ID: 1167926448

View in Genome Browser
Species Human (GRCh38)
Location 19:52825019-52825041
Sequence CCTGAAATGCAGAGGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 782
Summary {0: 1, 1: 0, 2: 12, 3: 84, 4: 685}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167926441_1167926448 16 Left 1167926441 19:52824980-52825002 CCAGCTACTTGGGAGGCTGAGAT 0: 1369
1: 20607
2: 125164
3: 234531
4: 285157
Right 1167926448 19:52825019-52825041 CCTGAAATGCAGAGGCTGCAGGG 0: 1
1: 0
2: 12
3: 84
4: 685
1167926439_1167926448 25 Left 1167926439 19:52824971-52824993 CCTGTAGTTCCAGCTACTTGGGA 0: 1999
1: 50016
2: 165254
3: 226366
4: 235969
Right 1167926448 19:52825019-52825041 CCTGAAATGCAGAGGCTGCAGGG 0: 1
1: 0
2: 12
3: 84
4: 685

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167926448 Original CRISPR CCTGAAATGCAGAGGCTGCA GGG Intronic
900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG + Intergenic
900672823 1:3866329-3866351 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
901029214 1:6297112-6297134 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
901110711 1:6792027-6792049 CCTGGAAGGCGGAGGTTGCAGGG - Intronic
901144244 1:7054296-7054318 CCAGACATGCAGAGGCGGCCTGG - Intronic
901297688 1:8173252-8173274 CCTGGAAGGCGGAGGTTGCAGGG - Intergenic
901368322 1:8773746-8773768 CCTGGGAGGCAGAGACTGCAGGG + Intronic
901459652 1:9383996-9384018 CCTGGGAGGCAGAGGCTGAAAGG - Intergenic
901520875 1:9783915-9783937 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
902669785 1:17965055-17965077 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
902891075 1:19444080-19444102 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
902932207 1:19739670-19739692 CTTGAACTGGAGAGGCAGCAAGG + Intronic
903397730 1:23014916-23014938 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
903939187 1:26917180-26917202 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
904375120 1:30076307-30076329 CCTGAATTTCAGAGGATGTATGG + Intergenic
904496542 1:30890229-30890251 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
904525869 1:31133422-31133444 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
905405517 1:37729795-37729817 CCTGGAAAGTTGAGGCTGCAGGG + Intronic
905557436 1:38898226-38898248 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
905637347 1:39563608-39563630 CCTCACCTGCAGAGGCTGTATGG + Exonic
905641076 1:39590394-39590416 CCTGAAATGCAAAGGGTTCAAGG - Intergenic
905646844 1:39630838-39630860 CCTGAAGATCAGAGGCTCCATGG + Intronic
905991963 1:42345594-42345616 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
906322764 1:44827170-44827192 GCTGAAATCCAGAGGCTCCTGGG + Exonic
906438342 1:45816751-45816773 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
906982139 1:50642914-50642936 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
907024142 1:51098551-51098573 CCTGGAAGGCGGAGGTTGCAGGG + Intergenic
907741439 1:57170070-57170092 CCTGGGATGCAGAGGTTGCAGGG - Intronic
907818879 1:57947359-57947381 ACTGAAGTGCAGAGGTTGCTGGG - Intronic
908733084 1:67247378-67247400 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
910568508 1:88674581-88674603 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
910572794 1:88724645-88724667 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
911015209 1:93324855-93324877 TCTGTAATGCAGAGGCTACTTGG + Intergenic
911150788 1:94595443-94595465 CCCGGAAGGCAGAGGTTGCAGGG - Intergenic
911216757 1:95203332-95203354 ACTGGGAGGCAGAGGCTGCAGGG - Intronic
911618902 1:100044589-100044611 CCTGAGAGGCAGAGGTTGCAGGG - Intronic
911706755 1:101023115-101023137 CCCGAGAGGCAGAGGTTGCAGGG + Intronic
912220767 1:107672191-107672213 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
912818921 1:112851257-112851279 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
912846066 1:113075769-113075791 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
913007302 1:114647421-114647443 CCCGAGAGGCAGAGGTTGCAGGG - Intronic
913243625 1:116852250-116852272 CCTGAAAAGCAGACTCTGAAAGG + Intergenic
914726756 1:150334435-150334457 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
914849633 1:151304729-151304751 CCTGGGAGGCGGAGGCTGCAGGG - Intronic
914893330 1:151648128-151648150 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
915480756 1:156183207-156183229 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
917863085 1:179166699-179166721 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
919006764 1:191908936-191908958 CCTAAATTGCAGAGGATGTATGG - Intergenic
919153075 1:193724769-193724791 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
919909119 1:202099581-202099603 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
919937058 1:202260407-202260429 CCCGGGAGGCAGAGGCTGCAGGG - Intronic
920527410 1:206677466-206677488 CCTAAAAGGTTGAGGCTGCAGGG - Intronic
920859135 1:209690619-209690641 CCCGGAAGGCAGAGGTTGCAGGG + Intronic
921164065 1:212493632-212493654 CCTACAGTGGAGAGGCTGCAAGG + Intergenic
922204187 1:223432244-223432266 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
922631237 1:227113940-227113962 CCTGGGAGGCTGAGGCTGCAGGG + Intronic
922698418 1:227743509-227743531 CACGCAATGCAGAGGCAGCAAGG - Intronic
922760050 1:228123011-228123033 GCAGAAATGAAGAAGCTGCAAGG - Intergenic
923123881 1:231018670-231018692 CCAGAGAGGCAGAGGTTGCAGGG + Intergenic
923641938 1:235772147-235772169 CCTGAGAGGCAGAGGTTGCAGGG + Intronic
923677230 1:236090477-236090499 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
923716855 1:236432311-236432333 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1062772505 10:114029-114051 CCTGGGAGGCAGAGGTTGCAAGG + Intergenic
1063028069 10:2202549-2202571 CCTGAATTCCAGAGGGAGCAGGG + Intergenic
1063400333 10:5737542-5737564 CCTGAAGGGCAGAGGTTGCCTGG - Intronic
1063568775 10:7195600-7195622 CCTGAAATGTGCAGACTGCAAGG - Intronic
1063660026 10:8028931-8028953 CCTGAGAGGCAGAGGTTGCAAGG - Intergenic
1063744173 10:8860994-8861016 CCTGGGAGGCCGAGGCTGCAGGG - Intergenic
1064764498 10:18657687-18657709 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1064906623 10:20353505-20353527 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1065387253 10:25146112-25146134 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1065899513 10:30192602-30192624 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
1065900549 10:30203663-30203685 GCTGAAAAGAAGAGGCTTCAAGG + Intergenic
1065918509 10:30371388-30371410 CCTGGAAGGCAGAGGCTGCAGGG + Intronic
1066084374 10:31962243-31962265 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1066372129 10:34826130-34826152 CCTGTGCTGCAGAGGCTGGAAGG + Intergenic
1067097574 10:43312544-43312566 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1067450098 10:46376771-46376793 CCTGACATCCTGAGGCTGCCTGG - Intronic
1067570754 10:47369247-47369269 CATGAAATGGAGAGTCTGCAGGG + Intronic
1067587145 10:47482992-47483014 CCTGACATCCTGAGGCTGCCTGG + Intronic
1067634204 10:47990759-47990781 CCTGACATCCTGAGGCTGCCTGG + Intergenic
1067711130 10:48652003-48652025 CCTGAAAAACAGAGACTTCAGGG - Intronic
1068009168 10:51426203-51426225 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1068818373 10:61344495-61344517 CCTGACCTGCAGAAACTGCAAGG - Intergenic
1069038975 10:63674551-63674573 CCTGAGAGGTCGAGGCTGCAGGG + Intergenic
1069477816 10:68751101-68751123 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1069488760 10:68843631-68843653 CCCGGAAGGCAGAGGTTGCAGGG - Intronic
1069545612 10:69325908-69325930 CCTGGCAGGCAGAGGTTGCAGGG - Intronic
1069842408 10:71348039-71348061 CCTGCCATGCTGAGGCAGCAGGG + Intronic
1069996115 10:72343125-72343147 CAGGAAATGCAGAGGAAGCAGGG + Intronic
1070004454 10:72409613-72409635 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1070034902 10:72712928-72712950 CCAGAAATGCTGAGGCAGCAAGG + Intronic
1070055130 10:72927213-72927235 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1070260372 10:74849055-74849077 CCTGGGATGCTGAGGTTGCAGGG - Intronic
1070461408 10:76674102-76674124 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1071462527 10:85912557-85912579 ACTGAAAGGCAGAGCCTGTAAGG + Intronic
1071606728 10:86998822-86998844 CCTGCGAGGCAGAGGGTGCAGGG + Intergenic
1072125196 10:92439384-92439406 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1072132539 10:92509515-92509537 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1072521854 10:96236379-96236401 GCAGAACTACAGAGGCTGCAGGG + Intronic
1073219608 10:101859426-101859448 CCTGAAAGGCAGATTCTTCAAGG + Intronic
1073306821 10:102509401-102509423 GCAGAAATGCAGAGGTTCCACGG - Intronic
1073701032 10:105926626-105926648 CCCGGGAGGCAGAGGCTGCAGGG + Intergenic
1074164421 10:110862410-110862432 CTTAAAAAGCAGAGGCCGCAGGG - Intergenic
1074370978 10:112900646-112900668 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1074578208 10:114690755-114690777 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1074810540 10:117100635-117100657 CCTCAAAAGCACAGGCTGAAAGG + Intronic
1075270048 10:121041751-121041773 ACCAAAATGCAGAGGCTACAGGG + Intergenic
1075493422 10:122895021-122895043 CCTGAGAGGCAGAAGTTGCAGGG - Intergenic
1075679716 10:124323455-124323477 TCTGCAGGGCAGAGGCTGCAGGG - Intergenic
1075767708 10:124907473-124907495 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1076396016 10:130137808-130137830 CCTGGGAGGCGGAGGCTGCAGGG - Intronic
1076481288 10:130786727-130786749 CCTCAAATGCGGAGTCTGTAGGG - Intergenic
1076496420 10:130900486-130900508 ACTCAGAGGCAGAGGCTGCAGGG + Intergenic
1076562735 10:131377589-131377611 CCTGAAGTGCTGAGCCTTCAAGG - Intergenic
1076833741 10:133009671-133009693 CCTGCATTGGGGAGGCTGCATGG - Intergenic
1077066891 11:645085-645107 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1077242280 11:1516915-1516937 GTTCAAATGCAGAGCCTGCAGGG + Intergenic
1078201093 11:9183973-9183995 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1078648243 11:13162772-13162794 CTTATAATGCAGAGGCTGGAAGG - Intergenic
1078723721 11:13908728-13908750 CCTGCAATGCAGTGGCCTCAGGG - Intergenic
1078937100 11:15961622-15961644 CCTGGAAGGCGGAGGTTGCAGGG - Intergenic
1079132497 11:17755661-17755683 CATGAGATGGAGAGGCTGCAGGG + Intronic
1079411791 11:20194477-20194499 TCTGAAATGGAGTGGCTCCAGGG - Intergenic
1079803934 11:24905450-24905472 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
1080641254 11:34159789-34159811 TCTGAGGGGCAGAGGCTGCAGGG + Intronic
1080722600 11:34864703-34864725 CCTGAAATTCAGAGTCTGGTGGG - Intronic
1081099977 11:38989324-38989346 CCTGGGAGGTAGAGGCTGCAGGG - Intergenic
1081825644 11:46048692-46048714 CCCGGGAGGCAGAGGCTGCAGGG + Intronic
1081860740 11:46332328-46332350 CCTGAATTACTGAGGCTTCAGGG - Intergenic
1081947435 11:47009719-47009741 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1082784988 11:57311727-57311749 CCTTAAATTCAGAGGCAGCCTGG + Intronic
1083245564 11:61424852-61424874 CCTGAATTACAGATACTGCATGG - Intronic
1083459497 11:62801367-62801389 CCTGAATCGCAGAAGCTGTATGG - Exonic
1083644514 11:64164842-64164864 CCTGAAAGGCAGGGGCAGCTGGG + Intronic
1083658882 11:64242994-64243016 CCCGGGAGGCAGAGGCTGCAGGG + Intronic
1084222138 11:67688866-67688888 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1085359350 11:75872462-75872484 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1085527729 11:77173866-77173888 CCTCTAATGCAGGGGGTGCAGGG + Intronic
1086118749 11:83283884-83283906 CCTGGGAGGCACAGGCTGCAGGG + Intronic
1086290815 11:85307001-85307023 GAAGAAATGCAAAGGCTGCAAGG + Intronic
1086384320 11:86291574-86291596 CCAGAAGTACAAAGGCTGCAGGG + Intergenic
1086476296 11:87178499-87178521 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1087940156 11:104087099-104087121 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1088068815 11:105755885-105755907 ACTGAAATTCAGAGGATGGATGG - Intronic
1088303565 11:108384695-108384717 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1088325660 11:108598399-108598421 CTGGAAATGCAGAGGCACCAAGG + Intergenic
1088692867 11:112342767-112342789 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
1088935057 11:114391094-114391116 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1089237136 11:117038972-117038994 CCTGGGAGGCGGAGGCTGCAGGG + Intronic
1089431986 11:118432903-118432925 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1090531808 11:127598575-127598597 CTAGAAATGAAAAGGCTGCATGG + Intergenic
1090675064 11:128984297-128984319 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1091752829 12:3033291-3033313 CCTGAAGGGCTGAGGCTGCTAGG + Intronic
1091898744 12:4125205-4125227 CGTGGGAGGCAGAGGCTGCAGGG + Intergenic
1092193204 12:6534668-6534690 CCTGCAATGCGGAGGCCGCCCGG - Intronic
1092268895 12:7006292-7006314 CCTGGAAGACAGAGGTTGCAGGG - Intronic
1093051544 12:14510316-14510338 CCCGAAAGGCAGAGGTTGCAGGG + Intronic
1093107327 12:15104360-15104382 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1093166212 12:15806812-15806834 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1093180955 12:15966386-15966408 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1093207242 12:16265139-16265161 CATGAATTGCAGATGCGGCAAGG + Intronic
1093269639 12:17044435-17044457 CCTGAAATACAAAGGCAGCTGGG - Intergenic
1094110796 12:26860155-26860177 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1094397105 12:30019554-30019576 ACTGCAATGCAGGGGCTGCGAGG + Intergenic
1095919731 12:47517079-47517101 CCTGAATTTCAGAGGATGTATGG - Intergenic
1097078120 12:56410173-56410195 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1097890993 12:64777833-64777855 CCTGGTAGGCAGAGGTTGCAGGG - Intergenic
1098125152 12:67283505-67283527 CCTGGAAGGCGGAGGTTGCAGGG + Intronic
1099663484 12:85596550-85596572 CCTAAAATTCAGAGGATGTATGG - Intergenic
1099854478 12:88146141-88146163 CCTGCAAAGTAGAGGTTGCAGGG - Intronic
1100369085 12:93949079-93949101 TCAGAAATGCTGAGGCTGCTTGG + Intergenic
1100644691 12:96516398-96516420 ACTCAAATGGAGAAGCTGCAGGG + Intronic
1101433907 12:104648935-104648957 CCTGAACTGCAGTGGAAGCAGGG + Intronic
1101624810 12:106429226-106429248 CCCAAAAGGCAGGGGCTGCAGGG - Intronic
1101892047 12:108725909-108725931 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1102067422 12:109988775-109988797 CCCGGGAGGCAGAGGCTGCAGGG + Intronic
1102127454 12:110495629-110495651 CCTGAGAGGCAGAGGTTTCAGGG + Intronic
1102243122 12:111337957-111337979 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1102281631 12:111623196-111623218 CCTGGGAAACAGAGGCTGCAGGG - Intergenic
1102500617 12:113349739-113349761 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1102895254 12:116593542-116593564 CCTGGGAAGTAGAGGCTGCAGGG + Intergenic
1102934716 12:116886746-116886768 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1103388639 12:120553978-120554000 CCTGAGAGGCAGAAGCTGCAGGG - Intronic
1103720386 12:122971527-122971549 CCTGGGAAGCAGAGGTTGCATGG - Intronic
1103788828 12:123454760-123454782 CCTGTGAGGCAGAGGTTGCAGGG - Intergenic
1104211856 12:126696603-126696625 GCTGAACTGCAGAGGCAGGAAGG + Intergenic
1104462102 12:128964305-128964327 CCTGAGAGGTAGAGGCTGCAAGG + Intronic
1105369466 13:19789841-19789863 CCTGAAAGGCAGAGATTGCGGGG + Intergenic
1106040859 13:26091488-26091510 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1106091786 13:26602214-26602236 TCTGAAGCCCAGAGGCTGCATGG - Intronic
1107466908 13:40659237-40659259 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1107485838 13:40826873-40826895 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1107697853 13:43018261-43018283 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1107887198 13:44883387-44883409 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1107939554 13:45371794-45371816 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1110421699 13:75317259-75317281 CCAGAAATGCAGAGGATCCTGGG - Intronic
1111880771 13:93954388-93954410 CCTGGAAGACAGAGGTTGCATGG - Intronic
1112150978 13:96763413-96763435 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1112452937 13:99528212-99528234 CATGACAGGGAGAGGCTGCAGGG + Intronic
1112525262 13:100140537-100140559 CCTGAAATGCAAAGTAGGCATGG - Intronic
1114320777 14:21545554-21545576 TCTGAGAGGCAGAGGTTGCAGGG - Intergenic
1114423008 14:22600311-22600333 CTTGAAAAGCTGAGGCTGGAAGG + Intronic
1114641093 14:24221671-24221693 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1115229702 14:31146775-31146797 CCTGGAAGGCGGAGGTTGCAGGG + Intronic
1115372856 14:32638131-32638153 CCTTAGATGTAGAGGCTGCTCGG - Intronic
1116050562 14:39797688-39797710 CCTGGAAGGCAGAGGTTGCATGG - Intergenic
1117130908 14:52686134-52686156 CCCAAAACGCAGAGGTTGCAGGG + Intronic
1117349245 14:54864708-54864730 CAGGAAATCCAGAGGCTGAATGG - Intronic
1117763970 14:59060915-59060937 CCAGAGATGAAGAGGCTACAGGG + Intergenic
1118109137 14:62696373-62696395 CCTGAAAGGAAGAGGCTGAGTGG - Intergenic
1118528107 14:66668954-66668976 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1118736454 14:68704814-68704836 CCTGAGATGCAGTGGCTGGTTGG - Intronic
1119765178 14:77183300-77183322 GCTGAGAAGCTGAGGCTGCAAGG + Intronic
1120469399 14:84903523-84903545 CCTAGAATTCAGAGGATGCATGG + Intergenic
1120484121 14:85088784-85088806 TCTGACATGCAGGGGCTGCGTGG + Intergenic
1121253976 14:92518370-92518392 CCAGAAATTCAGGGGCTCCAGGG - Intronic
1121409010 14:93736465-93736487 CCCAAAATGCACATGCTGCAGGG - Intronic
1122559663 14:102603398-102603420 CCTGAGAGGCTGAGGATGCAGGG - Intronic
1122568947 14:102680727-102680749 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1122710673 14:103655149-103655171 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1124083264 15:26520443-26520465 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1124175066 15:27416768-27416790 CCTGAAATGGACAGGCTGATCGG - Intronic
1124448842 15:29765814-29765836 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1124906263 15:33871490-33871512 CCTGGGAGGCAGAGGCCGCAGGG + Intronic
1124930241 15:34112665-34112687 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1125447850 15:39776999-39777021 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1125706863 15:41745678-41745700 CCTGAGATGTAGAGGCTGCAGGG - Intronic
1125925295 15:43558301-43558323 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1126450841 15:48807127-48807149 TCTGAGAAGCAGAGGCTGGAGGG - Intronic
1126625262 15:50680156-50680178 CCCGGGAGGCAGAGGCTGCAGGG + Intronic
1127246149 15:57177343-57177365 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1127436711 15:58964984-58965006 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1127672859 15:61212473-61212495 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1129921030 15:79319318-79319340 CCTGTAATGCAGAGGCAGAAGGG + Intronic
1130013688 15:80171830-80171852 CTTGAAAGGCAAAGGCTGTATGG + Intronic
1130086564 15:80782483-80782505 CCTGAAATGCAGAGCTGGAAGGG - Intronic
1130165687 15:81455623-81455645 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1130222653 15:82033651-82033673 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1130348640 15:83070906-83070928 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1130906376 15:88243373-88243395 GGAGAAATGAAGAGGCTGCAAGG + Intronic
1131219419 15:90569393-90569415 CCAGGGAGGCAGAGGCTGCAGGG - Intronic
1131892336 15:96985470-96985492 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1132329856 15:101004735-101004757 CCTGAACTGCAGAAGGAGCAGGG - Intronic
1132362120 15:101225142-101225164 CCTGGAAGGTTGAGGCTGCAGGG - Intronic
1132369565 15:101285011-101285033 GCTGAAGTGGAGAGGCTGAAGGG - Exonic
1132712259 16:1274283-1274305 CCTGGGAGGCGGAGGCTGCAGGG - Intergenic
1133081540 16:3325055-3325077 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1133566744 16:7002634-7002656 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1133736905 16:8622541-8622563 CCGGAAATGCAGGGTCTGTATGG - Intronic
1133792755 16:9021952-9021974 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1133856686 16:9556306-9556328 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1134752815 16:16639721-16639743 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1134867154 16:17618631-17618653 ACTGAACAGCAAAGGCTGCAAGG + Intergenic
1134993243 16:18719355-18719377 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1135032891 16:19052786-19052808 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1135035468 16:19073231-19073253 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1135289089 16:21219196-21219218 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1135989883 16:27211752-27211774 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1136466192 16:30445538-30445560 CATGAAGGGCTGAGGCTGCAAGG - Exonic
1137065554 16:35838438-35838460 TCTGAAAGGCAGAGGCAGGATGG + Intergenic
1137555828 16:49469763-49469785 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1137767805 16:50991401-50991423 GCTGGCAGGCAGAGGCTGCAGGG - Intergenic
1139765773 16:69228428-69228450 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1140098845 16:71897086-71897108 CCTGAAAGGTCGAAGCTGCAGGG - Intronic
1140895814 16:79323263-79323285 GATGACATGGAGAGGCTGCAGGG + Intergenic
1141984694 16:87572160-87572182 CCCGGAAGGCGGAGGCTGCAGGG - Intergenic
1142340140 16:89516473-89516495 CCTGGTAGGCAGAGGTTGCAGGG + Intronic
1142381241 16:89733460-89733482 CCTGCAATGAAGAGCATGCATGG - Exonic
1142710636 17:1721744-1721766 CCTGGAAGGTCGAGGCTGCAGGG + Intronic
1143131260 17:4678933-4678955 TCTGTCATGCAGAGGCTCCAGGG - Intronic
1143215191 17:5219550-5219572 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1143297064 17:5879161-5879183 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1143449904 17:7029882-7029904 CCTGAGGTGTGGAGGCTGCAGGG + Intronic
1143567622 17:7734073-7734095 CCTGAAATGCATATGCTTCCTGG + Intronic
1143689937 17:8552870-8552892 TCTGAAATGCAGGAGCTGCTGGG - Intronic
1143836160 17:9694696-9694718 CCAGAAAGGCGGAGGGTGCAGGG - Intronic
1143899062 17:10159859-10159881 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1144870281 17:18365308-18365330 CCAGAGAGGCAGAGGTTGCAGGG - Intergenic
1146273433 17:31499122-31499144 CCAGAGATGCAGTGGCTGCATGG + Intronic
1146323900 17:31869033-31869055 CCTGGGAGGCGGAGGCTGCAGGG + Intronic
1146527063 17:33576150-33576172 CCTGAAAGCCAAAGGGTGCAGGG - Intronic
1147443975 17:40463721-40463743 CCTGGAAGGTGGAGGCTGCAGGG + Intergenic
1147570824 17:41569795-41569817 GCAGAAATGCAGAGACAGCAGGG - Intronic
1147681421 17:42249734-42249756 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1148753224 17:49957949-49957971 CCCGGGAGGCAGAGGCTGCAGGG + Intergenic
1149192971 17:54086040-54086062 CCTGAAATGCTGCAGCTGGATGG + Intergenic
1149702850 17:58669656-58669678 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1149732837 17:58963309-58963331 CCAGAGAGGCAGAGGTTGCAGGG + Intronic
1149801438 17:59571664-59571686 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1150157445 17:62865932-62865954 GCTGAAATGTAGAGGCTGGGAGG + Intergenic
1150157531 17:62866691-62866713 GCTGAAATGTAGAGGCTGAGAGG - Intergenic
1150356076 17:64485990-64486012 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1150677099 17:67254108-67254130 CCTGGAAGGCAGAGGTTGCAGGG - Intergenic
1150967746 17:69990834-69990856 ACTGAAATGAAGAAGCTTCAAGG - Intergenic
1151738969 17:75966052-75966074 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1151880280 17:76890577-76890599 CCTGAGAGGCAGAGGCTGCAGGG - Intronic
1152117969 17:78400307-78400329 CCTGGGAGGCGGAGGCTGCAGGG + Intronic
1152175407 17:78783543-78783565 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
1152255663 17:79238010-79238032 CCTGAGAGGCAGAGGTTGCAGGG - Intronic
1152376335 17:79920646-79920668 CCTAAAATGCAGGCACTGCATGG - Intergenic
1152403211 17:80082095-80082117 CCTCATATGCCCAGGCTGCAGGG - Intronic
1152407287 17:80104920-80104942 CCTGCAAAGCAGGGGCTGCAGGG + Intergenic
1152586067 17:81190033-81190055 CCTGCAGTGCACAGGGTGCACGG + Intronic
1152884408 17:82840892-82840914 GCTGCAGGGCAGAGGCTGCAGGG + Intronic
1153579977 18:6562963-6562985 CCCAGAAGGCAGAGGCTGCAGGG + Intronic
1153793852 18:8604743-8604765 CCCGAGAGGCAGAGGTTGCAGGG + Intergenic
1153811456 18:8755574-8755596 CCTGGAACTCAGAAGCTGCATGG - Intronic
1154407671 18:14109029-14109051 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1155471116 18:26193879-26193901 CCTGAGAGGCGGAGGTTGCAGGG - Intergenic
1156894384 18:42229003-42229025 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1157301277 18:46481621-46481643 CCTGAAGTGAAGGGGTTGCAGGG - Intronic
1157406328 18:47425074-47425096 CCTGAAATGCTGAGGCCTCTTGG - Intergenic
1157835969 18:50903524-50903546 CCTGGAAGGTCGAGGCTGCAGGG - Intronic
1158708344 18:59814867-59814889 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1158790748 18:60777590-60777612 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
1158843981 18:61420973-61420995 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1158989410 18:62853443-62853465 CCCGAGAGGCAGAGGTTGCAGGG - Intronic
1159209826 18:65304142-65304164 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1160663924 19:314067-314089 CCTGAAATGCAGAGGCCTGAGGG + Intronic
1160885459 19:1344843-1344865 CCTCAAATGCAGATCTTGCAGGG - Intergenic
1161502805 19:4626503-4626525 CCTGAGAGGCGGAGGTTGCAGGG - Intergenic
1161621746 19:5301389-5301411 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
1162088952 19:8265406-8265428 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1162374105 19:10294979-10295001 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1162413529 19:10520212-10520234 CCTGGAAAGTCGAGGCTGCAGGG - Intergenic
1162654889 19:12121174-12121196 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1163079425 19:14926589-14926611 CCTGAGAGGCAGAGGTTGCAGGG - Intergenic
1163562004 19:18024928-18024950 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1164521756 19:28985020-28985042 ACTGAAGTGTGGAGGCTGCATGG - Intergenic
1165015499 19:32877356-32877378 TCTGAAAAGGAGATGCTGCAGGG + Intergenic
1165585432 19:36911285-36911307 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1165949259 19:39464790-39464812 CTTGATCTGCAGGGGCTGCAGGG - Exonic
1166158969 19:40937432-40937454 ACGTAAATGCAGAGGCTGCGTGG + Intergenic
1166167916 19:41005354-41005376 ATGTAAATGCAGAGGCTGCATGG + Intronic
1166570296 19:43791632-43791654 CCTGGAAGGCAGAGCTTGCAGGG - Intergenic
1166789822 19:45392113-45392135 CCTCAAACGCAGGGGCTCCATGG - Exonic
1167151000 19:47709602-47709624 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1167412480 19:49353172-49353194 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
1167922862 19:52796540-52796562 CCTGGGAGGTAGAGGCTGCAGGG - Intronic
1167926448 19:52825019-52825041 CCTGAAATGCAGAGGCTGCAGGG + Intronic
1168052642 19:53840880-53840902 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1168168782 19:54573057-54573079 CCTGGGAGGCGGAGGCTGCAGGG - Intronic
1168404177 19:56102360-56102382 CCTGACATGCAGACACAGCAAGG + Intronic
1168422728 19:56215717-56215739 CCTGAGAGGTTGAGGCTGCAGGG - Intergenic
1168503027 19:56909481-56909503 CCTGGAAGGTCGAGGCTGCAGGG - Intergenic
1168653276 19:58107483-58107505 CCCAAGAGGCAGAGGCTGCAGGG + Intronic
925915772 2:8604765-8604787 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
926115945 2:10213443-10213465 CCTGAAACGTGGAGGTTGCAGGG + Intergenic
926311060 2:11676679-11676701 GCTGAAATACAGATGCTGGAAGG + Intergenic
926398640 2:12471805-12471827 CCTGGAAGACAGAGGTTGCAAGG - Intergenic
926615185 2:14990346-14990368 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
926890252 2:17633441-17633463 CCTGAGAGGCAGAGGTTGCAGGG + Intronic
927045180 2:19271175-19271197 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
928023698 2:27723000-27723022 CCTGGGATGCAGAGGTTGAAGGG - Intergenic
928975427 2:37082143-37082165 CCGGAAAGGCAGAGGTTGCAAGG - Intronic
929181775 2:39048474-39048496 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
929679146 2:43971022-43971044 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
929819268 2:45260303-45260325 CCTGAAAGGAAGAGGCTGGAAGG - Intergenic
929934214 2:46282585-46282607 GCAGAAGTGGAGAGGCTGCAGGG - Intergenic
929950790 2:46408280-46408302 GCAGGAATGCAGAGGCAGCAAGG + Intergenic
930149278 2:48041939-48041961 TCTGATATCCAGAGTCTGCAAGG - Intergenic
931216545 2:60250146-60250168 CCTGGGAGGCAGAGGCTTCAGGG + Intergenic
931352350 2:61503039-61503061 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
931835701 2:66096449-66096471 CCTGCAATCCAGAGGCTGACTGG + Intergenic
932150927 2:69371150-69371172 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
932181675 2:69652086-69652108 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
932419059 2:71590746-71590768 CAGGAAATGCAGAGGCAGCCTGG - Intronic
932573637 2:72951074-72951096 CCTGGAGGGCAGGGGCTGCAGGG + Intronic
932633968 2:73371730-73371752 CCTGCCCTGCAGAGGTTGCAAGG - Intergenic
932653716 2:73588264-73588286 CCTGGACTGCAGAGACTGCAGGG - Intronic
933344497 2:81066037-81066059 CCTAAATTTCAGAGGATGCATGG - Intergenic
933818034 2:86084339-86084361 CCTGAGAGGCAGAGGCTGTAGGG + Intronic
934070720 2:88381632-88381654 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
935035648 2:99369898-99369920 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
935142613 2:100366691-100366713 CCTGGAAGGCAGAGGTTGCAGGG + Intergenic
935274294 2:101463105-101463127 CCTGTCATACAGAGGCTGCAAGG - Intronic
935293183 2:101626948-101626970 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
935712534 2:105912116-105912138 CCTGAAAACCAGAAGCTCCAAGG - Intergenic
936289595 2:111211309-111211331 CCTGGGATGCAGAGGTTGCAGGG - Intergenic
936558180 2:113514064-113514086 CCTGAAAGCCAGATGCTACAAGG + Intergenic
936698603 2:114982674-114982696 CCTGGGACGTAGAGGCTGCAGGG - Intronic
937256759 2:120561189-120561211 CCTCAGCTGCAAAGGCTGCAAGG + Intergenic
937276218 2:120685772-120685794 CTTGAGAAGCTGAGGCTGCAGGG - Intergenic
937636056 2:124156569-124156591 CCTGGAAAGCGGAGGTTGCAGGG - Intronic
937993554 2:127677108-127677130 CTGGAGATGCAGAGGCTTCAAGG + Intronic
939525422 2:143287890-143287912 CCTGAAAGGCATAGCCTGCAGGG - Intronic
939982678 2:148799715-148799737 CCTGAGAGGCAGAGGTTGCAGGG - Intergenic
940227420 2:151414208-151414230 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
940713238 2:157187538-157187560 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
940864194 2:158800913-158800935 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
941230985 2:162912501-162912523 CCTGCAAGTCAGAGGCTGCAGGG + Intergenic
941651962 2:168101660-168101682 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
941670759 2:168289743-168289765 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
941717611 2:168780181-168780203 CCTGAAAGAGAAAGGCTGCAAGG + Intergenic
941857045 2:170241921-170241943 TGTGAGATGCAGAGGCAGCAGGG + Intronic
942469123 2:176241780-176241802 CCTGAGAGGCGGAGGTTGCAGGG - Intergenic
942637236 2:178020720-178020742 CCCGAGAGGCAGAGGTTGCAGGG + Intronic
943032365 2:182700839-182700861 TCTGGAAGGCAGAGGTTGCAAGG + Intergenic
943600422 2:189912463-189912485 CCTGAGAGGCAGAGGCTGCAGGG + Intronic
944125074 2:196283449-196283471 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
944447382 2:199805207-199805229 CCTGGACTGAGGAGGCTGCAGGG - Intronic
945110127 2:206354948-206354970 CCTGAGAGGCAGAGGTTGCAGGG - Intergenic
945234590 2:207622981-207623003 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
945309842 2:208298916-208298938 TCTGAGAGGCAGAGGTTGCAGGG - Intronic
945920565 2:215750883-215750905 CCCCAAATGCAAAGGCGGCAGGG - Intergenic
946699045 2:222392729-222392751 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
946822752 2:223647263-223647285 CAGGAAAGACAGAGGCTGCAGGG - Intergenic
947504359 2:230695531-230695553 CCTGTGAGGCAGAGGCTGCAGGG + Intergenic
947686826 2:232094641-232094663 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
947713390 2:232328365-232328387 CCTGAGATGCAGAGGAAGAAGGG - Intronic
947784559 2:232804565-232804587 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
947982287 2:234420693-234420715 CTTGCAGTGCAGAGGCTGCAAGG + Intergenic
948182124 2:235990334-235990356 CCTGACCCACAGAGGCTGCAGGG - Intronic
948463768 2:238142626-238142648 CCTGAAAGGCACATGGTGCAAGG + Intronic
948510119 2:238458413-238458435 CCTGAAGTGCAGAAGCTGGTGGG + Intergenic
1168860923 20:1045566-1045588 CCTGAGTGGCTGAGGCTGCAGGG + Intergenic
1169215000 20:3788059-3788081 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1169482595 20:5998249-5998271 CCTATAATGCAGGGGCTGGAAGG + Intergenic
1169514782 20:6303877-6303899 TCTGAACTGCAGGGGCTGCCTGG - Intergenic
1170544331 20:17421475-17421497 ACTGAAATGCAGAGACTTCCTGG - Intronic
1170822724 20:19767847-19767869 CCTGAGAGGCAGAGGTTGCAGGG + Intergenic
1172427539 20:34865258-34865280 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1172575616 20:36006102-36006124 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1172716617 20:36968977-36968999 CCCGGAAGGCAGAGGTTGCAGGG + Intergenic
1172814638 20:37676714-37676736 GCTCAAATGAAGAGGCTGCCTGG + Intergenic
1172863484 20:38076567-38076589 GCTGAGAAGCAGAGGCAGCAAGG - Intronic
1172878658 20:38182470-38182492 CCTCAACTGCAGGGGCTGGAAGG + Intergenic
1173189567 20:40865597-40865619 CAAGAAAAGAAGAGGCTGCAAGG - Intergenic
1173475417 20:43355752-43355774 CATGCAAAGCAGAGGCTACAAGG - Intergenic
1173797916 20:45875575-45875597 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1174124083 20:48289853-48289875 CCTCCTCTGCAGAGGCTGCAGGG - Intergenic
1174445898 20:50590888-50590910 CATGGGAAGCAGAGGCTGCAGGG - Intronic
1174959906 20:55144228-55144250 CCAGATATGCACTGGCTGCAGGG + Intergenic
1175028607 20:55929859-55929881 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1175786765 20:61716830-61716852 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1176192500 20:63818780-63818802 ACTGGAAGGCAGAGGTTGCAAGG + Intronic
1176315311 21:5237190-5237212 CCTAAATTTCAGAGGATGCATGG + Intergenic
1176914191 21:14605085-14605107 CTTCAAATACAGAGGCAGCAAGG + Intronic
1177751606 21:25292183-25292205 CCTGAGAGGCAAAGGTTGCAAGG - Intergenic
1178335544 21:31739436-31739458 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1179499403 21:41797734-41797756 CCTGGGAGGCGGAGGCTGCAGGG + Intergenic
1179953653 21:44725720-44725742 CCCGGGAAGCAGAGGCTGCAGGG + Intergenic
1180065459 21:45410038-45410060 GATGAAATGTGGAGGCTGCAGGG + Intronic
1180393096 22:12303145-12303167 CCTAAATTTCAGAGGATGCATGG + Intergenic
1180406654 22:12561623-12561645 CCTAAATTTCAGAGGATGCATGG - Intergenic
1180994135 22:19956450-19956472 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1181083401 22:20428378-20428400 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1181129828 22:20724530-20724552 TCTGGGAGGCAGAGGCTGCAAGG + Intronic
1181265010 22:21625854-21625876 CCTGGGAGGTAGAGGCTGCAGGG - Intergenic
1181302779 22:21893248-21893270 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1181470629 22:23137165-23137187 CCAGAGAGGCAGAGGCTGCAGGG - Intronic
1181492026 22:23266463-23266485 CCTGGGAGGCAGAGGTTGCAAGG - Intronic
1181620601 22:24088530-24088552 CCTGAGAGGCAGAGGTTGCAGGG + Intronic
1181736290 22:24884223-24884245 GCAGTGATGCAGAGGCTGCAGGG + Intronic
1182198038 22:28539280-28539302 GCTGAAATGTAGAGGTTGCTAGG + Intronic
1182975946 22:34624214-34624236 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1183386076 22:37515485-37515507 CCCGGGAGGCAGAGGCTGCAAGG + Intronic
1183394901 22:37566194-37566216 CCCCAAATGCAGAGGCTGTGGGG - Exonic
1183791591 22:40074880-40074902 CCTGGAAGGTGGAGGCTGCAGGG + Intronic
1183899134 22:40991887-40991909 CCCGAGAGGCAGAGGTTGCAGGG - Intergenic
1183906910 22:41048534-41048556 CCTGGGAGGCGGAGGCTGCATGG + Intergenic
1183995008 22:41626528-41626550 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1184146921 22:42617197-42617219 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1184595999 22:45514643-45514665 CTTGACATGCAAAGGCTGCTGGG - Intronic
1184769610 22:46589582-46589604 CCTGCAAAGCAGGGGCAGCATGG - Intronic
1185310965 22:50153972-50153994 CATGGAATGCAGAGGCCCCAAGG - Intronic
1185379520 22:50501928-50501950 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1185424103 22:50754771-50754793 GCTGAAGTGGAGAGGCTGAAGGG - Intergenic
949624973 3:5855150-5855172 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
949990049 3:9571291-9571313 CCCGGGAGGCAGAGGCTGCAGGG - Intergenic
950462576 3:13134226-13134248 CCAGATATGCAGGGGCTGCAGGG + Intergenic
951000710 3:17556088-17556110 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
951204977 3:19916437-19916459 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
951957251 3:28271004-28271026 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
952271211 3:31833458-31833480 CCTGACATGCAGAAGCTGCATGG + Intronic
952487872 3:33833986-33834008 CTTGAAATGCAAAGGCTGTGAGG - Intronic
953705641 3:45227816-45227838 CCTGATATGCAAAGGTTGAAAGG - Intergenic
953853248 3:46481673-46481695 CCTGAAAGGCAGAGGTTGCAGGG + Intronic
954318385 3:49813609-49813631 CCTGCCATGCAGAGGATTCAGGG - Exonic
954386221 3:50245549-50245571 CCTGAAATGAAGAGGCCTCCAGG + Intronic
954630108 3:52043513-52043535 CCTGGAGTGCACAGGCTGGAGGG - Intergenic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
955690005 3:61581683-61581705 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
957170238 3:76729711-76729733 CATGGGAGGCAGAGGCTGCAGGG - Intronic
958514745 3:95099927-95099949 CATAAAAGGCAGAGGTTGCAGGG - Intergenic
960109982 3:113836717-113836739 CCTGGAAAGTGGAGGCTGCAGGG - Intronic
960630332 3:119724090-119724112 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
960638111 3:119803831-119803853 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
960794558 3:121471664-121471686 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
961672816 3:128547384-128547406 CCTGTACTGCAGAGGCTGGAAGG - Intergenic
961927668 3:130498511-130498533 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
962126493 3:132624760-132624782 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
963790820 3:149580687-149580709 ACCGGAAGGCAGAGGCTGCAGGG - Intronic
963948108 3:151168779-151168801 CCTGAGAGGCAGAGGTTGCAGGG - Intronic
964574937 3:158155508-158155530 CCTGAGAGGTAGAGGCTGCAGGG - Intronic
964976728 3:162630319-162630341 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
965334082 3:167414038-167414060 CCTGAATTGCACAGGGTGCTGGG + Intergenic
965503201 3:169480746-169480768 CCTGAAAAGCACAGGCTTCTAGG - Intronic
965688788 3:171333479-171333501 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
967884058 3:194321491-194321513 CCTGGGATGCAGAGGTTGCAGGG + Intergenic
967924344 3:194634282-194634304 CCTGGGAGGCGGAGGCTGCAGGG - Intergenic
968074324 3:195808289-195808311 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
968877586 4:3281388-3281410 CCCGAGAGGCAGAGGTTGCAGGG - Intergenic
968997195 4:3953317-3953339 CCTGACATTCAGATGCCGCAGGG + Intergenic
969261150 4:6034723-6034745 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
969284620 4:6195102-6195124 CCTGAGTTGCAGAGGGTTCAGGG + Intronic
969601613 4:8179735-8179757 CCTGACCTGCAGAGGGTCCATGG + Intergenic
970324037 4:14904510-14904532 GCTGAAATGCAGAGGTTAAATGG - Intergenic
970837350 4:20426198-20426220 CCTGGAATGCGGAGGCAGTAGGG + Intronic
971287898 4:25307985-25308007 ACTGGAAGGCAGAGGCTGCCGGG + Intergenic
971547383 4:27903484-27903506 ACTGAAAAGAAGGGGCTGCAGGG + Intergenic
971900307 4:32650090-32650112 CCTGAATTTCAGAGGATGTATGG - Intergenic
971915264 4:32862093-32862115 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
972253006 4:37324772-37324794 CCTGAAATGCAGCTGCAGCCTGG - Intronic
972436120 4:39037176-39037198 CCTGGAAGGCGGAGGTTGCAGGG - Intergenic
972832702 4:42832906-42832928 CCTAAATTGCAGAGGATGTATGG + Intergenic
973140203 4:46757622-46757644 CCCAAAATGCACAGGCTGTATGG - Intronic
973320239 4:48802643-48802665 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
973696971 4:53499704-53499726 CCTGAAAAGCAGAGTCTTTAAGG - Intronic
974090505 4:57305817-57305839 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
974882039 4:67771364-67771386 CCTGAGAGGCGGAGGTTGCAGGG + Intergenic
977579969 4:98714234-98714256 AGAGCAATGCAGAGGCTGCAAGG - Intergenic
978787904 4:112630440-112630462 CCTGGGAGGCAGAGGCTTCAGGG + Intronic
978890842 4:113825425-113825447 CCTCCACTGCAGAGGCTTCAGGG + Intergenic
978944021 4:114472584-114472606 TGTGAAATGCTGAGGCTCCATGG + Intergenic
979107437 4:116705674-116705696 CCTTCCTTGCAGAGGCTGCAGGG - Intergenic
980134381 4:128845846-128845868 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
980693160 4:136321403-136321425 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
981057536 4:140380271-140380293 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
981312747 4:143312989-143313011 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
982018281 4:151177422-151177444 CCTGAGAGGCGGAGGTTGCAGGG - Intronic
982087893 4:151854692-151854714 CCAGAAAAGCAGAGGATGAAAGG + Intergenic
982252068 4:153417211-153417233 CCTGGGATGCAGAGGTTGCGTGG + Intergenic
982631647 4:157838014-157838036 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
982687345 4:158506808-158506830 CCTGGGAGGCAGAGGTTGCAAGG + Intronic
983018677 4:162647252-162647274 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
983608220 4:169614345-169614367 CCTGGAAGGCGGAGGTTGCAGGG - Intronic
983614204 4:169683817-169683839 CCTGGAAGGCAGAGGTTGCAGGG - Intronic
983719678 4:170833953-170833975 CCTTTAATTCAGAGGCAGCAAGG + Intergenic
984021000 4:174484704-174484726 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
985024883 4:185731180-185731202 AGTCAAATGCAGAGGCTGTAAGG + Intronic
985066550 4:186127759-186127781 CTTGGAAGGCAGAGGTTGCAGGG - Intronic
985217257 4:187667164-187667186 CCTGCCACTCAGAGGCTGCAAGG + Intergenic
985431823 4:189888376-189888398 CCTAAATTTCAGAGGATGCATGG - Intergenic
985482360 5:122493-122515 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
985885340 5:2673162-2673184 TCAGATATGCACAGGCTGCAGGG - Intergenic
985988937 5:3539185-3539207 CCTGAAATGCAGATGCCTCAAGG + Intergenic
986547682 5:8916817-8916839 CAGGCATTGCAGAGGCTGCACGG + Intergenic
986585969 5:9318986-9319008 CCTGAGAGGCAGAGGTTGCCAGG + Intronic
986691869 5:10319949-10319971 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
987334967 5:16890762-16890784 CCCGAGAAGCAGAGGTTGCAGGG + Intronic
988342152 5:29986427-29986449 CCTGGGAAGCAGAGGCTGAAGGG + Intergenic
988431624 5:31125746-31125768 CCTGGGAGGCGGAGGCTGCAGGG - Intergenic
988856803 5:35234965-35234987 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
990019237 5:51105028-51105050 CCTGAGAGGCGGAGGTTGCAGGG - Intergenic
990168892 5:53025586-53025608 CCTGAAATGCAGAGGCGCAATGG + Intronic
990407530 5:55505979-55506001 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
990494329 5:56332432-56332454 CCTGAAATGCAGGTGAAGCAGGG - Intergenic
992016142 5:72577259-72577281 ACTAAAATGGGGAGGCTGCAAGG + Intergenic
992023508 5:72648721-72648743 ACTGAACTGCAGAGGCTGGCTGG + Intergenic
992432147 5:76719511-76719533 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
992911175 5:81397448-81397470 CCTGAACAGCAGAGGCAGCCGGG + Intergenic
992911294 5:81398473-81398495 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
993310034 5:86318090-86318112 CCTGGGAGGCAGAGGATGCAGGG - Intergenic
993379415 5:87189171-87189193 CCCTAAAGGCAGAGGCAGCATGG + Intergenic
993544266 5:89191617-89191639 CCTGAAATGAAACAGCTGCAAGG - Intergenic
994395896 5:99225550-99225572 CCTGATATGCAGAGGGGGAAAGG - Intergenic
994508663 5:100675152-100675174 CCTGGAAGGCGGAGGCTGCAGGG - Intergenic
994761236 5:103856876-103856898 CCTGAGAGGCAGAGGTTTCAGGG - Intergenic
995781930 5:115785888-115785910 CCTGACATTCAGAGACTGCCGGG - Intergenic
996572937 5:124952111-124952133 CCTGGAAAGCTGAGGCTGCGGGG - Intergenic
996847411 5:127915455-127915477 CCCGGGAGGCAGAGGCTGCAGGG - Intergenic
997116657 5:131132462-131132484 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
997325855 5:133020366-133020388 CCTGGGAGGCAGAGGCTGCAAGG + Intronic
997514412 5:134476504-134476526 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
998214565 5:140227462-140227484 CCTAGAACTCAGAGGCTGCAGGG + Intronic
1000317383 5:160105460-160105482 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1001287018 5:170431218-170431240 CCTGACAGGCAGTGGCAGCAAGG - Intronic
1001508872 5:172303343-172303365 CCCGAAATGCAGAGCCGGGAAGG + Intergenic
1001625153 5:173126214-173126236 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1001802541 5:174556652-174556674 CCTGGAAGGCGGAGGTTGCAGGG + Intergenic
1001919798 5:175590912-175590934 CCTTTCATGCAGAGGCTGCTAGG - Intergenic
1001943288 5:175755881-175755903 CCTGGGAAGCAGAGGCTGCAGGG + Intergenic
1002043952 5:176531937-176531959 TCTGAGAGGCAGAGGCAGCAAGG - Intronic
1002127947 5:177060730-177060752 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1002182306 5:177437028-177437050 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1002436052 5:179231788-179231810 CCTAAAGTGCTGAGACTGCAGGG - Intronic
1002519830 5:179786162-179786184 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1002970328 6:2010249-2010271 CCCGAGAGGCAGAGGTTGCAGGG + Intronic
1003101219 6:3177828-3177850 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1004227003 6:13794724-13794746 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1004468050 6:15904029-15904051 CCTGGTAGGCAGAGGTTGCAGGG + Intergenic
1004493296 6:16138829-16138851 CCTGGAGTGCAGAGGATGCCTGG - Intronic
1004547921 6:16616462-16616484 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1004650427 6:17602104-17602126 CCTGGGAGGCGGAGGCTGCAGGG - Intronic
1005354959 6:24973519-24973541 CCTGGAAGGCAGAGATTGCAGGG + Intronic
1005622074 6:27629312-27629334 CCTGGAAGGCAGAGGTTGCAGGG + Intergenic
1005958738 6:30682203-30682225 TCAGAAATGCACAGCCTGCATGG + Intronic
1006373430 6:33659061-33659083 GCTGGCATGCAGAGGCTGCCCGG - Exonic
1006458355 6:34144482-34144504 CCTGAAGTCCTGGGGCTGCAGGG + Intronic
1006987914 6:38189061-38189083 CCTGGAGGGCAGAGGATGCAGGG - Intronic
1007411344 6:41663753-41663775 CCCGAGAAACAGAGGCTGCAAGG + Intergenic
1008355105 6:50543588-50543610 CCTGAAAAGCAAATGCTACACGG - Intergenic
1009515508 6:64611051-64611073 CCTAAAAAGCAGAGGATGCATGG - Intronic
1010022142 6:71173209-71173231 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1010230423 6:73529959-73529981 CCTGGGAGGTAGAGGCTGCAGGG - Intergenic
1010231516 6:73539364-73539386 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1010349769 6:74859668-74859690 CCTGAGAGGCGGAGGTTGCAGGG - Intergenic
1010391208 6:75339870-75339892 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1010406083 6:75507340-75507362 CCTAAAATCCAGAGTCTACAAGG + Intergenic
1011275145 6:85623486-85623508 TCTGGGAGGCAGAGGCTGCAGGG + Intronic
1011413371 6:87090016-87090038 TCTGAAATGCTGAGGATGAAAGG - Intronic
1012638090 6:101572922-101572944 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1013074520 6:106759491-106759513 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1013485896 6:110595658-110595680 CCTGGTAGGCAGAGGTTGCAGGG + Intergenic
1013510014 6:110835935-110835957 CCAGAAAGGCTGAGGCTGCAGGG + Intronic
1014035083 6:116757671-116757693 CCTGGCAGGCAGAGGATGCAGGG + Intronic
1014109773 6:117607538-117607560 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1015284109 6:131465336-131465358 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1015653747 6:135493965-135493987 CCTGAAATGTGGAGGTTGCAGGG + Intronic
1015824564 6:137297955-137297977 CCTGAGATGCAGGGTCTGCCCGG + Intergenic
1016466297 6:144328857-144328879 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1016810242 6:148253794-148253816 TCTGGAAGGCAGAGGATGCAGGG + Intergenic
1017097869 6:150820787-150820809 CCTGGGAAGCAGAGGTTGCAAGG + Intronic
1017103585 6:150867871-150867893 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1017281221 6:152628264-152628286 AATGTGATGCAGAGGCTGCAAGG - Exonic
1017404321 6:154102013-154102035 CCTGGGAAGTAGAGGCTGCAGGG - Intronic
1017680217 6:156856294-156856316 CCTGAAAAGCATAGGCTATATGG - Intronic
1017842067 6:158230694-158230716 CCCGAGAGGCAGAGGTTGCAGGG - Intergenic
1018087086 6:160312193-160312215 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1018319762 6:162595096-162595118 CCTGAGAGGCAGAGCTTGCAGGG + Intronic
1018701778 6:166432917-166432939 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1019028835 6:168993426-168993448 CCCAACAGGCAGAGGCTGCAGGG - Intergenic
1019503390 7:1376952-1376974 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1019539026 7:1543317-1543339 ACTGGAAGGGAGAGGCTGCATGG - Exonic
1019558884 7:1646103-1646125 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1019696129 7:2447040-2447062 CCTGATGTGCTGAGGGTGCAGGG + Intergenic
1020166445 7:5811309-5811331 CCTGGGAGCCAGAGGCTGCAGGG - Intergenic
1020166973 7:5814922-5814944 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1020176324 7:5885042-5885064 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1020190871 7:5996477-5996499 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1020210642 7:6155599-6155621 CCTGAAATTCAGTGGCTGTGAGG + Intronic
1020705949 7:11544264-11544286 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1020716870 7:11685486-11685508 CCTAATATCCAGAGTCTGCAAGG + Intronic
1020830588 7:13089842-13089864 CCCGGAAGGCAGAGGTTGCAGGG + Intergenic
1020949497 7:14657704-14657726 CCAGAAATGCAGAGTCTGGTGGG - Intronic
1021158754 7:17245536-17245558 CCTGGGAGGCCGAGGCTGCAGGG + Intergenic
1021561013 7:21968647-21968669 CCTGGGAGGCGGAGGCTGCAGGG + Intergenic
1021568478 7:22038717-22038739 CCTGAAAAGCAGAAGCTGCAGGG - Intergenic
1021679474 7:23115617-23115639 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1021873761 7:25029388-25029410 CCTGAAAAGCCCAGCCTGCATGG + Intergenic
1022168284 7:27795626-27795648 CCCAGAAGGCAGAGGCTGCAGGG - Intronic
1022361431 7:29663358-29663380 CCTGGGAGGCGGAGGCTGCAGGG - Intergenic
1022822648 7:33976226-33976248 CCTGGGAGTCAGAGGCTGCAGGG - Intronic
1022935900 7:35176077-35176099 CCCAAGAGGCAGAGGCTGCAGGG + Intergenic
1023647165 7:42330092-42330114 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1023787480 7:43722473-43722495 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1023859427 7:44208572-44208594 CCTTCAATGCAAACGCTGCAAGG - Intronic
1024578138 7:50781500-50781522 TCTGAAAGGCAGCGACTGCAGGG - Intronic
1025938210 7:66054008-66054030 CCCGAAAGGCAGAGGTTGCAGGG - Intergenic
1025957037 7:66190980-66191002 CCTGAGAAGCAGAGGTTGCAGGG - Intergenic
1026286008 7:68963446-68963468 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1026772563 7:73211678-73211700 CCTGGTAGGCAGAGGTTGCAGGG - Intergenic
1027013427 7:74765078-74765100 CCTGGTAGGCAGAGGTTGCAGGG - Intergenic
1027074611 7:75180955-75180977 CCTGGTAGGCAGAGGTTGCAGGG + Intergenic
1027202158 7:76070979-76071001 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1027390838 7:77702039-77702061 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1028237038 7:88374522-88374544 CCTGTACTGCAGAGGCTGGAAGG + Intergenic
1028933781 7:96443049-96443071 CCTGGAAGGCAGTGGTTGCAAGG + Intergenic
1030564601 7:111137898-111137920 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
1031622492 7:123951695-123951717 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1031873461 7:127111950-127111972 CCCGAGAGGCAGAGGTTGCAGGG + Intronic
1031936139 7:127737497-127737519 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1032200418 7:129818647-129818669 CCTGGGAGGCAGAGGTTGCAAGG - Intergenic
1032376745 7:131427627-131427649 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1032559460 7:132873487-132873509 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1032862536 7:135894102-135894124 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1033820576 7:145129881-145129903 CCTGGCATGAAGAGGCTGCTGGG + Intergenic
1034655423 7:152725656-152725678 CCTGGAAGGTAGAGGCTGCAGGG - Intergenic
1034897642 7:154887668-154887690 CGGAAAACGCAGAGGCTGCACGG - Exonic
1035096486 7:156360179-156360201 TCTGGAATGCAGAGGCACCAAGG - Intergenic
1035640024 8:1177880-1177902 CCTGAAATTCATATGCTGAAAGG - Intergenic
1035772259 8:2156968-2156990 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1035792897 8:2323783-2323805 GCTGAAGTGCAGTGGCTGCACGG + Intergenic
1035799907 8:2397922-2397944 GCTGAAGTGCAGTGGCTGCACGG - Intergenic
1036181949 8:6593428-6593450 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1036704282 8:11034994-11035016 TATGAAATGCAGAGTCTTCAGGG - Intronic
1037344487 8:17884265-17884287 CCAGAGAGGCAGAGGTTGCAGGG - Intronic
1037475849 8:19256939-19256961 CCTGGAAGGCAGAGGTTGCAGGG + Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038921513 8:32090394-32090416 CCTGTGAGGCGGAGGCTGCAGGG - Intronic
1039031469 8:33314234-33314256 CCTCAGTTGGAGAGGCTGCAGGG - Intergenic
1039347503 8:36723570-36723592 CCTGGGAGGCAGAGGATGCAGGG + Intergenic
1039495013 8:37974070-37974092 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1039912770 8:41837928-41837950 CCTGAATGGCCAAGGCTGCAGGG + Intronic
1040544873 8:48391197-48391219 CCTGGAAGGTCGAGGCTGCAGGG + Intergenic
1040834284 8:51716284-51716306 CCAGAAATGCAATGGCTCCAAGG - Intronic
1041266363 8:56069372-56069394 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1041425050 8:57711404-57711426 CCTGAATTCCAAATGCTGCAGGG + Intergenic
1042563678 8:70092441-70092463 AATGCACTGCAGAGGCTGCAGGG + Intergenic
1043968226 8:86503274-86503296 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
1044649575 8:94480398-94480420 CCCGGAAGGCAGAGGTTGCAGGG + Intergenic
1045341334 8:101257358-101257380 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1045342604 8:101267991-101268013 CCTGGACTCCAAAGGCTGCAGGG - Intergenic
1045505016 8:102772140-102772162 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
1045989981 8:108295689-108295711 CCTGGGAGGTAGAGGCTGCAGGG - Intronic
1046732409 8:117739752-117739774 CCTGGAAGGTTGAGGCTGCAGGG - Intergenic
1047314057 8:123716159-123716181 CCCGGGAGGCAGAGGCTGCAGGG - Intronic
1047322195 8:123796983-123797005 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1047366578 8:124216963-124216985 CCTGATAGGCAGAGGCCCCATGG + Intergenic
1047681071 8:127254580-127254602 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1048344493 8:133566520-133566542 CCTGCAATGCGGGGGATGCAGGG - Intronic
1048639850 8:136343465-136343487 CCTGGAAAGTTGAGGCTGCAAGG + Intergenic
1048849268 8:138629230-138629252 CCTGGGAGGCAGAGACTGCAGGG - Intronic
1049540851 8:143208138-143208160 CCTGATGTGCAGAGGCTGCCAGG + Intergenic
1049894682 9:102202-102224 CCTGAAAGCCAGATGCTACAAGG - Intergenic
1049910169 9:258199-258221 CTTGAATAGCAGAGGCTGGAAGG + Intronic
1050575007 9:6985764-6985786 CCTGAGAGGCAGAGGTTGCAGGG - Intronic
1052784058 9:32812339-32812361 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
1052836997 9:33258218-33258240 CCTGGCAGGCAGAGGCTACAGGG + Intronic
1053720990 9:40946422-40946444 CCTAAATTTCAGAGGATGCATGG - Intergenic
1053735888 9:41102192-41102214 CCTGAAAGCCAGATGCTACAAGG - Intergenic
1054345000 9:63905734-63905756 CCTAAATTTCAGAGGATGCATGG + Intergenic
1054692485 9:68329206-68329228 CCTGAAAGCCAGATGCTACAAGG + Intronic
1054722288 9:68616081-68616103 CCTGGAAGGCGGAGGTTGCAGGG + Intergenic
1055052581 9:71995142-71995164 GCTGGAATGCAGAGGATTCACGG + Intergenic
1055052825 9:71996854-71996876 CCTGAGAGGCAGAGGTTGTATGG + Intergenic
1055243894 9:74217703-74217725 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1055317018 9:75043745-75043767 CCTGGAAGGCAGAGGTGGCAGGG + Intergenic
1055395445 9:75869016-75869038 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1056225638 9:84492585-84492607 CCTGAAGTGCAGAGGTTCCAGGG - Intergenic
1056486322 9:87061832-87061854 CCTGGGAGGTAGAGGCTGCAGGG - Intergenic
1056654030 9:88494858-88494880 CCCGGGAGGCAGAGGCTGCAGGG - Intergenic
1057606739 9:96503775-96503797 CTTGAAATGGAGAGACTACAGGG + Exonic
1058255696 9:102759865-102759887 CCTGAGAGGCGGAGGTTGCAGGG + Intergenic
1059115034 9:111593759-111593781 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1059213488 9:112537179-112537201 CCTGGAAGGCAGAGGTTCCAGGG - Intronic
1060225189 9:121786152-121786174 CCTGAGATGCTGAAGATGCAGGG - Intergenic
1060275234 9:122177506-122177528 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1060486038 9:124046812-124046834 CCTGGAAGGTGGAGGCTGCAGGG - Intergenic
1060691723 9:125667393-125667415 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1060994281 9:127867479-127867501 CCTGGACTGCACAGGCAGCAAGG - Exonic
1061234209 9:129333145-129333167 CCTGGGAGGCAGAGGCTGCGGGG - Intergenic
1061364294 9:130163388-130163410 CCTGGGAAGCAGAGGCTGCAGGG - Intergenic
1061610547 9:131742553-131742575 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1185820585 X:3199219-3199241 GCTGGAGTGCAGAGGCTTCAGGG - Intergenic
1185834937 X:3336657-3336679 ACTGAATTGTAGAGGCTACAAGG + Intronic
1185862779 X:3594497-3594519 CCTGAGAGGCCAAGGCTGCAGGG + Intergenic
1185873442 X:3683102-3683124 TCTGAAGTGCAGATGCGGCAGGG - Intronic
1185921119 X:4093958-4093980 CCTGACAGGCAAAGGTTGCAGGG + Intergenic
1185972707 X:4682297-4682319 CCTGGGAGGCAGAGGCTGCACGG + Intergenic
1186491194 X:9974123-9974145 CCTGAGAGGCAGTGGTTGCACGG - Intergenic
1187115867 X:16350055-16350077 CCTGGGAGGCGGAGGCTGCAGGG - Intergenic
1187168141 X:16824108-16824130 CCTGAAGTGCAGATGCTACAGGG - Intronic
1187361868 X:18635898-18635920 TTTGTATTGCAGAGGCTGCATGG + Intronic
1187381614 X:18807103-18807125 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1187516543 X:19976464-19976486 CCCGAGAGGCGGAGGCTGCAGGG - Intergenic
1189896159 X:45658784-45658806 CCTGTATTTCAGAGGATGCATGG + Intergenic
1189980637 X:46506826-46506848 CCAGCAATGCAGAGGGTGAAGGG + Intronic
1190190049 X:48269448-48269470 CCTGGTAGGCAGAGGTTGCAGGG - Intronic
1191611443 X:63118829-63118851 CCCGGGAGGCAGAGGCTGCAGGG - Intergenic
1192119970 X:68446401-68446423 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1193226466 X:78989756-78989778 CCTGAATTTCAGAGGATGTATGG + Intergenic
1194757794 X:97758154-97758176 CCTGGAAGGCCGAGGTTGCAGGG + Intergenic
1196157834 X:112450403-112450425 CCTGAAATACACAGGCTTGAGGG - Intergenic
1197058932 X:122153901-122153923 CCTGAATTTCAGAGGATGTATGG + Intergenic
1197257467 X:124279135-124279157 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1197839083 X:130726292-130726314 CTTGTAAAGCAGAGGCTCCATGG + Intronic
1198462359 X:136876197-136876219 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1198741014 X:139842646-139842668 GCTGAAATGTAGAGGCTGACTGG + Intronic
1199338392 X:146646195-146646217 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1200177988 X:154131505-154131527 CCTGAGAGACAGAGGTTGCAGGG - Intergenic
1200790862 Y:7298003-7298025 TCTGAAGTGCAGATGCAGCAGGG + Intergenic
1201784875 Y:17764286-17764308 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1201816677 Y:18141701-18141723 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1201853441 Y:18514867-18514889 CCTGGAAGGCAGAGGCTGCTGGG + Intergenic
1201879880 Y:18805517-18805539 CCTGGAAGGCAGAGGCTGCTGGG - Intronic
1202125964 Y:21569159-21569181 CCTGAAATCCAGAGTTTGCCAGG - Intergenic
1202344692 Y:23909107-23909129 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1202526076 Y:25760976-25760998 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic