ID: 1167930259

View in Genome Browser
Species Human (GRCh38)
Location 19:52857739-52857761
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 623
Summary {0: 2, 1: 1, 2: 13, 3: 74, 4: 533}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167930246_1167930259 30 Left 1167930246 19:52857686-52857708 CCGGGTGAGGTGTGGGCGGGGCG 0: 2
1: 0
2: 3
3: 32
4: 271
Right 1167930259 19:52857739-52857761 CGCAGAGGGCGGGGCCGGAGCGG 0: 2
1: 1
2: 13
3: 74
4: 533
1167930248_1167930259 -6 Left 1167930248 19:52857722-52857744 CCTTGCCCTTTAGAACCCGCAGA 0: 2
1: 4
2: 3
3: 11
4: 173
Right 1167930259 19:52857739-52857761 CGCAGAGGGCGGGGCCGGAGCGG 0: 2
1: 1
2: 13
3: 74
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167930259 Original CRISPR CGCAGAGGGCGGGGCCGGAG CGG Intergenic
900121334 1:1049794-1049816 CGGTGAGGGTGGGGCCGGGGCGG + Exonic
900154143 1:1197382-1197404 GGCAGAGGCTGGGGCTGGAGGGG - Intronic
900244304 1:1630455-1630477 CGCTGAGCGCGGAGCCGCAGGGG - Exonic
900245159 1:1633135-1633157 CGCGCAGGGCCGGGCCGGGGCGG - Intronic
900256390 1:1700294-1700316 CGCGCAGGGCCGGGCCGGGGCGG - Intronic
900349481 1:2227947-2227969 CGCGGGGGGCGGGGCCGGCGCGG + Intergenic
900350175 1:2230550-2230572 CGCAGAGGGGTGCGCCGGAGAGG + Intronic
900432896 1:2611376-2611398 CGGAGAGGGTGGGGCAGGACTGG + Intronic
900599961 1:3498710-3498732 CCCAGAGGGCTGGGCCGGCCTGG - Exonic
901089575 1:6632396-6632418 CCCTGAGGCGGGGGCCGGAGAGG + Exonic
901199164 1:7457033-7457055 CGCAGGGGGCGGGGCGGGTGAGG - Intronic
901232606 1:7649533-7649555 AGCAGAGGGTGGGCACGGAGAGG + Intronic
901465262 1:9417269-9417291 GGCCGAGGGCTTGGCCGGAGGGG + Intergenic
901629207 1:10640203-10640225 GGGAGGGGGCGGGGCAGGAGAGG - Intronic
901730016 1:11272952-11272974 GGGAGGGGGCGGGGCCGGGGCGG - Intergenic
902375079 1:16026784-16026806 CCCAGGGGGCGGGGCATGAGGGG - Intronic
902634093 1:17723892-17723914 TGCTGAGAGCGGGGCTGGAGAGG + Intergenic
903078109 1:20787344-20787366 CGCGGGAGGCGGGGCCGGCGGGG - Intergenic
903227928 1:21904339-21904361 CGCTGAGGCCAGGGCTGGAGAGG + Intronic
903233796 1:21937112-21937134 GGCGGGGGGCGGGGGCGGAGGGG - Intronic
903251115 1:22053364-22053386 CCCAGAGGACGCGGCCGGCGCGG - Intronic
903750416 1:25617489-25617511 CGGGGAGGGCTCGGCCGGAGGGG + Exonic
904050215 1:27634306-27634328 CGCGGAGGGGGCGCCCGGAGAGG + Intronic
904199765 1:28812200-28812222 CGCCGGGGGCTGGGCCGGTGCGG + Exonic
904437188 1:30506605-30506627 GGCAGGGGGCGGGGCTGCAGTGG - Intergenic
904813878 1:33181445-33181467 AGCAGAGAGGGGGGCCCGAGGGG + Exonic
904814091 1:33182123-33182145 CGCAGCGGGCGGGGGAGGGGCGG + Intergenic
904826455 1:33276600-33276622 CCGAGCGGGCGGGGCCGGCGGGG + Intronic
904901340 1:33859664-33859686 CACAGAGGAAGGGGCAGGAGGGG + Intronic
905182251 1:36174795-36174817 CTCCGAGGGCGGGGTGGGAGAGG - Intronic
905201816 1:36321247-36321269 CGCTGGGGGCGGGGCCTGCGCGG + Exonic
905212812 1:36385968-36385990 GGCGGAGGGCGGGGCCCGGGGGG - Intergenic
905647291 1:39633317-39633339 CGCAGAGGGAAGGCCCGGAGTGG - Intronic
905755878 1:40508792-40508814 GGCAGAGCGCGCTGCCGGAGCGG - Exonic
905796372 1:40818747-40818769 CGGAGAGGGCGAGGTCAGAGGGG + Intronic
905796417 1:40818895-40818917 ATCAGGGGGCGGGGCCGGAGAGG + Intronic
906027025 1:42682607-42682629 CGCTGAGGGCGGGGGCGGCGGGG - Exonic
906090291 1:43172669-43172691 GGCCGGGGGCGGGGTCGGAGCGG + Intronic
906517506 1:46448314-46448336 CGCGGCAGGCGGGGCGGGAGCGG - Intergenic
906662230 1:47591000-47591022 CCCAGAGGGCTGGGCCTGGGAGG - Intergenic
906734937 1:48116290-48116312 AGCAGAGAGGGGGGCCTGAGAGG - Intergenic
907080439 1:51617028-51617050 TGCGGGGGGCGGGGCCGCAGGGG - Intronic
911664273 1:100536335-100536357 GGCAGGGGCAGGGGCCGGAGGGG - Intergenic
911943170 1:104073155-104073177 CCCTGAGGCGGGGGCCGGAGAGG + Intergenic
912642381 1:111359862-111359884 CTCAGAGACCGGTGCCGGAGTGG - Intergenic
912741166 1:112198915-112198937 CTCAGAGGGTGGGGGCTGAGGGG - Intergenic
913144514 1:115976485-115976507 CGCTGGCGGCGGGGCCGGGGCGG - Exonic
913498244 1:119447909-119447931 TGCAGAGGACGGGGCAGGAGGGG - Intergenic
913532067 1:119740534-119740556 TGCAGAGGGAGGGGGAGGAGGGG + Intronic
914869063 1:151458639-151458661 CGCGGCGGGAGGGGCCGGCGAGG - Intronic
915470663 1:156123953-156123975 GGCAGAGGGAGGGGCTGAAGTGG - Intronic
915497357 1:156291600-156291622 CTCCGAGGGCGAGGGCGGAGAGG - Exonic
915552257 1:156642050-156642072 CGGGGAGGGCGGGGCAGGGGCGG + Exonic
915586910 1:156848893-156848915 TGCCGGGGGCGGGGCCGGAGCGG - Intronic
915835736 1:159173215-159173237 GGCACAGGGCGGGGCGGGGGTGG + Intronic
916048896 1:161021176-161021198 CGCGGAGGGCGGGGCCGGGCGGG - Exonic
916174195 1:162023980-162024002 CGCACAGGGCTCGGGCGGAGGGG + Intergenic
916666929 1:166975347-166975369 GGCAGCGGGCGGCGGCGGAGCGG + Intronic
916694450 1:167221484-167221506 GGGAGGCGGCGGGGCCGGAGCGG + Intronic
919800731 1:201353317-201353339 CGCAGTGGGCGGGGTGGGAGAGG - Intergenic
919820546 1:201469265-201469287 CCCCGGGGGCGGGGCCGCAGCGG + Intergenic
920071790 1:203307440-203307462 CGCCCAGGGCGGGGGCGGAAGGG - Exonic
921060448 1:211579667-211579689 CGGCGGGGGAGGGGCCGGAGGGG + Intergenic
922119036 1:222644234-222644256 CGGCGAGGGCGGGGCCAGAGCGG - Intronic
922250638 1:223845996-223846018 CGCCGCGGGCGGGGTCGGCGCGG - Intergenic
922335854 1:224617550-224617572 AGGAGAGGACGGGGCGGGAGAGG - Intronic
922783945 1:228273851-228273873 CGCAGAGGGTGTGGCCAGTGTGG - Exonic
922817269 1:228458791-228458813 CGCGGAGGGAGGGGATGGAGAGG - Exonic
1062774475 10:134736-134758 CGCCGAGGCCGGGGCGCGAGGGG - Exonic
1062789025 10:289725-289747 CGCAGAGGGCTGTGCTGGACTGG - Intronic
1062857112 10:784847-784869 CGCAGCGCCCGGGGCAGGAGTGG + Intergenic
1063123695 10:3122661-3122683 CACAGAGGGTGTGGCCGGACAGG - Intronic
1063907815 10:10798730-10798752 GGCTGAGGGCGAGTCCGGAGAGG - Intergenic
1064981694 10:21173140-21173162 GGCAGGGGGCAGGGCTGGAGGGG + Intronic
1065099603 10:22320838-22320860 CGCGGCGTGCGGGGCCGGAGCGG + Intronic
1065588429 10:27241750-27241772 CGTAGAGGGCGGGGCCAATGAGG + Intronic
1065590382 10:27256809-27256831 CGGGGGGGGCGGGGCGGGAGCGG - Intergenic
1065724979 10:28660620-28660642 CCCAGAGGGTGGGGCCCCAGGGG + Intergenic
1065797251 10:29318892-29318914 CGGAGAGGGGAGGGCAGGAGAGG + Intergenic
1065883630 10:30058902-30058924 CGCAGAGACCGGAGCGGGAGCGG + Intronic
1067669616 10:48306950-48306972 CGCGGTGGGCGGGGGCGGCGCGG + Intronic
1067841009 10:49679588-49679610 CGCGCCGGGCGGGGCCGGGGTGG - Intergenic
1068788363 10:61001501-61001523 GGGAGAGGGCGGGGTCGGCGGGG - Intergenic
1069557380 10:69407053-69407075 GGCAGAGGGTGGGGCTGGAGTGG + Intronic
1070148787 10:73792777-73792799 GGCCGAGGGCGGGGCTGGGGAGG + Exonic
1070328302 10:75401710-75401732 CGCAGAGCGCAGCGCCGGCGCGG - Exonic
1070756440 10:78996526-78996548 CGCTGGGGGTGGGGGCGGAGGGG - Intergenic
1072656762 10:97335005-97335027 CCCAGGAGGCGGGCCCGGAGTGG - Intergenic
1072903500 10:99430321-99430343 TGAAGAGGGCGGCGCCGGAGAGG - Intronic
1073196394 10:101695039-101695061 CGGCGAGGGCGAGGGCGGAGAGG - Exonic
1073249928 10:102115035-102115057 GGGAGGGGGCGGGGCCGGTGGGG - Intronic
1074088362 10:110225923-110225945 GGCAGAGGCAGGGGCGGGAGGGG + Intronic
1074829956 10:117241245-117241267 CGCAGGGCGCGGTGCCGGAGGGG + Intronic
1075031900 10:119029632-119029654 CGCAGGGGGCAGGGCCGCGGCGG + Intergenic
1075483470 10:122801019-122801041 TGCAGAGGGCGGTGGCTGAGTGG - Intergenic
1075699836 10:124462053-124462075 GGCAGGGGGCGGGGCGGCAGGGG + Intronic
1076469947 10:130711271-130711293 TGCAGAGGGCAGGGCAGGTGGGG + Intergenic
1076707091 10:132307982-132308004 CGCTGGGGGCGGGGCAGGGGCGG + Intronic
1076879103 10:133231216-133231238 CGACGGGGGCGCGGCCGGAGGGG - Exonic
1076999708 11:316401-316423 CCCAGAGGGCGGAGACTGAGAGG + Intergenic
1077008516 11:369979-370001 CGCGGGGGGCGGGGGCGGCGCGG + Intronic
1077285754 11:1764470-1764492 CCCAGAGGGAGAGGGCGGAGCGG - Intergenic
1077327861 11:1971454-1971476 GGTGGAGGGCAGGGCCGGAGAGG - Intronic
1077367279 11:2166313-2166335 GGCATAGGGCGGGGCTGGAGCGG - Intronic
1077419812 11:2444941-2444963 CGCTCGGGGCGGGGCCGGAGGGG - Intronic
1077972788 11:7212801-7212823 CAGAGAGGGCTGGGCAGGAGAGG + Intergenic
1079278143 11:19060877-19060899 TGCAGGGAGTGGGGCCGGAGAGG - Intergenic
1081807873 11:45900094-45900116 GTCAGGGGGCGGGGCCGGGGCGG - Intronic
1083419941 11:62546874-62546896 GGGAGAGGGCGGGGCCGGGCGGG + Intronic
1083895134 11:65616129-65616151 AGCAGGGGGCGGGGCCGGCCGGG - Exonic
1083952089 11:65962112-65962134 CGCAGGGGGCGGGTCGGGCGGGG + Intronic
1084151244 11:67289004-67289026 AGAGGAAGGCGGGGCCGGAGGGG - Intronic
1084238827 11:67805389-67805411 GGCAGTGGGCGGGGGCAGAGAGG + Intergenic
1084321106 11:68373818-68373840 CACAGAGGATGGGGCTGGAGGGG - Intronic
1084465557 11:69321030-69321052 AGCAGAGGGCAGGCCTGGAGGGG - Intronic
1085037180 11:73307722-73307744 CGCAGAGGGCGGGCGGGGAGGGG + Intergenic
1085456991 11:76670863-76670885 CGGAGCCGGCGGGGGCGGAGTGG + Intergenic
1085458483 11:76679089-76679111 TGCAGAGGACGGGGCAGGTGAGG - Intergenic
1085474924 11:76783561-76783583 CGCCTAGGGCTGGGCGGGAGTGG + Intronic
1085519179 11:77128191-77128213 CCCAGGAGGCGGAGCCGGAGGGG - Intergenic
1086166845 11:83789366-83789388 AGGACAGGGCGGGGCGGGAGGGG + Intronic
1086393241 11:86387806-86387828 GGCAGAGGGAGGGGCCAAAGTGG + Intronic
1089208919 11:116787910-116787932 GGCAGGCGGCGGGGCCGGGGCGG + Exonic
1089374764 11:117986434-117986456 CGCATCGTCCGGGGCCGGAGCGG - Exonic
1089845086 11:121452190-121452212 CGCAGCGGGGCGGCCCGGAGCGG + Exonic
1090710013 11:129375698-129375720 CGCGCAGGTCGGCGCCGGAGTGG + Intergenic
1091224026 11:133946947-133946969 CGCAGAGGGGGGAGTGGGAGGGG + Intronic
1091280868 11:134380781-134380803 GGCTGAGGGTGGGGCCGGGGAGG + Intronic
1202810841 11_KI270721v1_random:26634-26656 GGTGGAGGGCAGGGCCGGAGAGG - Intergenic
1092038707 12:5364151-5364173 TGCAGAGGGATGGGCCAGAGGGG - Intergenic
1095977553 12:47950063-47950085 CGCCGAGCAGGGGGCCGGAGGGG + Intergenic
1096191587 12:49623494-49623516 CCGGGAGGGCGGGGCCGGCGGGG - Exonic
1096411010 12:51377180-51377202 CACAGAGGGTGAGGCTGGAGGGG - Exonic
1096515217 12:52151981-52152003 TGCAGAGGGCGTGGCTGGTGTGG + Intergenic
1096618199 12:52846522-52846544 AGGAGAGGGCGGGGAGGGAGAGG - Intronic
1096870315 12:54588577-54588599 GGCTGGGGCCGGGGCCGGAGCGG - Exonic
1097019184 12:56007786-56007808 AGCCGGGGGCGGGGCCTGAGGGG + Intronic
1097872009 12:64610130-64610152 CGGAGAGGGCGGGAGCAGAGCGG - Intergenic
1102180828 12:110911238-110911260 GGCTGTGGGCGGGGCCTGAGTGG + Intronic
1103320075 12:120087274-120087296 CGCAGTGGGCGGGGCTGACGCGG + Intronic
1103800392 12:123533862-123533884 GGCAGAGCGCGGGGCCGGAGAGG + Intergenic
1103862462 12:124025844-124025866 CGCAGAGGCCTGGGTTGGAGGGG + Intronic
1104009111 12:124916594-124916616 TGCAGAGGCAGGGGCGGGAGAGG + Intronic
1104058026 12:125245370-125245392 TGCAGAGGGGTGGGCGGGAGGGG - Intronic
1104256746 12:127146186-127146208 CGCAGAGAGCGAGGCCGGCGAGG - Intergenic
1104633412 12:130423547-130423569 CCCAGACGGCAGGGCCGGCGGGG + Intronic
1104928622 12:132326902-132326924 CGGGGAGGGCGGTGCCGTAGAGG - Intronic
1105514305 13:21076424-21076446 CGCACAGTGCAGGGGCGGAGGGG + Intergenic
1105767903 13:23579287-23579309 CGGTGAGGGCGGGGCCCGGGTGG + Intronic
1112208197 13:97346730-97346752 CGCGGTGGCCGGGGCCGCAGGGG + Intronic
1113541655 13:111114645-111114667 TGCAGAGGGCCGGGCCGGGCCGG - Intronic
1113543076 13:111123868-111123890 GGCAGGGGGCGGGGCCGGGGGGG - Intronic
1113737750 13:112690301-112690323 CGCCGAGGCCGTGACCGGAGCGG + Intergenic
1114516170 14:23301628-23301650 CGGCGGGGGCGGGGCCGGACCGG + Exonic
1114957813 14:27845690-27845712 AGCAGAGGGCGGTGCCGGTCGGG - Intergenic
1115331327 14:32201671-32201693 CGCAGAGGACAGGGCCGGCCTGG - Intergenic
1118289321 14:64505019-64505041 GGCGGAGTGCGGGGCCGGAGGGG + Intronic
1119720227 14:76885150-76885172 CCCAGAGGGCAGGGCGGGGGAGG + Intergenic
1119720701 14:76888301-76888323 AGATGAGGGTGGGGCCGGAGTGG - Intergenic
1119743709 14:77029450-77029472 GGGAGGGGGAGGGGCCGGAGAGG + Intergenic
1120976578 14:90254215-90254237 CAGAGGGGGCGGGGCCGGGGTGG - Intergenic
1121199651 14:92106593-92106615 GGCAGGGGGCGGAGCTGGAGGGG - Exonic
1122736696 14:103847606-103847628 CGCTGGGGGCGGGGCCTGCGGGG - Intergenic
1122768210 14:104085645-104085667 CTGGGAGGGCGGGGCCGGCGGGG - Intergenic
1123040153 14:105487111-105487133 TTCAGAGGGCGGGGCGCGAGGGG + Intergenic
1125664151 15:41417078-41417100 AGCAGGGGGCGGGGCCAGGGGGG + Intronic
1125675960 15:41502764-41502786 TGCAGAGGGTGGGGTGGGAGAGG - Intronic
1126113266 15:45187688-45187710 CGCGGGGGGCGCGGCCGGAGAGG + Intronic
1127423582 15:58833485-58833507 CTCAGAGGCCGGTGCCGGCGTGG - Intronic
1127819087 15:62639742-62639764 CCCAGAGGGCAGGGCCTGAGTGG - Intronic
1127867183 15:63042494-63042516 CGCCGAGGCGGCGGCCGGAGAGG - Intergenic
1128838434 15:70830041-70830063 AGCATAGGGCGGGGCTGGAGGGG + Exonic
1128861040 15:71072498-71072520 TGCAGAGGAAGGGGCCCGAGCGG + Intergenic
1128987390 15:72231243-72231265 GGCAGAGGGCGGGGCGGCGGAGG - Exonic
1129644646 15:77419594-77419616 CGGGGAGGCCGGGGCAGGAGGGG - Intronic
1129676059 15:77632869-77632891 TGCAGAGCGCGGAGCCCGAGCGG - Intronic
1130105946 15:80928590-80928612 CACAGAGGATGGGGCTGGAGAGG + Intronic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1132099771 15:99015076-99015098 CGTCGAGTGCGGGGCCGGCGGGG + Intergenic
1132320197 15:100919616-100919638 CGCAGGGGCCGCGGCCCGAGGGG + Intronic
1132462234 16:61352-61374 GGCTGGGGGCGGGGCCGGCGGGG - Intronic
1132589776 16:721545-721567 GGCTGCGGGCGGGGCGGGAGCGG + Intronic
1132698438 16:1212209-1212231 CGGGGAGGCCGGGGCGGGAGTGG - Intronic
1132700913 16:1221721-1221743 GGGAGAGGGAGGGGGCGGAGCGG + Exonic
1132839491 16:1972167-1972189 GGCAGAGACCGCGGCCGGAGTGG + Exonic
1133052272 16:3124034-3124056 CGGTGAGGGCGGAGGCGGAGAGG + Intergenic
1133259428 16:4538564-4538586 CGCCGCGGGCGGGGGCGGGGAGG + Intronic
1133328716 16:4958190-4958212 CGCCTGGGGCGGGGCCAGAGTGG + Intronic
1133350623 16:5098231-5098253 CTCAGGAGGCGGGGCCGGGGCGG + Intergenic
1135027182 16:19007395-19007417 CGCAGAGGGCCAGGCCAGTGTGG + Intronic
1135326089 16:21526633-21526655 AGGAGAGGGTGGGGGCGGAGGGG + Intergenic
1135822026 16:25692872-25692894 CTCAGAGCGCGCTGCCGGAGAGG + Exonic
1136129760 16:28212121-28212143 CGCAGGGGGCGGGGCAAGAGAGG - Intergenic
1136223640 16:28844646-28844668 TGCAGAGGGTGGGGCTGGATGGG - Intronic
1136377911 16:29876444-29876466 CGCAGAGGAGGGGTCAGGAGGGG + Intronic
1136382042 16:29900334-29900356 CGTATCGGGCGGGGCCTGAGGGG - Intergenic
1136605631 16:31331511-31331533 CCAGGAGGGCGGGGCGGGAGGGG - Intronic
1136690368 16:32024256-32024278 CACAGTGGGCGGGGGCTGAGAGG + Intergenic
1136790957 16:32967820-32967842 CACAGTGGGCGGGGGCTGAGAGG + Intergenic
1136878856 16:33886112-33886134 CACAGTGGGCGGGGGCTGAGAGG - Intergenic
1137444772 16:48525019-48525041 CACAGAGGGAGGGGCAGGAGTGG - Intergenic
1137683317 16:50369105-50369127 GGCCGAGGGCGGGGCCGGGGCGG + Intergenic
1138031021 16:53559445-53559467 CCCAGAGGCCGGGTCTGGAGTGG - Intergenic
1138370030 16:56519643-56519665 GGCTGGGGGCGGGGTCGGAGAGG + Intronic
1139433224 16:66922336-66922358 CACAGAGGGCCGGGCCTGCGCGG - Exonic
1139576115 16:67843148-67843170 CGCAGAGGGCGCAGCCGCTGCGG + Exonic
1139775062 16:69311650-69311672 CGGCGAGGGGGCGGCCGGAGCGG - Intronic
1140664046 16:77212619-77212641 CCCCGAGGTCGGGGCCGGCGAGG + Exonic
1141665395 16:85462964-85462986 GGCAGAAGACGGGCCCGGAGGGG - Intergenic
1141686556 16:85573694-85573716 CACAGTGGGCGCGTCCGGAGGGG + Intergenic
1141828121 16:86494993-86495015 CGCCGAGGGCGCGGAGGGAGCGG + Intergenic
1142029935 16:87833408-87833430 CACAGCAGGCAGGGCCGGAGGGG + Intronic
1142039127 16:87881358-87881380 AGGAGAGGGCGGGGGCGGAGGGG + Intergenic
1142136217 16:88453154-88453176 CGCTGGGGGCGGAGCCGGAGAGG + Intergenic
1142412219 16:89922714-89922736 CGCAGTGGGCGGGGAGGGGGTGG - Intronic
1142417178 16:89949101-89949123 CGGCGAGGTCGGGGCCGGCGGGG + Intronic
1203093164 16_KI270728v1_random:1229277-1229299 CACAGTGGGCGGGGGCTGAGAGG + Intergenic
1142623754 17:1179987-1180009 CGCGGGGGGCGGGGCGGGGGTGG + Intronic
1142876298 17:2853653-2853675 CGCGGGAGGCGGGGCCGGGGCGG + Intronic
1143183403 17:4997590-4997612 GTCTGAGGGCGGGGCCTGAGCGG + Intronic
1143465120 17:7131376-7131398 GGCAGAGGATGGGGCCAGAGAGG + Intergenic
1143485562 17:7251846-7251868 CGCAGAGCGCTGGGCCGGAGCGG + Intronic
1143670496 17:8392897-8392919 AGCAGAAGGCGCGGGCGGAGCGG + Exonic
1144045062 17:11447905-11447927 AGCAGTGGGCAGGGCTGGAGGGG + Intronic
1145236982 17:21214953-21214975 CGCAGCGGCCAGGGCAGGAGTGG - Intergenic
1145865843 17:28241011-28241033 GGCAGAGGTCGGGGGCGGAAGGG + Intergenic
1146382593 17:32341942-32341964 GGCCGGGGGCGGGGCCGCAGGGG + Intronic
1147138960 17:38451079-38451101 CCCAGAGGGTGGTGGCGGAGGGG - Intronic
1147153225 17:38530391-38530413 CACAGTGGGCGGGGGCTGAGAGG + Exonic
1147331204 17:39700381-39700403 CGCGGCCGGCGGGGCCAGAGGGG + Intronic
1147935327 17:44007509-44007531 CCCAGAGGGCGGGGTCTGGGGGG + Intronic
1147996811 17:44363976-44363998 CGCAGAGCGCGGGGGCTGCGGGG - Intergenic
1148108692 17:45132581-45132603 GGAAGGGGGCGGGGCCGGGGCGG + Exonic
1148183963 17:45627878-45627900 CACAGAGCCGGGGGCCGGAGAGG + Intergenic
1148455779 17:47810743-47810765 AGTAGAGGGCAGGGCCGGGGTGG - Intronic
1151457912 17:74237532-74237554 GGCAGAGGGAGGGGCAGCAGCGG + Intronic
1152132301 17:78484803-78484825 CGGTGAGGGCGGGGCCAGGGCGG - Intronic
1152244304 17:79177205-79177227 GGGAGAGGGCGGGGGGGGAGAGG - Intronic
1152293622 17:79454388-79454410 CGCAGAGGGCAGGCCAGGAGGGG - Intronic
1152433321 17:80261067-80261089 CGCCGCGGGCGGGGCTGGACCGG - Intronic
1152587869 17:81197125-81197147 CCCAGAGGGCAGGGCCGCAGGGG - Intronic
1152691974 17:81722441-81722463 TGCAGAGGGTGGGGTGGGAGAGG + Intergenic
1152719882 17:81918223-81918245 CGCGGCGGGCGGAGCCGGAAGGG - Intronic
1152741005 17:82018296-82018318 GGCAGGGGGCGTGGCCCGAGGGG + Intergenic
1152821318 17:82439221-82439243 GGGAGAGGGTGGGGCAGGAGGGG + Intronic
1152870741 17:82751852-82751874 CGCGGTGGGCGGGGCAGGACAGG - Intergenic
1152923955 17:83079333-83079355 AGCGGAGTCCGGGGCCGGAGGGG - Intergenic
1153006275 18:500805-500827 GGCCGAGGGCGGGGCGGGCGCGG - Intergenic
1153040913 18:812333-812355 GTCAGGGGGCGGGGCCGGGGGGG - Intronic
1153565579 18:6414661-6414683 CGGCGAGGGCCGGGCCGGTGGGG - Intronic
1153911464 18:9709015-9709037 AGCCGAGGGCGCGGCCGGGGTGG + Intronic
1154193268 18:12247654-12247676 AGCTGAGGACGGGGCAGGAGAGG + Intergenic
1154329492 18:13418106-13418128 CTCAGAGGGCGGGTGGGGAGCGG - Intronic
1155218418 18:23662883-23662905 CACACAGGGCCGGGCCGAAGGGG + Exonic
1156350431 18:36297659-36297681 CGCGGGGGGCGGGGCGGGGGCGG - Intergenic
1156448589 18:37254046-37254068 GGCCGGGGGCGGGGCCCGAGGGG - Intronic
1156647528 18:39184244-39184266 CGCAGAGATAGGGGCCTGAGCGG - Intergenic
1157863161 18:51159761-51159783 TGCAGAGGGCAGGGACGGGGAGG + Intergenic
1157928027 18:51787798-51787820 TGCAGAGGGCAGGGGCGGTGAGG + Intergenic
1158658173 18:59359428-59359450 CGCAGGGGGCGGGTCTGGGGCGG + Exonic
1160288025 18:77564685-77564707 CACAGAGGGCTGGCCTGGAGAGG - Intergenic
1160508282 18:79439335-79439357 CTCCTGGGGCGGGGCCGGAGCGG - Intronic
1160513629 18:79466501-79466523 CGCAGAGGTCGGGGCTGGGTGGG - Intronic
1160521268 18:79509446-79509468 TGCAGAGGGCGTGGGAGGAGAGG + Intronic
1160663400 19:311972-311994 TGCCCAGGGCGGGGCCGCAGCGG + Intronic
1160663419 19:312029-312051 CGCCCAGGGCGGGGCCGCAGCGG + Intronic
1160663439 19:312086-312108 CGCCCAGGGCGGGGCCGCAGCGG + Intronic
1160663458 19:312143-312165 TGCCCAGGGCGGGGCCGCAGCGG + Intronic
1160744455 19:704107-704129 TGCAGGGGGCGGGGTCGGGGCGG + Intergenic
1160808220 19:1001681-1001703 AGGAGAGGGAGGGGCTGGAGGGG - Intronic
1160862908 19:1245205-1245227 GGCACAGGGCGGGGCCAGCGTGG - Intergenic
1160912609 19:1481851-1481873 CGCAGAGGACGGGGCCTCCGAGG + Exonic
1160930752 19:1568432-1568454 CGCGCGGGGCGGGGCCGGGGCGG + Intergenic
1161095001 19:2385154-2385176 CGCGGAGGGCGGGGCTCGCGGGG + Intergenic
1161250240 19:3276233-3276255 CTCTGAGGGCGGGGCCTGTGGGG + Intronic
1161471126 19:4457324-4457346 CGCAGGGGGCGGGGCGGGAGGGG - Intronic
1161620163 19:5293319-5293341 TGCAGTGGGCGGGGCTGCAGGGG + Intronic
1161772801 19:6240421-6240443 CGCAGAGGGCGGGCTCCAAGCGG + Intronic
1161913631 19:7212929-7212951 CTGAGGGGGCGGGGCTGGAGAGG - Intronic
1161976913 19:7612221-7612243 GGCAGAGGCTGAGGCCGGAGCGG + Exonic
1162032955 19:7925230-7925252 CTCAGAGGGCCGGCCCGGCGGGG - Exonic
1162033255 19:7926187-7926209 CGCGGGGGGCGGGGCTGCAGGGG + Intergenic
1162145856 19:8611623-8611645 CGGAGAGGGCGGGGCCGAGCTGG - Intergenic
1162289625 19:9768993-9769015 CGCAGCGGGCGGGGCACGCGTGG + Intronic
1162327876 19:10009509-10009531 GGCGCAGGGCGGGGCAGGAGTGG - Intronic
1162373295 19:10291385-10291407 CCCAGGGGGCGGGGCCTGGGAGG - Intronic
1162478785 19:10916050-10916072 CACAGACGGCAGGGCCTGAGAGG + Intronic
1162575731 19:11497760-11497782 GGGAAAGGGCTGGGCCGGAGAGG - Intronic
1162609522 19:11738580-11738602 CGCCGGGGCCGGGGCCGCAGCGG + Intronic
1162733824 19:12734695-12734717 CGCCAAGCGCGGGGCCGGAGCGG - Exonic
1163027079 19:14518582-14518604 TGCCGAGGGCGGAGCGGGAGGGG - Intronic
1163368693 19:16890004-16890026 CGCAGGGCGCGGGCCCGCAGCGG - Exonic
1163579892 19:18132076-18132098 CGCGGAGGGCGGGGCCAGAGAGG + Intronic
1163666420 19:18606080-18606102 CGGGGAGGGCGGGGCTGCAGGGG - Intronic
1163799761 19:19357227-19357249 GTCAGAGGGCGGGGCTGGTGAGG + Exonic
1164658608 19:29942588-29942610 GGCAGGGGCCGGGGCCGAAGGGG - Exonic
1164834785 19:31349964-31349986 CGCACGGGGCGGAGGCGGAGGGG - Intergenic
1165798823 19:38535292-38535314 TGCAGAGGGCGAGGCAGGGGAGG - Intronic
1165939159 19:39406760-39406782 GGCCGGGGGCGGGGCAGGAGGGG - Intergenic
1165999677 19:39870823-39870845 CAAAGAGGTCGGGGCCAGAGTGG + Intronic
1166100389 19:40568111-40568133 CGCGGAGGCGGCGGCCGGAGCGG + Exonic
1166157411 19:40924363-40924385 GGCAGAGGGCGGGGCCCTGGTGG - Intergenic
1166166281 19:40991396-40991418 GGCAGAGGGCGGGGCCCTGGTGG - Exonic
1166661316 19:44649118-44649140 CGGAGAGGGCAGGGCTGGAAAGG - Intronic
1166979421 19:46623949-46623971 CGCACAGGGCGGGGCCGCCTCGG + Exonic
1167077326 19:47257476-47257498 AGCCGTGGGCGGGGCCAGAGCGG + Intronic
1167091738 19:47349084-47349106 AGGAGAGGGCGGGGCCGGGGAGG + Intergenic
1167348587 19:48961871-48961893 AGCAGACGGCGGGCCCGGCGTGG - Intergenic
1167445287 19:49533881-49533903 GGCCGAGGGCGGGGCCGGCGCGG + Intronic
1167507380 19:49878031-49878053 CTCAGGGGGCGGGGCCGGGAGGG - Intronic
1167884904 19:52492687-52492709 GGCAGAGGGCGGGGCCGGGGCGG - Intronic
1167889351 19:52527526-52527548 GGCAGAGGGCGGGGCCGGGGCGG - Intergenic
1167890466 19:52535870-52535892 GACAGAGGGCGGGGCCGGGGCGG - Intronic
1167894475 19:52570145-52570167 GGCAGAGGGCGGGGCCGGGGCGG - Intronic
1167898520 19:52601170-52601192 GGCAGAGGGCGGGGCCGGGGCGG - Intronic
1167903388 19:52638472-52638494 AGCAGTGGGCGGGGCCAGGGCGG + Intronic
1167909561 19:52690606-52690628 GGCAGAGGGCGGGGCCGGGGCGG + Intergenic
1167915289 19:52735161-52735183 GGCAGAGGGCAGGGCCGGGGCGG + Intergenic
1167921588 19:52786874-52786896 GGCAGAGGGAGGGCCCGGGGCGG + Intronic
1167926075 19:52821753-52821775 CGCAGAGGGCGGGGCCGGAGCGG + Intronic
1167930259 19:52857739-52857761 CGCAGAGGGCGGGGCCGGAGCGG + Intergenic
1167940560 19:52942704-52942726 GACAGAGGGCGGGGCGGGGGCGG + Intronic
1167972390 19:53196886-53196908 GGCAGGGGGCGGGGCCGGGAGGG - Intergenic
1167972436 19:53197004-53197026 GGCAGGGGGCGGGGCCGGAGGGG - Intergenic
1167987804 19:53333607-53333629 GGCAGAAGGCGGGGCCGGGGTGG - Intergenic
1167991584 19:53365578-53365600 GGCAGAGGGCGGGGCGGGGCTGG - Intergenic
1168003475 19:53467609-53467631 CGCAGAGGGCGGGGCCGGGGTGG - Intergenic
1168062094 19:53898767-53898789 CTCAGGGGGCGTGGCCGGGGGGG + Intronic
1168076392 19:53982749-53982771 CGCAGAGGGCGCGGGTGGCGCGG - Exonic
1168239314 19:55081386-55081408 CGCAGAGGCCTGAGCCGGTGGGG + Exonic
1168494767 19:56839552-56839574 CAAAGCGGGCGGGGCCTGAGTGG + Intronic
925204683 2:1996052-1996074 GGAAGAGGGAAGGGCCGGAGAGG + Intronic
925495783 2:4447639-4447661 AGCAGAGGGAGGGGTCGGGGAGG - Intergenic
926220863 2:10934722-10934744 GGCAGAGGGAGGGGCAGGTGGGG - Intergenic
926672833 2:15591754-15591776 CGCATAAGGCGGGGCCGGCGCGG + Exonic
927052917 2:19348071-19348093 AGAGGAGGGCGGGGCCGCAGTGG + Intergenic
927052921 2:19348086-19348108 CGCAGTGGGCGCGGCCATAGTGG + Intergenic
927891196 2:26750671-26750693 CTCAGAGGCCGGGGCCGGCGCGG + Intergenic
929151230 2:38750914-38750936 CGCCGAGGGCGGGGGGGGAGGGG + Intronic
929650571 2:43676461-43676483 AGAAGGGGGCGGGGCAGGAGCGG + Intronic
929966983 2:46543293-46543315 GGCAGAGGGCGCGGCGGGGGAGG - Intronic
930102280 2:47612710-47612732 CACAGAGGGCAGGGAAGGAGTGG + Intergenic
933847475 2:86337434-86337456 CGGGGAGGGAGGGGACGGAGGGG + Intronic
934897309 2:98130023-98130045 CTCAGAGGCCGGTGCCGGTGTGG - Intronic
934978524 2:98822596-98822618 CCGAGAGGGCGGCGCCAGAGCGG - Exonic
935591739 2:104851595-104851617 CGCAAAGGGAGGGGGCGGATGGG + Intergenic
935592463 2:104855346-104855368 CGAAGGCGGCGGGGCCGGCGGGG + Intergenic
936091832 2:109506509-109506531 TGCAGAGGGTGGGGCAGGACAGG + Intergenic
936104496 2:109613666-109613688 CTGGGCGGGCGGGGCCGGAGGGG + Intronic
937953774 2:127408065-127408087 CGCAGACGGCGCGGGCGGGGAGG - Intergenic
938277150 2:130037147-130037169 CGCAGACGGCGGGGTCGCCGGGG - Intergenic
938301125 2:130213705-130213727 CGCAGCGACCGGGGCCGGGGCGG - Intergenic
938361829 2:130693558-130693580 CGCAGACGGCGGGGTCGCCGGGG + Intergenic
938438234 2:131300242-131300264 CGCAGACGGCGGGGTCGCCGGGG + Intronic
939990731 2:148875396-148875418 TGCAGCCGGAGGGGCCGGAGCGG + Exonic
941077263 2:161020041-161020063 AGGAGAGAGCTGGGCCGGAGAGG + Intergenic
941384853 2:164841103-164841125 CGGGGAGGGCGAGGCCGGCGAGG - Intronic
942044953 2:172094855-172094877 CGCGGAGGGAGGGGGCGGGGCGG + Intergenic
942151022 2:173076023-173076045 CGCGGAGGGCGGGGAGGGAGGGG + Intronic
945235182 2:207626173-207626195 GGCAGAGCGCGCGGCTGGAGTGG + Intergenic
946328296 2:218996226-218996248 CGCGGAGGGCGGGGTGGAAGGGG + Intergenic
948528822 2:238589954-238589976 CCCAGAGGGGAGGGCAGGAGTGG + Intergenic
948768017 2:240233415-240233437 CGCCGTGGGTGGGGCTGGAGAGG - Intergenic
949000714 2:241611203-241611225 CTCAGAGGCCTGGGGCGGAGTGG + Intronic
1168769772 20:407981-408003 GGCTGGGGGCGGGGCCGGGGTGG - Intronic
1168769790 20:408009-408031 GGCCGGGGGCGGGGCCGGGGGGG - Intronic
1168769806 20:408032-408054 CGGGGTGGGCGGGGCCGGGGCGG - Exonic
1169262451 20:4148771-4148793 AGCGGAGGGCCGGGCCGGAGCGG + Exonic
1171317141 20:24205297-24205319 AGCAGAGGGCAGGGGAGGAGAGG + Intergenic
1171486823 20:25491414-25491436 GGCAGAGGGCCGCGCTGGAGTGG - Exonic
1172032368 20:31991080-31991102 GGCAGAGGAGGGGGCAGGAGTGG + Intronic
1172293212 20:33790774-33790796 CGCAGAGGGAGGAGCCAGCGTGG + Intronic
1172359715 20:34303432-34303454 CGCGCAGGGCGGAGCCGGAGGGG + Intronic
1173555439 20:43962257-43962279 CCCAGAGGGCCGGGCCTGATGGG - Intronic
1173730481 20:45325135-45325157 GGCAGAGGGTGGGGGCAGAGAGG - Intergenic
1173821230 20:46021895-46021917 CGCAGGGGGCGGGGCCTGCCAGG + Intronic
1173823262 20:46031778-46031800 CCCAGGGGGCGGGGGCGGGGAGG + Intronic
1175542185 20:59754843-59754865 GGCAGAGGCCGGGGTCAGAGTGG + Intronic
1175543341 20:59762042-59762064 TGCAGAGGGCGGTGTCAGAGAGG + Intronic
1175847306 20:62065555-62065577 CGCCGAGGGCGCGCCCGGAGCGG - Exonic
1175856135 20:62122095-62122117 CTCAGTGGGCGGGACCGGGGAGG - Intergenic
1175938701 20:62527233-62527255 CGTAGGGGGCGGGGGCGGGGGGG - Intergenic
1176044199 20:63083967-63083989 CCCAGAGGGCAGGACGGGAGCGG + Intergenic
1176126834 20:63479280-63479302 TGCAGAGGGCGGCGCTGGTGTGG + Intergenic
1176131759 20:63499295-63499317 CGCCGCGGGCGGGGGCGGGGCGG + Exonic
1176178111 20:63738064-63738086 AGCAGAGGGCGGGGCGGGGGCGG + Intronic
1176178570 20:63739604-63739626 CGGAGGGGGCGGGCCCGGGGCGG + Intronic
1178544202 21:33479727-33479749 CCCAGAAGGCCGGGCCGGACAGG + Intronic
1178992507 21:37367327-37367349 CGCAGAGGGCGGCGTCGGCGAGG - Intronic
1179197965 21:39183487-39183509 CGCGGAGGGCGTGGCCTGTGCGG - Exonic
1179775206 21:43657903-43657925 CGGCGTGGGCTGGGCCGGAGCGG - Intronic
1179881948 21:44296658-44296680 CGCAGGGGGAGGGGCCGGGGGGG - Intronic
1179882645 21:44299991-44300013 CGCCGGGGGCGGGCCCGGGGCGG + Intergenic
1179891735 21:44338915-44338937 GGGAGAGGGCGGAGCCGGGGCGG - Intronic
1179891745 21:44338937-44338959 GGGAGAGGGCGGAGCCGGGGCGG - Intronic
1179932668 21:44580470-44580492 GGCAGGGGGCGGTGCCGCAGGGG + Exonic
1180064304 21:45405077-45405099 GGCAGGGGGCGGGGCGGGCGCGG - Intergenic
1180170906 21:46057639-46057661 CCCAGTGGGCGGGGTCGGGGAGG + Intergenic
1180908572 22:19432325-19432347 AGCACAGGGCGGGGACGGAAGGG + Exonic
1181184638 22:21094167-21094189 CTCAGAGACCGGGGCCGGTGCGG + Intergenic
1181276740 22:21692077-21692099 CTCAGAGGGCAGAGCCAGAGAGG - Intronic
1181409017 22:22704991-22705013 TGCAGAGGGTGGAGCAGGAGTGG + Intergenic
1181491386 22:23262717-23262739 GGGTGAGGGCGGGGGCGGAGAGG + Intronic
1181637561 22:24181417-24181439 CGCAGAGTGCAGGGCGGGCGGGG + Exonic
1181774556 22:25149964-25149986 CGCAAAGGCCGAGGCTGGAGTGG - Intronic
1182236922 22:28883520-28883542 GGCCGAGGGCGGGGAGGGAGGGG + Intergenic
1182668806 22:31978564-31978586 CTCAGAGGGCAGGGTAGGAGAGG + Intergenic
1183185451 22:36289151-36289173 AGCAGAAGGCGGAGCTGGAGCGG - Exonic
1183545912 22:38454880-38454902 CGGAGCGGGCGGGGCCGGAGCGG + Intronic
1183739601 22:39662498-39662520 CCCAGGAGGCGGGGCCCGAGCGG + Intronic
1183781052 22:39999171-39999193 GACAGAGGGCGTGGCGGGAGGGG + Intronic
1183815143 22:40293605-40293627 GCCTGAGGGCGGGGGCGGAGGGG + Intronic
1183903297 22:41022028-41022050 CGCCCAGGGCTGGGCCGGAGGGG + Intergenic
1184186506 22:42868685-42868707 CCCTGAGGGCAGGGCAGGAGAGG + Intronic
1184236916 22:43187440-43187462 AGAAGAGGGCGGGGCAGGGGAGG - Intergenic
1184340147 22:43881527-43881549 GGCAGAGGGCAGGGATGGAGAGG - Intronic
1184620438 22:45672283-45672305 CGCGGAGGGCGAGGCCTGCGCGG + Intronic
1184640395 22:45867284-45867306 CGCAGAGGGCAGTGCAGGATCGG - Intergenic
1184748858 22:46472833-46472855 CGCAGAGGCAGAGGCCAGAGGGG - Intronic
1185092928 22:48786080-48786102 CGCAGATGGCAGGGCAGGTGTGG - Intronic
1185272698 22:49936100-49936122 CGAGGAGCGCGGGGCCGGGGCGG - Intergenic
949414252 3:3799327-3799349 CGAAGAGGGTCGGGCGGGAGGGG + Intronic
949891470 3:8736652-8736674 CGCAGAGGGAGCGGCGGGGGCGG + Intronic
950406946 3:12810526-12810548 CGCAGAGGTTGGGGCCGGATAGG + Intronic
950650212 3:14402540-14402562 GGCCGGGGGCGGGGCCGGGGCGG - Intergenic
951543667 3:23806193-23806215 CGCAGGGCACGGGGCCGGCGCGG + Intronic
952377774 3:32781440-32781462 CGCAGGTGGCGGGGCCGAAGGGG + Intergenic
952883461 3:37999141-37999163 CGGGCGGGGCGGGGCCGGAGGGG + Intronic
952942251 3:38453973-38453995 CGCAGGGGCCGAGTCCGGAGGGG - Exonic
954004024 3:47578325-47578347 GGCCGGGGGCGGGGCCGGGGCGG - Intronic
954295762 3:49673929-49673951 CGCGAAGGGCGGGGCCCGAGGGG - Intergenic
954577779 3:51686270-51686292 CGCAGAGGGCGTGGCCAGTGTGG + Intronic
954717990 3:52536385-52536407 GGCAGGGGGCGGGGCCGGGCCGG + Intronic
955916372 3:63912262-63912284 CGCGGAGGCCAGCGCCGGAGCGG - Intronic
957054890 3:75435578-75435600 CTCAGGAGGCGGGGCCGGGGCGG + Intergenic
958692151 3:97481688-97481710 CACAGGGGGCGGGGCCGGGGCGG - Intronic
960637177 3:119795306-119795328 GGAAGAGGGTGGGGCAGGAGAGG + Intronic
961888561 3:130111977-130111999 CTCAGGAGGCGGGGCCGGGGCGG + Intronic
962108470 3:132417561-132417583 GGCAGAGGGAGGAGGCGGAGGGG + Exonic
962498395 3:135965653-135965675 CGCCGAGGGTGGGGCCGAGGAGG + Exonic
962498477 3:135965935-135965957 CGCGGAGGCCGGGGCGGGCGGGG + Intronic
962722259 3:138187226-138187248 CGCGGTGGGCGGGGCCCCAGAGG - Intronic
963275937 3:143329830-143329852 CGCTGACGGCTGGGCAGGAGCGG - Intronic
963335671 3:143971769-143971791 AGCCGGGGGCGGGGCCAGAGGGG - Intergenic
964209834 3:154214457-154214479 AGCAGAGGGAGGGGTCTGAGTGG + Intronic
966595676 3:181723136-181723158 CGAAGTGGGCGGGGGCAGAGAGG - Intergenic
968502438 4:957172-957194 CGCAGAGGGCGAGGGGTGAGGGG - Intronic
968571968 4:1346802-1346824 CGCCGGGGGCGGGGCCGGCCGGG - Intergenic
968702386 4:2063108-2063130 AGGAGAGGCCGGGGCCAGAGGGG + Intronic
968729123 4:2261535-2261557 CGGCGAGGGCGGGGCCGGCCGGG + Intronic
968756486 4:2418701-2418723 CGCTGCGGGCGGGGCGGGCGGGG + Intergenic
968815130 4:2818119-2818141 GGCAGGGGGCGGGGCCGGGAGGG + Intronic
968974535 4:3814349-3814371 GGCAGTGGGCGGGGCCTGGGGGG - Intergenic
969114072 4:4860389-4860411 CGCAGAGGGAGGGGGCCGGGTGG + Intronic
969437461 4:7196639-7196661 GGCAGAGGGAGGGGAGGGAGAGG - Intronic
969620177 4:8275024-8275046 GGGAGTGGGCGGGGCAGGAGGGG - Intronic
969816627 4:9691966-9691988 CTCAGGAGGCGGGGCCGGGGCGG - Intergenic
975795127 4:77998713-77998735 CTCAGAGGGCCGGGCCGGGCCGG - Intergenic
976390193 4:84498309-84498331 CGCCGAGGGCGCGAGCGGAGAGG + Exonic
978530048 4:109703479-109703501 GGCAGGGGGCGGGGCCGCCGAGG - Intronic
979523832 4:121697086-121697108 CGCTGAGGCCGGGGCAGGGGCGG - Exonic
981528900 4:145733525-145733547 AGCAGAGAGCGGGGCTGGGGAGG - Intronic
982204867 4:152990083-152990105 AGCAGAGGGGTGGGCCGCAGTGG - Intergenic
982573193 4:157076098-157076120 CGCCGCGGTCGGGGCCGCAGCGG - Exonic
983533296 4:168832645-168832667 GGGAGAGGGTGGGGACGGAGGGG + Intronic
983945197 4:173578262-173578284 CAAAGACGGCCGGGCCGGAGGGG - Intergenic
984762762 4:183376829-183376851 CGCAGAGGGGGGTGGCAGAGAGG - Intergenic
984959484 4:185081616-185081638 CTCAGAGGGTGGGGGCTGAGGGG - Intergenic
985271204 4:188196741-188196763 GGCACAGGTCGGGGCCGTAGTGG - Intergenic
985579818 5:690703-690725 CCCGGAGGGAGGGGCCGCAGGGG - Intronic
985594664 5:782762-782784 CCCGGAGGGAGGGGCCGCAGGGG - Intergenic
985660854 5:1155905-1155927 CGGGGAGGGCGGGGCCGGCGGGG + Intergenic
985973994 5:3400912-3400934 TGCTAAGGGCGGGGCTGGAGTGG - Intergenic
986466935 5:8035032-8035054 CAGAGAGGGCGGGGCCAGAGAGG + Intergenic
986661721 5:10065562-10065584 CTCAGAGTGGGGGGCCTGAGGGG - Intergenic
987303432 5:16617038-16617060 CGCCGAGGGCGGGGCGGCGGTGG + Exonic
989379343 5:40798192-40798214 CGCTGCGGGAGGGGGCGGAGGGG + Exonic
990765524 5:59178016-59178038 CCTAGAGGGTGGGGCCTGAGTGG + Intronic
992320924 5:75612333-75612355 GGCGGAGGGCGGGGGCGGGGCGG - Intronic
994531944 5:100983190-100983212 CTCAGAGGACGGTGCCGGCGTGG - Intergenic
995724673 5:115170235-115170257 TGCCGAGGGCGGCGCCGGGGCGG + Intronic
996404838 5:123094781-123094803 CGCAGGGGCAGGGGCCGGCGAGG + Intronic
997454744 5:134008107-134008129 CGGAGAGGCGGGGGCAGGAGAGG - Intergenic
998522928 5:142817029-142817051 GGCAGAGGGAGGGGACAGAGAGG + Intronic
1001159498 5:169300852-169300874 CGCACGGGGCGCGGGCGGAGCGG + Intronic
1001191552 5:169637213-169637235 AGGAGAGGGCGGGCCCTGAGAGG + Intergenic
1001296932 5:170504803-170504825 CCCAGAGGAGGGAGCCGGAGTGG + Intronic
1001824704 5:174735588-174735610 GGCAGCGGGCGGGGCGGAAGGGG - Intergenic
1002062340 5:176632946-176632968 AGCAGAGGGCGGGGTGGGGGAGG + Intronic
1002132842 5:177092012-177092034 GGCAGAGGGCGCAGCCCGAGCGG + Intronic
1003624137 6:7727223-7727245 TGCAGGGGCCGGGGCCGGTGCGG - Exonic
1004044331 6:12011493-12011515 AGCACACGGCGGGGGCGGAGGGG - Intronic
1004216931 6:13711754-13711776 CGCCGAGGGCGGGGGCGACGCGG + Intergenic
1005293342 6:24400188-24400210 CTCAGAGGCCGGTGCCGGCGCGG - Intergenic
1005832399 6:29681162-29681184 GGAAGAGGGCGGGGCCGGGGTGG - Intergenic
1005912862 6:30326509-30326531 CGAAGAGGGCGGGGCGGGGGCGG - Intronic
1006634576 6:35452640-35452662 CGCTGCAGGCGGGGCCTGAGGGG + Exonic
1006860689 6:37170087-37170109 CGCGGCGGGCGGGGACGGGGCGG - Intergenic
1007722179 6:43891559-43891581 CGCCCAGGGCCGGGCGGGAGGGG + Intergenic
1008007081 6:46422235-46422257 CAGAGAGGGCTGGGCCGGGGAGG - Intronic
1009964768 6:70566842-70566864 TGCAGAGGGCGGGGCCTCCGTGG - Intergenic
1012450546 6:99349462-99349484 CGCGGAGGGCGCGGGCGGCGCGG + Exonic
1013575742 6:111482718-111482740 CGCCGGGCGCGGGGCGGGAGCGG - Intronic
1019008833 6:168825676-168825698 CACAGAGGGCGGTACCTGAGAGG - Intergenic
1019111938 6:169724037-169724059 CGGAGGGGGCGGGGCCGGGGCGG - Exonic
1019323317 7:425288-425310 TGGGGAGGGCAGGGCCGGAGCGG + Intergenic
1019538315 7:1540125-1540147 CGCAGAAGGAGGAGCTGGAGCGG + Exonic
1019689650 7:2403567-2403589 CGCCGGGGGCGGGGCCGGCGAGG + Exonic
1019735209 7:2647042-2647064 GACGGAGGGCGGGGCCAGAGGGG + Intronic
1019735223 7:2647070-2647092 CCGAGGGGGCGGGGCTGGAGTGG + Intronic
1020083098 7:5296822-5296844 GGTGGAGGGCGGGGCCGGTGGGG + Intronic
1021719245 7:23490428-23490450 TGCAGAGGGCGGGGGCGGGCGGG + Intergenic
1023255819 7:38311425-38311447 GGCAGAGGGCGCGGCGGGAGGGG - Intergenic
1023418091 7:39950605-39950627 CGCAGAGCGCGGCGCGGGTGCGG - Exonic
1024965597 7:55019916-55019938 CGCGGAGGGCGGAGGCGGGGAGG - Intronic
1025211205 7:57020408-57020430 GGTGGAGGGCGGGGCCGGCGGGG - Intergenic
1025660750 7:63556439-63556461 GGTGGAGGGCGGGGCCGGCGGGG + Intergenic
1026853370 7:73738266-73738288 GGGAGTGGGCGGGGCCTGAGAGG - Intronic
1026911243 7:74093127-74093149 TGCAGAGGGTGGGGCCAGCGTGG - Intronic
1027190676 7:75994127-75994149 CGCAGCGGGCAGCGCCCGAGAGG - Intronic
1027202213 7:76071512-76071534 AGCCGAAGGCGGGGCCTGAGAGG + Intergenic
1027244671 7:76359021-76359043 CGGCGTGGGCGGGGCCGCAGGGG - Exonic
1027745447 7:82068241-82068263 GGCAGGGGGCGGGGCTGGAGGGG - Intronic
1028540823 7:91940771-91940793 CCCGGAGGGCTGGGCCGGGGCGG + Intergenic
1028871125 7:95772666-95772688 CGAAGGTGGCGGGGCCGGCGCGG - Exonic
1029123029 7:98281294-98281316 GGGGGAGGGCGGGGCCTGAGAGG - Intronic
1029708287 7:102286726-102286748 GGCCGGGGGCGGGGCCTGAGCGG + Intronic
1030055842 7:105583162-105583184 CGCTGAGGGCGGGGGCGGCGGGG + Intronic
1030348246 7:108456457-108456479 CGGAGAGGGCGGGAGCGGCGGGG - Intronic
1031999066 7:128253040-128253062 CGCAGAAGGTGGGGACAGAGGGG - Intronic
1034166545 7:149028873-149028895 TGCCGGGGGCGGGGCAGGAGAGG + Intergenic
1034439824 7:151080922-151080944 CGCCGAGGGCGGGGCCACGGAGG + Intergenic
1034882914 7:154776037-154776059 AGCAGTGGGTGGGGCAGGAGGGG - Intronic
1035404258 7:158587835-158587857 CGCCGGGGGCGGGGCCGGGGCGG - Intergenic
1036780346 8:11642718-11642740 AGAAGAGGGCGGGGGCGGGGGGG - Intergenic
1036849899 8:12194147-12194169 GGCAGAGCGCGGGGGCAGAGAGG + Intergenic
1037752938 8:21694414-21694436 TGCAGAAGGCTGGGCCGGTGGGG - Intronic
1038566334 8:28622694-28622716 AGCCGAGGGCGGGGCCTCAGGGG + Intronic
1039398579 8:37248059-37248081 AGCAGAGAGCAGCGCCGGAGTGG + Intergenic
1039559774 8:38503794-38503816 GGAAGCGGGCAGGGCCGGAGTGG - Intergenic
1040599499 8:48870191-48870213 TGAGGAGGGCGGGGCCGGGGAGG - Intergenic
1040622250 8:49103272-49103294 CCCAGGCGGCAGGGCCGGAGAGG + Intergenic
1041801755 8:61807857-61807879 TTCAGAGGGCTGGGCAGGAGAGG + Intergenic
1042281873 8:67064351-67064373 AGCGGAGGGCTGGGCCTGAGGGG + Exonic
1043875869 8:85485247-85485269 AGCAGAGGTCAGGGGCGGAGAGG - Intergenic
1045242775 8:100416904-100416926 AGCAGAGGGTGGGGCGGGGGTGG + Intergenic
1045454805 8:102367444-102367466 TGCTGGGGGCGGGGCTGGAGTGG - Intronic
1047277393 8:123416551-123416573 CGAAGTGGGCGGGTCCGGGGTGG - Intergenic
1047277427 8:123416669-123416691 CGCGGTGGGCGGGGCCAGGGCGG - Intergenic
1049032460 8:140047861-140047883 AGCAGAGGTCGGGGCAGAAGTGG + Intronic
1049417126 8:142500317-142500339 CGCGGGGGGCGGGGGAGGAGCGG - Intronic
1049417137 8:142500340-142500362 CGCGGGGGGCGGGGGAGGAGCGG - Intronic
1049452598 8:142670106-142670128 CGCGGAGGGCGTGGGAGGAGAGG + Intronic
1049593548 8:143473258-143473280 TGCAGAGGCCTGGGCAGGAGTGG - Intronic
1049613692 8:143567345-143567367 CGGAGAAGGCGGGGCCCGCGGGG + Exonic
1049614278 8:143569324-143569346 CTGAGAGGGCGGGGCCTGGGCGG + Intronic
1049623522 8:143609819-143609841 CGTAAGGGGCGGGGCCGGCGGGG + Intergenic
1049686740 8:143942159-143942181 TGGAGGGGGCGGGGCTGGAGGGG - Intronic
1049746949 8:144267042-144267064 GGAAGAAGGCGGGCCCGGAGTGG - Exonic
1049753326 8:144296161-144296183 GGCAGGGGGCAGGGCCTGAGGGG + Intronic
1051697958 9:19789081-19789103 CCCAGAGGGAGGGGCCGGCGGGG - Intergenic
1051936344 9:22447145-22447167 CGCCGGGGACGGGGGCGGAGGGG - Exonic
1052781253 9:32783559-32783581 CGCAGAGCGCGGGGCGCGGGAGG - Exonic
1053181252 9:35972254-35972276 CGCTGAGGGCGGGGGCGGCGTGG + Intergenic
1053188183 9:36036845-36036867 GGCAGGGGGCGGGGCTTGAGCGG + Exonic
1055640278 9:78314264-78314286 TGCAGAGGGCTGGGTGGGAGGGG + Intronic
1055640295 9:78314344-78314366 TGCAGAGGGCTGGGTGGGAGGGG + Intronic
1055640312 9:78314424-78314446 TGCAGAGGGCTGGGTGGGAGGGG + Intronic
1055640328 9:78314504-78314526 TGCAGAGGGCTGGGTGGGAGGGG + Intronic
1057043323 9:91863730-91863752 CGCAGATGGCTGGGCCTGGGGGG + Intronic
1057212129 9:93206098-93206120 TGCAGAGGGTGGTGCCTGAGGGG + Intronic
1057313255 9:93954536-93954558 CGCAGAGGGATGGCCGGGAGTGG - Intronic
1057617449 9:96604666-96604688 TGCGGGGGGCGGGGCAGGAGGGG + Intronic
1057922145 9:99105642-99105664 CGGAGAGTGCGAGGCCGGCGGGG + Intronic
1058530716 9:105902470-105902492 CGCAGAGGGCTGAGCCAGGGTGG + Intergenic
1059145699 9:111897182-111897204 CGCAGCGGGCCGGGCCGGTCCGG + Exonic
1059234509 9:112750706-112750728 CCTCGGGGGCGGGGCCGGAGCGG + Intergenic
1060103935 9:120862064-120862086 CCCAGAGGGAGGCGCCGCAGGGG + Intronic
1060234590 9:121853461-121853483 TGCAGAGGTGGGGGCCTGAGGGG + Intronic
1060478064 9:124000026-124000048 CGCGGCGCGCGGGGCCGGGGAGG - Intergenic
1060856036 9:126915269-126915291 CGCGGGGGGCGGGGCCGGGGGGG + Intronic
1060856057 9:126915320-126915342 TGCGGGGGGCGGGGCCGGCGGGG + Intronic
1060979497 9:127784521-127784543 CGCAGAGGGCTGGAGAGGAGGGG + Intergenic
1061149683 9:128821625-128821647 TGCAGAGGGCTGGGGCTGAGAGG + Exonic
1061450242 9:130663746-130663768 CGGGGAGTGCAGGGCCGGAGAGG + Intergenic
1061595342 9:131625219-131625241 GGGAGAGGGCGGGGACAGAGGGG + Intronic
1061802804 9:133121294-133121316 GGAAGAGGGTGGGGCCGGGGAGG + Intronic
1061802850 9:133121426-133121448 CAAAGAGGGCGGGGCCGGGGAGG + Intronic
1062011359 9:134268612-134268634 GGGAGCTGGCGGGGCCGGAGGGG + Intergenic
1062231586 9:135484951-135484973 CGCACAGCCCGGGGCCGGCGGGG + Exonic
1062461968 9:136665964-136665986 CGCTGGGGCCGGGGGCGGAGCGG + Intronic
1062556888 9:137117068-137117090 CTCAGAGACCGGGGCCGGTGCGG + Intergenic
1062565803 9:137163479-137163501 AGCTGGGGGCGGGGCCGGGGCGG - Intronic
1062696210 9:137877642-137877664 CGCAGCCGGAGGGGCCGGGGCGG + Intergenic
1203772819 EBV:58121-58143 CGCGGAGGCCGGGGCCGCGGAGG + Intergenic
1203772826 EBV:58136-58158 CGCGGAGGCCGGGGCCGCGGAGG + Intergenic
1203772833 EBV:58151-58173 CGCGGAGGCCGGGGCCGCGGAGG + Intergenic
1203772840 EBV:58166-58188 CGCGGAGGCCGGGGCCGCGGAGG + Intergenic
1203772846 EBV:58181-58203 CGCGGAGGCCGGGGCCGCAGAGG + Intergenic
1203772852 EBV:58196-58218 CGCAGAGGCCGGGGCCGCAGAGG + Intergenic
1203772858 EBV:58211-58233 CGCAGAGGCCGGGGCCGCAGAGG + Intergenic
1185506543 X:635476-635498 AGCAGAGGACAGGGCTGGAGAGG - Intronic
1187332647 X:18354717-18354739 CGCGGGGGGCGGGGCGGCAGTGG - Exonic
1187507272 X:19887765-19887787 GGGCGGGGGCGGGGCCGGAGAGG + Intergenic
1187518203 X:19991092-19991114 AGCAGTGGGCGGGGCCGGGGTGG - Intergenic
1189487127 X:41442563-41442585 CGCGGAGGGAGGAGCCAGAGCGG + Intergenic
1190385633 X:49879957-49879979 CGCCGGGGCCGGGGCCGGGGCGG - Exonic
1191184218 X:57592500-57592522 GGCGGAGATCGGGGCCGGAGTGG - Exonic
1191213175 X:57909959-57909981 GGCGGAGATCGGGGCCGGAGTGG + Exonic
1192180393 X:68912391-68912413 GGCAGAGGGCCGGGCTGGGGAGG - Intergenic
1192270099 X:69571009-69571031 AGCAGAGGGCTGGGAGGGAGCGG + Intergenic
1195370262 X:104166469-104166491 CGCAGTGGGCGGGGCGGGCCTGG + Intergenic
1195773447 X:108377008-108377030 CTCAGAGGCCGCGGCCGGCGCGG - Intronic
1198085300 X:133276960-133276982 CGGGGAGGGCTGGGCCGGTGGGG - Intergenic
1198312066 X:135433743-135433765 GGCAGAGAGCGGGGCCGAAGCGG + Intergenic
1198480220 X:137033921-137033943 CGCTGCGGGCGCGGCAGGAGCGG + Intergenic
1198696262 X:139342056-139342078 CTCAGAGGCCGGTGCCGGCGCGG - Intergenic
1200047698 X:153411459-153411481 GGGAGCGGGCGGGGCCGGGGCGG - Intergenic
1200098178 X:153673842-153673864 CGGAGGGGGCGGGGCCGGCGGGG - Intronic
1200147818 X:153935458-153935480 GGGAGAGGGCGGGGCCGCAGGGG - Intronic
1200218363 X:154378731-154378753 GGCAGGGGGCGGGGCCCGCGCGG - Intergenic
1200218390 X:154378838-154378860 CGTAGGGGGCGGGGCCCGCGCGG - Intergenic
1200218476 X:154379150-154379172 CGGAGAGGGCGGGGCCCGCCCGG - Intergenic