3114452 ATCTATCTCAGTGAGCAGAAGGG + Intergenic
1185985075 X:4823626-4823648 GTTTATCTCAGTGAGCAGAGGGG + Intergenic
1186003436 X:5040783-5040805 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1186007879 X:5094475-5094497 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1186019892 X:5242638-5242660 ATTTATCTCAGTGAGTAGAGGGG + Intergenic
1186020795 X:5252895-5252917 ATCTGTCTCAGTGAGCAGAGGGG - Intergenic
1186029312 X:5349561-5349583 ATTTATCTCAGTGAGCACAGGGG + Intergenic
1186046398 X:5541455-5541477 ATTTATCTCAGTGAGCACAGGGG + Intergenic
1186053819 X:5627786-5627808 ATTTATCTCAGTGAGCACAGGGG - Intergenic
1186147698 X:6641987-6642009 ATTTATCTCAGTGAGCAGAAGGG - Intergenic
1186156190 X:6729211-6729233 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1186692872 X:11997807-11997829 ATGTACCTCAAGGAGAAGAGAGG + Intergenic
1186726948 X:12367509-12367531 ATGGATGCCAGTGTGCAGAGAGG + Intronic
1187139844 X:16583106-16583128 ACTTATCTCAGTGAGCAGAGAGG - Intergenic
1187139875 X:16583350-16583372 ATCTATCTCAGTGAGCAGAGGGG - Intergenic
1187352662 X:18535330-18535352 ATGTGTGTCAGGTACAAGAGTGG - Intronic
1187616123 X:20995291-20995313 ATCTATCTCAGTGAGCAGAGGGG - Intergenic
1187616534 X:21000688-21000710 ACCTATCTCAGTGAGCAGAGGGG - Intergenic
1187817395 X:23247509-23247531 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1188167453 X:26879500-26879522 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1188285517 X:28322039-28322061 ATTTATCTCAGGGAGCAGAGGGG + Intergenic
1188351670 X:29138927-29138949 AAGTATTTCAGGAAGCATAGAGG + Intronic
1188868508 X:35344861-35344883 ATCTATCTCAGTGAGCAGAGGGG + Intergenic
1188939529 X:36219638-36219660 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1189312090 X:40026323-40026345 AAGAATGTCAGGGAGCAAGGAGG + Intergenic
1189493402 X:41487692-41487714 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1189669147 X:43389055-43389077 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1189691945 X:43625700-43625722 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1189843515 X:45108448-45108470 ATGTGTTTCAGGGAGAAAAGTGG + Intronic
1190719533 X:53136002-53136024 ATTTATGTCTGAGAGCAGATGGG + Intergenic
1191010927 X:55758123-55758145 ATGTATGTCAGAGAACATACAGG - Intronic
1192209078 X:69116017-69116039 GTGCAGGTCAAGGAGCAGAGAGG + Intergenic
1193264358 X:79451022-79451044 ATTTATCTCAGTGAGCGGAGGGG + Intergenic
1193291627 X:79779767-79779789 ATTTATGTGAGGGAGGATAGAGG + Intergenic
1193474669 X:81948632-81948654 ATTTATGTCAATGAGCAGAGGGG - Intergenic
1193911742 X:87314921-87314943 AACTATCTCAGAGAGCAGAGGGG - Intergenic
1194166540 X:90522887-90522909 ATTTACCTCAGTGAGCAGAGGGG - Intergenic
1194167045 X:90530011-90530033 ATTTATCTCAGTGAGCATAGGGG - Intergenic
1194200405 X:90948004-90948026 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1194368366 X:93037503-93037525 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1194412386 X:93572945-93572967 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1194450933 X:94044082-94044104 ATTTATCTCAGTGAGCAAAGGGG + Intergenic
1194594323 X:95838245-95838267 ATTTATCTCAATGAGCAGAGGGG + Intergenic
1194810825 X:98384949-98384971 ATTTATCTCAGTGAGCAGCGGGG + Intergenic
1195156008 X:102125540-102125562 AGGTATGTCAGGAAAGAGAGGGG + Intergenic
1195220669 X:102743087-102743109 ATTTATCTCAGTGAGCAGAGGGG + Intronic
1195286398 X:103388818-103388840 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1195487057 X:105421306-105421328 ATTTGTCTCAGTGAGCAGAGGGG + Intronic
1195487326 X:105424407-105424429 ATTTATCTCGGTGAGCAGAGGGG + Intronic
1195943049 X:110180831-110180853 AAGTGTGGAAGGGAGCAGAGAGG - Intronic
1196369782 X:114964394-114964416 ATTTATAGCAGTGAGCAGAGGGG + Intergenic
1196385234 X:115141521-115141543 ATTTATCTCAGTGAGCAGAGTGG + Intronic
1196772607 X:119309814-119309836 ATCTCTCTCAGTGAGCAGAGGGG - Intergenic
1197026353 X:121754531-121754553 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1197042555 X:121957209-121957231 ATTTATCTCAGTGAGTAGAGGGG - Intergenic
1197043174 X:121964810-121964832 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1197347128 X:125337441-125337463 ATTTATCACAGTGAGCAGAGGGG + Intergenic
1197376436 X:125687475-125687497 ATTTATCTCAGTGATCAGAGGGG + Intergenic
1197547854 X:127848904-127848926 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1197628197 X:128827129-128827151 TTGTATCTTAGGGAGCAGGGAGG - Intergenic
1198424975 X:136508843-136508865 AAGTATGGCAGGCAGCAGAAGGG - Intronic
1198498027 X:137213430-137213452 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1198751324 X:139938953-139938975 ATTTATCTCAGGGAGCAGAGGGG - Intronic
1198867408 X:141138922-141138944 TATTATGACAGGGAGCAGAGTGG + Intergenic
1199166151 X:144678118-144678140 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1199383041 X:147192786-147192808 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1199868615 X:151876571-151876593 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1199887159 X:152031580-152031602 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1199887919 X:152040704-152040726 ATTTATCTCAGTGAGCAGAGGGG + Intergenic
1200389123 X:155925758-155925780 ATTTATCTCAGTGAGCAGAGGGG + Intronic
1200512808 Y:4100671-4100693 ATTTACCTCAGTGAGCAGAGGGG - Intergenic
1200513313 Y:4107786-4107808 ATTTATCTCAGTGAGCATAGGGG - Intergenic
1200546399 Y:4524425-4524447 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1201110362 Y:10794750-10794772 TTGAATGTCATGGAGCGGAGTGG - Intergenic
1201269093 Y:12237079-12237101 GCGTCTCTCAGGGAGCAGAGGGG - Intergenic
1201269824 Y:12243882-12243904 ATCTATCTCAGTGAGCAGAGGGG - Intergenic
1201288739 Y:12401734-12401756 ATCTATCTTAGTGAGCAGAGGGG + Intergenic
1201310212 Y:12590628-12590650 ATCTATCTCAGTGAGCAGAGGGG + Intergenic
1201319997 Y:12687961-12687983 ATGCATCTAAGTGAGCAGAGGGG - Intergenic
1201398587 Y:13577219-13577241 AGGCCTGTCAGGGAGCGGAGAGG + Intergenic
1201693680 Y:16799242-16799264 ATTTATCTCAGTGAGCAGAGGGG - Intergenic
1202046695 Y:20742935-20742957 ATTTATCTCAGTGAGCAGAGAGG + Intergenic
1202180730 Y:22137617-22137639 ATGTATCTCACAGAGAAGAGAGG + Intergenic
1202210630 Y:22448783-22448805 ATGTATCTCACAGAGAAGAGAGG - Intergenic