ID: 1167934775

View in Genome Browser
Species Human (GRCh38)
Location 19:52897220-52897242
Sequence CGGACAGGGGTGGCGTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167934767_1167934775 13 Left 1167934767 19:52897184-52897206 CCGCACAAGGAGGGAGGTGGGGA 0: 1
1: 0
2: 2
3: 53
4: 1045
Right 1167934775 19:52897220-52897242 CGGACAGGGGTGGCGTCTGCAGG 0: 1
1: 1
2: 1
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167934775 Original CRISPR CGGACAGGGGTGGCGTCTGC AGG Intronic
900107963 1:993568-993590 CGGTCAGGGATGAGGTCTGCTGG - Intergenic
900402105 1:2476820-2476842 GGGACAGGGGAGGCGAGTGCAGG - Intronic
900513216 1:3069892-3069914 GGGGCAGGGGTGGCGACGGCGGG + Intronic
901241175 1:7694572-7694594 GAGCCAGGGGTGCCGTCTGCAGG - Intronic
902784466 1:18724110-18724132 CGGCAAGGAGTGGCGTCAGCGGG + Intronic
904331013 1:29757781-29757803 GGCACAGGAGTGGCATCTGCAGG + Intergenic
904384944 1:30135014-30135036 CGGCCAGGGGAGGCGGGTGCGGG + Intergenic
905294393 1:36945043-36945065 CGGCCAGGGGTGGAGCCAGCTGG - Intronic
906297133 1:44655705-44655727 TGGTCAGGGCTGGCGCCTGCAGG - Intronic
909412172 1:75367466-75367488 TGGACAGGTGTGGCTCCTGCTGG + Intronic
919931560 1:202224546-202224568 CGGACAGGGGTGGAGTGTGGGGG + Intronic
922766354 1:228158489-228158511 CGGGCAGGGCTGGCGGCTGCAGG - Exonic
1066044630 10:31584512-31584534 CTCACAGGGGTGAGGTCTGCAGG - Intergenic
1066586785 10:36944490-36944512 GGGACCGGGGTGAGGTCTGCAGG - Intergenic
1067528014 10:47050018-47050040 TGGAGAGTGGTGGGGTCTGCAGG - Intergenic
1069913620 10:71774202-71774224 CGGACAGCTGAGGCCTCTGCCGG - Intronic
1074898415 10:117796332-117796354 CTGGCGGGGGTGGCGTCTTCAGG + Intergenic
1075653763 10:124147566-124147588 AGCAAAGGGGTGGCCTCTGCTGG - Intergenic
1076792825 10:132785986-132786008 CGGGCAGGGGCGGCGGCGGCGGG - Exonic
1077211083 11:1371270-1371292 CGGGGAGAGGTGGTGTCTGCAGG - Intergenic
1077394915 11:2316015-2316037 GGGACAGGGCTGGCCTCTGTGGG - Intronic
1077895532 11:6450711-6450733 AGGAGAGGGGTGGGGTCTCCAGG + Intronic
1078524225 11:12088386-12088408 TGGCCTGGGGTGGCCTCTGCTGG - Intergenic
1078929320 11:15901224-15901246 CGGGCAGGGCTGCCCTCTGCTGG - Intergenic
1081674877 11:44963022-44963044 CTGACCTGGGTGGCATCTGCAGG + Intergenic
1081733988 11:45390996-45391018 AGGAGAGGGGTGGGGTCAGCAGG + Intergenic
1084612459 11:70212298-70212320 CGGGCAGGAGTGGGGGCTGCAGG - Intergenic
1086411881 11:86552013-86552035 AGGACTGGGGTGGCCTCAGCAGG + Intronic
1089372764 11:117973008-117973030 CAGCCAGGGGTGGGGTCTGTGGG - Intergenic
1096231216 12:49897885-49897907 GGGGCAGGGATGGCTTCTGCAGG + Intronic
1099588037 12:84546315-84546337 CGGCCAGTGGTGGCTTCCGCAGG + Intergenic
1100175865 12:92030186-92030208 GGAATAGGGGTGGCTTCTGCTGG - Intronic
1103680739 12:122691592-122691614 TGGACAGGGGTGGTGTTTGGTGG - Intergenic
1104697142 12:130872162-130872184 GGGACAGGGGTGGCGGCGGCGGG + Intronic
1119709682 14:76812709-76812731 CGGCCAGGGCTCGCCTCTGCGGG - Intronic
1121118155 14:91357960-91357982 GGACCAGGGGTGGCCTCTGCAGG + Intronic
1122204669 14:100142595-100142617 CGCACAGGGGTGGAGGCTGATGG + Intronic
1122718097 14:103707259-103707281 CGGGCAGGGCTGGGGACTGCGGG + Intronic
1122880299 14:104687817-104687839 TGGACAGGGGAGGGGGCTGCAGG + Intergenic
1124072768 15:26411357-26411379 CGGACAGGGGCTATGTCTGCTGG - Intergenic
1129183945 15:73894364-73894386 ATGACAGGGGTGGTGTGTGCAGG + Intergenic
1129524080 15:76203163-76203185 CTGGCAGGGGTGGGGGCTGCGGG - Intronic
1131402055 15:92133126-92133148 AGGGCAGGGGTGGCATCTGGTGG - Intronic
1132535528 16:477582-477604 AGGACAGGGCTGGCCTGTGCTGG - Intronic
1132539624 16:502576-502598 TGCACAGGGGAGGTGTCTGCAGG + Intronic
1133269356 16:4602872-4602894 TGCAGAGGGGTGGCGCCTGCAGG + Intergenic
1133301125 16:4783612-4783634 CGGGCAGGGCTGGGGTCAGCGGG - Intronic
1136683573 16:31981622-31981644 GGGAGAGGGTTGGGGTCTGCTGG + Intergenic
1136784204 16:32925182-32925204 GGGAGAGGGTTGGGGTCTGCTGG + Intergenic
1136885580 16:33928624-33928646 GGGAGAGGGTTGGGGTCTGCTGG - Intergenic
1139336637 16:66236512-66236534 GGGCCACGGATGGCGTCTGCTGG - Intergenic
1141590849 16:85067524-85067546 CAGCCAGGGGTGGCGACTGCAGG + Intronic
1142248949 16:88982472-88982494 CGGAGAGGGGCCGCATCTGCAGG - Intergenic
1142428647 16:90013994-90014016 AGGGCAGGGGTGGTGTGTGCAGG + Intronic
1203086859 16_KI270728v1_random:1189188-1189210 GGGAGAGGGTTGGGGTCTGCTGG + Intergenic
1142795339 17:2303291-2303313 CGGAAAGGAGTGGGGTCTGGTGG - Intronic
1143140627 17:4740029-4740051 CGAAAAGTGGTGGCGGCTGCAGG + Exonic
1143710354 17:8730241-8730263 GGGACAGGGGAGGCCTCTGGGGG - Intronic
1146514744 17:33480416-33480438 GAGACTGGGGTGGAGTCTGCAGG + Intronic
1146809407 17:35891256-35891278 AGGGCAGGGGTGGGGTGTGCAGG - Intergenic
1147144488 17:38477329-38477351 GGGAGAGGGTTGGGGTCTGCTGG + Intronic
1147884480 17:43675581-43675603 CGGACAGGGCTGGCCTGGGCAGG + Intergenic
1150062867 17:62083883-62083905 CGGTCAGGGCTGGCATCTTCAGG - Intergenic
1151415305 17:73958219-73958241 CCGACAGGTGTGGGGTTTGCTGG + Intergenic
1152900907 17:82940570-82940592 AGGACAGAGGTGGCCTCTCCAGG + Intronic
1153682895 18:7517295-7517317 GGGACAGGGGAGGAGTGTGCAGG + Intergenic
1156515183 18:37673399-37673421 AGGACTGAGGTGCCGTCTGCTGG + Intergenic
1160525262 18:79532120-79532142 CGGACACCGGAGGGGTCTGCTGG - Intergenic
1160856474 19:1220178-1220200 CGGACGAGGGTGGCCACTGCAGG + Intronic
1160873864 19:1288393-1288415 GGGAGAGGAGTGGCGTCAGCCGG + Intronic
1161506219 19:4645123-4645145 GGGACAGGGGTGGGGACGGCAGG + Intronic
1161535464 19:4816475-4816497 CGTGCAGGGGTGGCGGCTGCGGG + Exonic
1162142127 19:8591369-8591391 AAGAGAGGGGTGGCGGCTGCAGG + Intronic
1162967198 19:14161533-14161555 CGGAGCGGGGTGGTGGCTGCGGG + Exonic
1163055562 19:14714952-14714974 GGGACAGTGGTGGGGGCTGCAGG + Intronic
1164146225 19:22514229-22514251 CTCACAGGGGAGGGGTCTGCAGG + Intronic
1165108934 19:33490022-33490044 CGGACAGCGGCAGTGTCTGCAGG - Exonic
1165436409 19:35797648-35797670 CGGGCAGGGGTGTGGTCTGAGGG + Intergenic
1167040288 19:47019782-47019804 CGGGCGGGGGCGGGGTCTGCCGG - Intergenic
1167896340 19:52585349-52585371 CGGACAGGGGTGGGGTCTGCAGG - Exonic
1167909437 19:52689994-52690016 AGGACAAGGGTGGGGTCTGCAGG + Intronic
1167925946 19:52821152-52821174 CGGACAAGGGTGGGATCCGCAGG + Intronic
1167930132 19:52857138-52857160 CGGACAAGGGTGGGATCCGCAGG + Intronic
1167934775 19:52897220-52897242 CGGACAGGGGTGGCGTCTGCAGG + Intronic
1167937956 19:52922934-52922956 CGGACAAGGGTGGGGTCCGCAGG + Intergenic
1167946469 19:52992853-52992875 AAGACAAGGGTGGGGTCTGCAGG + Intergenic
1167952317 19:53037417-53037439 AGGATAGGGGTGGGGTCTGCAGG + Intergenic
1167960769 19:53102938-53102960 AGGACAGGGGTGGGATGTGCAGG + Intronic
1167964513 19:53132448-53132470 CAGACAGGGGTGGGGTCTGCAGG + Intronic
1167967330 19:53158289-53158311 AGAAGAGGGGTGGGGTCTGCAGG + Intronic
1167971881 19:53192887-53192909 AGGAGAGGGGTGGGGTATGCAGG + Intronic
1167995112 19:53395608-53395630 AAGACAAGGGTGGGGTCTGCAGG - Intronic
1168003607 19:53468183-53468205 AAGACAAGGGTGGGGTCTGCAGG - Intronic
925669396 2:6294614-6294636 CTGACAGGTGTGGTGTCTCCAGG - Intergenic
926418678 2:12675744-12675766 GGTACAGGGGTGTCCTCTGCTGG - Intergenic
935011499 2:99140983-99141005 CGGGCAGGAGTGGCGGGTGCGGG - Intronic
936093941 2:109517633-109517655 CAGACAGCCGTGGGGTCTGCAGG - Intergenic
937216520 2:120316736-120316758 CGGGCAGGGGTGGGGTTTGTGGG + Intergenic
937227307 2:120377289-120377311 CGGAGAAGGGAGGGGTCTGCAGG - Intergenic
937304325 2:120861869-120861891 CAGGCAGGGGTTGTGTCTGCAGG + Intronic
940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG + Intronic
942413755 2:175737290-175737312 CAGAGAGGGGTGGGCTCTGCAGG - Intergenic
946314022 2:218897727-218897749 CGGCCAGGGGTGGGGACAGCGGG + Intronic
948231490 2:236352205-236352227 CGGCCAGCGGTGGCCTGTGCTGG + Intronic
1170562558 20:17569838-17569860 CGGACTGGGCTGGCTCCTGCTGG - Intergenic
1174068967 20:47886756-47886778 CTGATATGGGTGGTGTCTGCTGG + Intergenic
1174494599 20:50930872-50930894 CGGACAGCGGCGGCGGCGGCGGG + Exonic
1174736847 20:52973076-52973098 CAGACACGGGTGGCTTGTGCCGG - Exonic
1176386300 21:6139992-6140014 CGGGAAGGGGTGGCTTCTGGGGG + Intergenic
1176624775 21:9083544-9083566 CGGACAGGGGCGGCTCCTGGGGG - Intergenic
1179713023 21:43273912-43273934 AGGAGAGAGGAGGCGTCTGCTGG - Intergenic
1179737173 21:43398260-43398282 CGGGAAGGGGTGGCTTCTGGGGG - Intergenic
1181668100 22:24412236-24412258 GGGACTGGGGTGGGGGCTGCGGG - Intronic
1184476546 22:44725158-44725180 CGGACTGGGGTGGGGCCTCCTGG - Intronic
1185314011 22:50170985-50171007 CGGGCAGAGGGGGCGTCCGCAGG + Intronic
950566412 3:13772279-13772301 AGGGCAGGGGTGGCCACTGCTGG + Intergenic
954558079 3:51533931-51533953 CGGCCAGGGGAGGTGTCTTCCGG + Intergenic
961365736 3:126398185-126398207 CGGGCAGGGGTGGGGGCTGCAGG + Intronic
968002299 3:195214406-195214428 TGGACATGGGTGGGGTCAGCAGG - Intronic
969883946 4:10198553-10198575 CGGAAAGGGATGGCCACTGCTGG + Intergenic
986787390 5:11127036-11127058 CGTGCAGGGGTGGGGTCTGCAGG + Intronic
990711159 5:58582272-58582294 GGGGTAGGGGTGGCGTCTGGCGG - Intronic
991542371 5:67743962-67743984 TGGACAGGGGTGGGGTCGGGTGG - Intergenic
992219541 5:74558180-74558202 CAGACAGAGGCGGTGTCTGCTGG - Intergenic
992411535 5:76510428-76510450 CAGGCAGGGGTGGCGCCTGAGGG + Intronic
996117145 5:119631455-119631477 AGCACAGTGGTGGGGTCTGCGGG + Intronic
998393750 5:141804952-141804974 AGGGCAGGGGTGGGCTCTGCAGG + Intergenic
999129349 5:149271440-149271462 AGGAAATGGGTGGCGGCTGCAGG + Intergenic
1002432107 5:179209642-179209664 GGGACAGGGGTGGGGCCGGCAGG + Intronic
1002634062 5:180598505-180598527 CACACAGGGGTGGAGTCAGCCGG - Intergenic
1004426001 6:15507510-15507532 CGGGGAGGGATGGCGTCTTCAGG + Intronic
1006676267 6:35765864-35765886 CTGACAGGTGCGGCGTGTGCCGG - Intergenic
1006738057 6:36289210-36289232 CTCCCAGGGGTGGCTTCTGCTGG + Intronic
1013366455 6:109441317-109441339 GGGGCAGGGGAGGCGACTGCTGG - Intronic
1013615704 6:111841169-111841191 CTTCCAGGGGTGGCATCTGCAGG - Intronic
1020013043 7:4816733-4816755 CGCACAGAGGTGGCGCCTGGGGG + Intronic
1020274180 7:6615120-6615142 CGGACCGGGGTGGCCTCTCCAGG + Intergenic
1021597231 7:22330257-22330279 AGGACAAGGCTGGGGTCTGCTGG + Intronic
1027482719 7:78718770-78718792 CGGACAGGGGTTGGGGGTGCGGG - Intronic
1029706548 7:102279587-102279609 GGGACAGGGCTGGGGGCTGCTGG - Intronic
1029855747 7:103515226-103515248 CCGACAGGGCCGGCATCTGCAGG + Exonic
1032398545 7:131607982-131608004 CGGGCAGGCGTGGGGTCTGGTGG + Intergenic
1034330775 7:150280301-150280323 ATGACAGGGGTGGGGCCTGCGGG - Intronic
1034667269 7:152829548-152829570 ATGACAGGGGTGGGGCCTGCGGG + Intronic
1037738280 8:21583850-21583872 AGGAGAGGGGTGGGGGCTGCAGG - Intergenic
1039885875 8:41653752-41653774 CGGGCCGGGGTGGCCTCTGGCGG + Intronic
1049385491 8:142341095-142341117 GGGACAGGGGAGGGGTCTGGGGG - Intronic
1049749835 8:144277819-144277841 CGGGCAGGGGCGGCCACTGCTGG + Intronic
1057514667 9:95711117-95711139 CGGTCAGGGCTGCTGTCTGCTGG - Intergenic
1057566493 9:96169768-96169790 CGGCCCTGGGTGGCGGCTGCTGG - Intergenic
1057834841 9:98436040-98436062 AGGATAGGGGTGGCGGCTGCTGG - Intronic
1057839152 9:98471232-98471254 CGGACAGGGATTGGGTCTCCTGG + Intronic
1059740383 9:117144166-117144188 CAGTGAGGGGTGGCATCTGCAGG + Intronic
1060520686 9:124292309-124292331 GGGACAGGGGTGGCTGCTGATGG + Intronic
1060793263 9:126499618-126499640 CGGGCAGGGACCGCGTCTGCGGG + Intronic
1060827918 9:126696888-126696910 AGGGCAGGGGTGGCCTCTGGGGG + Exonic
1062309415 9:135928124-135928146 AGGGCAGGGGTGGCAGCTGCGGG - Intergenic
1203747938 Un_GL000218v1:53972-53994 CGGACAGGGGCGGCTCCTGGGGG - Intergenic
1188156433 X:26748467-26748489 AAGACAGGGGTGGCGGCTGGAGG - Intergenic
1193096814 X:77558402-77558424 CTGAGAGGGGTTGCATCTGCTGG + Intronic
1198533522 X:137566586-137566608 CGGAAAGGGGTGGCGGCGGTTGG - Exonic
1199990341 X:152984187-152984209 CTGACAGGGGTGCCGTCCTCAGG - Intergenic
1200033431 X:153313661-153313683 CTGACAGGGGTGCCGTCCTCAGG - Intergenic