ID: 1167935194

View in Genome Browser
Species Human (GRCh38)
Location 19:52900131-52900153
Sequence TGTATCTGGTATAACCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167935190_1167935194 12 Left 1167935190 19:52900096-52900118 CCACTGATCAGGCAGCTTAGCAT 0: 14
1: 15
2: 17
3: 20
4: 125
Right 1167935194 19:52900131-52900153 TGTATCTGGTATAACCTGGTGGG No data
1167935189_1167935194 17 Left 1167935189 19:52900091-52900113 CCTGTCCACTGATCAGGCAGCTT 0: 14
1: 21
2: 10
3: 15
4: 124
Right 1167935194 19:52900131-52900153 TGTATCTGGTATAACCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167935194 Original CRISPR TGTATCTGGTATAACCTGGT GGG Intergenic
No off target data available for this crispr