ID: 1167932501

View in Genome Browser
Species Human (GRCh38)
Location 19:52877606-52877628
Sequence CTTGAGGTTCCCGGTTTGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167932493_1167932501 16 Left 1167932493 19:52877567-52877589 CCAGGGTGAAATTCAACAGAACT 0: 45
1: 85
2: 45
3: 47
4: 159
Right 1167932501 19:52877606-52877628 CTTGAGGTTCCCGGTTTGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167932501 Original CRISPR CTTGAGGTTCCCGGTTTGGG AGG Exonic
902241918 1:15095187-15095209 CGTGAGGTTCCCGCATTGGTTGG - Intronic
905363357 1:37435178-37435200 CTTGGGGTTCCCGGTGGGGCGGG + Intergenic
907417184 1:54322724-54322746 GTTGAGGTGCCGGGGTTGGGGGG - Intronic
915597974 1:156906172-156906194 CTTCAGGTCCCTGGTTTTGGAGG + Intronic
917450519 1:175143993-175144015 CTCCAGGTTCCAGGTCTGGGTGG + Intronic
921363581 1:214353089-214353111 CTTGAGGTGCGGGGGTTGGGGGG - Exonic
923194624 1:231653305-231653327 CTTGAGGTACCAGGCTTGCGTGG + Intronic
1063078801 10:2745035-2745057 CCAGAGGCTTCCGGTTTGGGAGG - Intergenic
1063169707 10:3496511-3496533 CTGGAGCTTCCAGGTGTGGGTGG + Intergenic
1067113918 10:43420467-43420489 CTGGAGGATCCCGCGTTGGGCGG - Intergenic
1067208980 10:44242774-44242796 CCTGAGCTTCTGGGTTTGGGAGG - Intergenic
1068420628 10:56787267-56787289 CTTGAGGTGGCCGGTGTGGAAGG - Intergenic
1073093283 10:100963195-100963217 CTTGATGTTTGCGGTTTGAGAGG + Intronic
1080105321 11:28505741-28505763 CTTGAATTTCACTGTTTGGGTGG + Intergenic
1082752429 11:57033737-57033759 CTTGAGATTCGAGGTTTCGGTGG - Intergenic
1085424275 11:76389824-76389846 CTTGAGTGTCCCAGTATGGGAGG - Intronic
1086149784 11:83596331-83596353 CCTGAGGTTTCTGGCTTGGGTGG - Intronic
1099626563 12:85083103-85083125 ATTGATGTTCCAGGTTTGTGTGG + Intronic
1100464415 12:94832872-94832894 CTTGTGGTTCCAGCTATGGGTGG - Intergenic
1100517615 12:95343281-95343303 CTTGTGGTTCCCTGGTTAGGTGG + Intergenic
1103488964 12:121302186-121302208 CTGGATGTTCAAGGTTTGGGAGG - Intergenic
1105751760 13:23427362-23427384 CTTGAGGTTCCAAGCTGGGGAGG - Intronic
1107351821 13:39522741-39522763 CTTGTGGTTGCCTGTCTGGGAGG - Intronic
1118488995 14:66241024-66241046 TTTGAGGTTCCAGGTATAGGTGG + Intergenic
1118674215 14:68165407-68165429 CTAGAGGTTACTGATTTGGGTGG + Intronic
1125492837 15:40161074-40161096 CTTGAGGTGGCCGGTTTGTTAGG + Exonic
1127908618 15:63396614-63396636 CTTGAGGAGACCGTTTTGGGTGG - Intergenic
1128343249 15:66837240-66837262 CTTGAGTGTCCCGGTCTAGGCGG - Intergenic
1129424979 15:75456023-75456045 CTTGAGGTCCTCGGACTGGGGGG + Intergenic
1132551991 16:557312-557334 CTTGAGGATCCCTGGTTGAGAGG - Intergenic
1138242882 16:55442996-55443018 CTTGAGGTTTTGGGTTTGGGGGG - Intronic
1142747366 17:1966609-1966631 CTTGGGGTTCCCTGTCTGTGTGG + Intronic
1145759338 17:27417259-27417281 CTTGAGGCTCCAGGTTTGGATGG + Intergenic
1145799706 17:27675090-27675112 CTTGAGCCTCCAGGTTTGGATGG - Intergenic
1147662928 17:42126839-42126861 CTTGTGCTTCCTGGTTTGGATGG + Exonic
1147890146 17:43711316-43711338 ACTGAGGTTGGCGGTTTGGGTGG + Intergenic
1148369968 17:47091264-47091286 CTTGAGGAGGCCGATTTGGGAGG + Intergenic
1151928791 17:77217742-77217764 CCTGCGGTTCCCAGTTAGGGAGG - Intergenic
1158167426 18:54556199-54556221 CTTGAGGTTTCCTGCTTGTGAGG + Intergenic
1160880367 19:1316886-1316908 CTTGGGTTTCCAGGTTTGGGGGG + Intergenic
1164795514 19:31024084-31024106 GCTGAGGTGCCTGGTTTGGGAGG - Intergenic
1164958960 19:32410533-32410555 CTTTAGGATCCCAGCTTGGGTGG + Intronic
1167903854 19:52642226-52642248 CTTGAGGCTTCCAGTTTGTGAGG + Intronic
1167932501 19:52877606-52877628 CTTGAGGTTCCCGGTTTGGGAGG + Exonic
1167993941 19:53387300-53387322 CTCGAGGTCCCCAGTTTGTGAGG - Intronic
1168002584 19:53461082-53461104 CTTGAGGTCCCCAGTTTGTGAGG - Intergenic
932420587 2:71599119-71599141 CTTGGGGTTCCTTGTTTAGGTGG + Intronic
932772174 2:74506653-74506675 CTTGAGGTGACGGGTTTGGTAGG - Intronic
935152527 2:100450600-100450622 TTTGAGGTTCCTGGTGTGCGGGG - Intergenic
935454527 2:103251900-103251922 TTTGAGTTTCCAGGTTTGTGTGG + Intergenic
937221398 2:120344870-120344892 CTCGAGCTTCCCGGGGTGGGGGG - Intergenic
944123607 2:196268684-196268706 CTTGAGTTTCCTGTTTTGTGGGG + Intronic
946480511 2:220051443-220051465 CTTGAAGTGTCCCGTTTGGGAGG + Intergenic
1172055617 20:32152394-32152416 CTTCAGGTTTCTGGCTTGGGGGG - Intronic
1172533564 20:35653002-35653024 CTGGATGTTCCGGGTTTTGGAGG - Exonic
1176443349 21:6798568-6798590 CTCGAGGTTCCCGCGGTGGGAGG - Intergenic
1176821517 21:13663615-13663637 CTCGAGGTTCCCGCGGTGGGAGG - Intergenic
1182910992 22:33984481-33984503 CTTGAGCTTACCATTTTGGGTGG + Intergenic
1184468637 22:44683423-44683445 CTTGTGGTTCTGGGTGTGGGTGG - Intronic
953293629 3:41690927-41690949 CCTGATGTTCCTGGTTGGGGTGG - Intronic
955876458 3:63494927-63494949 CTTGACCTTCCTGGTTTGGCTGG - Intronic
963145152 3:141986356-141986378 CTTGAGGTGTTGGGTTTGGGTGG - Intronic
964701975 3:159578049-159578071 ATTGAGGGACCCGGTTTTGGGGG + Intronic
980101926 4:128550507-128550529 TTTCAGGCTCCTGGTTTGGGTGG - Intergenic
984206996 4:176797315-176797337 CTTGAGCTTCCTGGCTTGGTGGG + Intergenic
986213644 5:5698094-5698116 CTGGAGGTTTCCGTTTGGGGAGG + Intergenic
987031826 5:13983301-13983323 CTTCAGGCTCCAGGTTTGGATGG - Intergenic
993902317 5:93593023-93593045 CTGGAGGTTTCTGGTTGGGGTGG + Intronic
995610339 5:113902992-113903014 ACTGAGGCTCACGGTTTGGGAGG - Intergenic
997210040 5:132071851-132071873 CTTGAGGCTCCCAGTCTGGTAGG - Intergenic
1000314754 5:160079023-160079045 CTTGGGTTTCCAGGTTTGAGAGG - Intronic
1005090977 6:22056891-22056913 CTTGAGTTTCCAGGTGTGGCTGG + Intergenic
1005450503 6:25967359-25967381 CTGGAGGTCCCTGGTTTTGGTGG + Intronic
1016299885 6:142619002-142619024 CTTGAAGTTCCATGTTTGGAAGG - Intergenic
1017621192 6:156300165-156300187 CTTGAGGTTTTCTGTTTGGAAGG - Intergenic
1022520945 7:31006565-31006587 CCTGAGGTCCCCAGTCTGGGAGG - Intergenic
1029537918 7:101166675-101166697 CTAGAGGTTCCGGGGGTGGGGGG + Intergenic
1035903542 8:3484383-3484405 GTTGAGGTTCACGGTTTGCCTGG - Intronic
1041351880 8:56955245-56955267 CTTAAGCTTCCTAGTTTGGGAGG + Intergenic
1042787258 8:72562285-72562307 CTTGAGGCTCCAGGTTTGGAGGG - Intronic
1046930224 8:119834429-119834451 CTAGAGGCTTCCAGTTTGGGTGG + Exonic
1050733349 9:8734975-8734997 CCTGAGTTTCCTGGTTTGGTTGG + Intronic
1055336092 9:75235084-75235106 CTTTAGGTTCCCGGGGTTGGGGG - Intergenic
1055891335 9:81127200-81127222 CTTGATGTTCCCGGGGTGGCTGG + Intergenic
1056825592 9:89874361-89874383 CCAGAGGTGCCCAGTTTGGGAGG + Intergenic
1058014587 9:100016022-100016044 GTTGAGGATCCCTGTTTAGGTGG - Intronic
1060377284 9:123128038-123128060 CTTGTGGTTCTTGGTTTGGTTGG - Intronic
1061246851 9:129404968-129404990 CTGGATGTTTCCAGTTTGGGGGG + Intergenic
1203525852 Un_GL000213v1:85959-85981 CTCGAGGTTCCCGCGGTGGGAGG + Intergenic
1186423939 X:9448830-9448852 TTTGTGGTTCCCTGTTTGAGCGG + Intergenic
1199717254 X:150515545-150515567 CTTGAGGTTCCCTGTGTGGTTGG - Intergenic