ID: 1167945680

View in Genome Browser
Species Human (GRCh38)
Location 19:52986701-52986723
Sequence TTGAATGCAAAGATGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 1, 2: 4, 3: 32, 4: 385}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167945680_1167945689 25 Left 1167945680 19:52986701-52986723 CCTTGCTCCATCTTTGCATTCAA 0: 1
1: 1
2: 4
3: 32
4: 385
Right 1167945689 19:52986749-52986771 GGAGGGACCAGGTCCACGGTTGG 0: 1
1: 0
2: 4
3: 19
4: 182
1167945680_1167945684 7 Left 1167945680 19:52986701-52986723 CCTTGCTCCATCTTTGCATTCAA 0: 1
1: 1
2: 4
3: 32
4: 385
Right 1167945684 19:52986731-52986753 TGGCTCACGACTCCTACTGGAGG 0: 1
1: 1
2: 1
3: 23
4: 69
1167945680_1167945686 14 Left 1167945680 19:52986701-52986723 CCTTGCTCCATCTTTGCATTCAA 0: 1
1: 1
2: 4
3: 32
4: 385
Right 1167945686 19:52986738-52986760 CGACTCCTACTGGAGGGACCAGG 0: 1
1: 1
2: 0
3: 12
4: 73
1167945680_1167945685 8 Left 1167945680 19:52986701-52986723 CCTTGCTCCATCTTTGCATTCAA 0: 1
1: 1
2: 4
3: 32
4: 385
Right 1167945685 19:52986732-52986754 GGCTCACGACTCCTACTGGAGGG 0: 1
1: 1
2: 0
3: 4
4: 49
1167945680_1167945688 21 Left 1167945680 19:52986701-52986723 CCTTGCTCCATCTTTGCATTCAA 0: 1
1: 1
2: 4
3: 32
4: 385
Right 1167945688 19:52986745-52986767 TACTGGAGGGACCAGGTCCACGG 0: 1
1: 2
2: 10
3: 36
4: 172
1167945680_1167945683 4 Left 1167945680 19:52986701-52986723 CCTTGCTCCATCTTTGCATTCAA 0: 1
1: 1
2: 4
3: 32
4: 385
Right 1167945683 19:52986728-52986750 AGCTGGCTCACGACTCCTACTGG 0: 1
1: 1
2: 2
3: 11
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167945680 Original CRISPR TTGAATGCAAAGATGGAGCA AGG (reversed) Intergenic
900822122 1:4897821-4897843 TGGAAAGCAAAGAGGAAGCAAGG - Intergenic
903054723 1:20627747-20627769 TTGAATGTAAAAATGGAAAAAGG - Intergenic
903623341 1:24713976-24713998 GTGAATGCTAAGGTGGAGCCAGG + Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
906605153 1:47164132-47164154 GGCCATGCAAAGATGGAGCAGGG - Intergenic
906634823 1:47402412-47402434 TAGAATGAAGAGTTGGAGCAGGG + Intergenic
906846249 1:49196020-49196042 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
907664346 1:56421248-56421270 ATAAATGCAAAGATGGTGGATGG - Intergenic
910186219 1:84543479-84543501 TGGAAGGCAAAGGGGGAGCAAGG + Intergenic
910746532 1:90580792-90580814 GTGAAAGCAAAGAGGGAGCAAGG - Intergenic
911709836 1:101057827-101057849 CAGAATGCAAAGAGGCAGCAAGG - Intergenic
911759076 1:101596166-101596188 TTGAAAGCCAAGATAGATCAAGG - Intergenic
912387662 1:109280286-109280308 TTGTATGGAAAGATGGAGAGAGG - Intronic
912790471 1:112644486-112644508 TTGAATACAAAGCTGGGGCCAGG - Intronic
913385349 1:118252974-118252996 TTGAAGGGAAAGAGGGAGGAAGG - Intergenic
913560157 1:120010386-120010408 TTGAATACAAGCATGTAGCATGG + Intronic
913637966 1:120783180-120783202 TTGAATACAAGCATGTAGCATGG - Intergenic
914280745 1:146169805-146169827 TTGAATACAAGCATGTAGCATGG + Intronic
914541788 1:148620745-148620767 TTGAATACAAGCATGTAGCATGG + Intronic
914624852 1:149450502-149450524 TTGAATACAAGCATGTAGCATGG - Intergenic
914684228 1:149964283-149964305 TTGTATGCACTGATGGAGAAGGG - Exonic
915016027 1:152734643-152734665 TTGAAAGAAAAGAGGGAACAGGG - Intergenic
915074740 1:153298865-153298887 TCCAAGGCAAACATGGAGCAAGG - Intronic
916116713 1:161491015-161491037 TTGAATGCGAAGATGAAACGAGG + Intergenic
917663137 1:177197207-177197229 TGGAAGGCAAAGGGGGAGCAAGG + Intronic
917736940 1:177929989-177930011 TTGATTGGACAGATGGAGCTAGG + Intronic
917952268 1:180051458-180051480 TTGACTGCAAAGAGGATGCACGG + Intronic
918087337 1:181256862-181256884 TTTAAGGGCAAGATGGAGCAAGG + Intergenic
919371733 1:196736962-196736984 TTACATGCAAAGATGGAAGATGG + Exonic
919392314 1:197002620-197002642 TTGTATGTAAAGATGGACGATGG + Exonic
920628989 1:207633146-207633168 TTGAATTCAGAGCTGGAGCTGGG - Intronic
921501460 1:215909298-215909320 ATGAATGAATAGATGGAACACGG + Intronic
921711170 1:218374798-218374820 TTGAACTCACAGAGGGAGCAGGG - Intronic
923290364 1:232539485-232539507 TTGAAGGCAAAGATGCAGAAGGG - Intronic
1063081518 10:2772341-2772363 TTGAATGCATAGACTGAGTAAGG + Intergenic
1063857641 10:10272611-10272633 TTGATTCCAAGGATGGGGCAGGG + Intergenic
1064755264 10:18567392-18567414 TGAAATGCAATGATGGAGAATGG - Intronic
1065377196 10:25055269-25055291 TTGCATGCAAAAGTTGAGCAGGG + Intronic
1065598401 10:27341339-27341361 TTGAAGGCAGAGAAAGAGCATGG - Intergenic
1067318461 10:45194340-45194362 TTGAAGGCAGAGAAAGAGCATGG - Intergenic
1067661304 10:48237990-48238012 TTTTCTGCAAAGAAGGAGCAAGG - Exonic
1067794837 10:49313388-49313410 ATGAGGGGAAAGATGGAGCAAGG + Intronic
1067847681 10:49736661-49736683 TTGAACTAAAAGATGGAGCAGGG + Intronic
1068731493 10:60363229-60363251 TTGAATGCAGATTTGCAGCATGG + Intronic
1068956193 10:62819969-62819991 TTGAATACAAACATGTACCATGG + Intronic
1069080642 10:64084860-64084882 GTCAAGGCAAAGATGCAGCAGGG - Intergenic
1069982082 10:72259933-72259955 TTTCCTGCATAGATGGAGCAAGG - Intergenic
1070760235 10:79019682-79019704 TTGAATGAAAAGAGGGTGGATGG + Intergenic
1070909771 10:80107845-80107867 CTGAATGCAAAGATGGAATGAGG + Intergenic
1071613677 10:87055265-87055287 GTGACTGTAATGATGGAGCACGG + Intronic
1071769953 10:88717237-88717259 TTGAATGAAAAGATCTAGAAGGG - Intergenic
1072532786 10:96335375-96335397 GTGAATGAAAGGATGGAGGAAGG - Intronic
1073443192 10:103564870-103564892 TTTAATGCCAGGATGGAGGAGGG + Intronic
1073673368 10:105617320-105617342 TTGGCTTCAAAGATGGAGGAAGG + Intergenic
1073946117 10:108752650-108752672 TGGAAGGCGAAGGTGGAGCAAGG + Intergenic
1074346513 10:112691353-112691375 TTGGATGGGAAGATGTAGCAAGG + Intronic
1074950516 10:118329810-118329832 ATGAATGCAAACATGGATGACGG - Intronic
1075568112 10:123519317-123519339 TTCATAGCAAAGATGCAGCAGGG + Intergenic
1076266778 10:129114856-129114878 TTGAATGCAGAGACTTAGCAAGG - Intergenic
1077213679 11:1385400-1385422 TGGAAGGCAAAGGGGGAGCAGGG + Intergenic
1078414221 11:11152015-11152037 TTGAATGCAATGAAGGATGAAGG - Intergenic
1079663840 11:23078261-23078283 TTGAAAGTAAAAATGGAGAAAGG + Intergenic
1080726970 11:34907951-34907973 TTGAAAGAAAAGATGGGGGAGGG - Intronic
1080881829 11:36328494-36328516 TGGAAAACAAAGAGGGAGCAAGG - Intronic
1082171659 11:49012376-49012398 CGGAATGCAGAGATGGAGCAGGG + Intergenic
1082765646 11:57165498-57165520 TGGAATGCAAAGGAGGAGCAAGG + Intergenic
1084970863 11:72771391-72771413 CTGAGTCCAAAGATGGGGCAAGG - Intronic
1086020271 11:82220012-82220034 TGGACCGCAAAGATGAAGCAGGG - Intergenic
1086491189 11:87359283-87359305 TGGAATGCAAAGATGATGCCTGG - Intergenic
1088035633 11:105310621-105310643 CTGAATAGAAAGATGGAACAGGG - Intergenic
1089826796 11:121284943-121284965 CTGAATGCAAAGATGGAACGAGG + Intergenic
1090448778 11:126787877-126787899 ATGAATGCCAAGAAGAAGCAGGG - Intronic
1090519156 11:127460266-127460288 TCGAATGGAAAAATGAAGCAGGG - Intergenic
1091388240 12:108834-108856 TTCAAAGCAAAGAAGGAGCCAGG - Intronic
1091688257 12:2578914-2578936 GGGAAGGCAGAGATGGAGCATGG - Intronic
1092395031 12:8118530-8118552 TGGAAGGCAAAGTGGGAGCAAGG + Intergenic
1092876282 12:12850869-12850891 TGGAAAGCAAAGGAGGAGCAAGG + Intergenic
1093348754 12:18071065-18071087 CTGAATGCGAAGATGGAACAAGG + Intergenic
1094090680 12:26645592-26645614 TTGAATGCCCAGAGGCAGCATGG + Intronic
1094607102 12:31958514-31958536 TTGAGTGCAAAGTTTGAGGATGG + Intergenic
1094773796 12:33697603-33697625 TTGAATGCAAAAATGGAGCAAGG - Intergenic
1095200044 12:39373190-39373212 TTTAATGCAAAGATGTAGCATGG - Intronic
1096258027 12:50074576-50074598 TTGACCTCACAGATGGAGCAAGG - Intronic
1097318792 12:58202629-58202651 TTGAACAAAAAGATGGAGGAAGG - Intergenic
1097326817 12:58286636-58286658 ATAAATGCAAAGATGTAACAGGG - Intergenic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1098783252 12:74715307-74715329 TTTGTTGCAAATATGGAGCAGGG + Intergenic
1099671776 12:85702938-85702960 TAGAAGGCAAAGGTGAAGCAAGG - Intergenic
1101061447 12:100976705-100976727 TTTAATGAGAAGATGGAGCTTGG - Intronic
1101496189 12:105256584-105256606 TGGAAAGCAAAGAGGAAGCAAGG + Intronic
1102011068 12:109618618-109618640 TGGAAAGCAGAGAGGGAGCAGGG + Intergenic
1104120279 12:125791946-125791968 GTGAGTGCAAAGATGGAGCGGGG - Intergenic
1105224148 13:18413019-18413041 TTGAAGGCAGAGAAAGAGCATGG + Intergenic
1106112800 13:26791897-26791919 TGGAAGGCAAAGAAGAAGCATGG - Intergenic
1108034912 13:46280500-46280522 TTGAATGGAAAGATGCAGAAAGG - Intergenic
1108482952 13:50893773-50893795 TTGCATGTAAACAGGGAGCATGG - Intergenic
1109606546 13:64705124-64705146 GTGAATACGAAGATGGAACAAGG - Intergenic
1111795577 13:92915107-92915129 GTTAATGCATAGAGGGAGCAGGG - Intergenic
1111806388 13:93043979-93044001 CTGAATGCGAAGACGGAACAAGG + Intergenic
1112106638 13:96247511-96247533 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
1113646607 13:112001839-112001861 ATGAATGCAACGATGGAATATGG - Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114453276 14:22839857-22839879 AAGAAAGCAAAGCTGGAGCAGGG + Intronic
1116081092 14:40173541-40173563 TTTAATGCAGAGTTGGAGCCTGG + Intergenic
1117319705 14:54609268-54609290 CTGACTTCAAAGATGGAGAAAGG + Intronic
1117492652 14:56266865-56266887 TTTAATGTATAGATGCAGCATGG - Intronic
1119571630 14:75679312-75679334 TTGACTTCAAAGATAGAGGAAGG + Intronic
1119922798 14:78461971-78461993 TTCAATGCAAAGCTGGAGTTGGG - Intronic
1119938928 14:78619699-78619721 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
1120508701 14:85385695-85385717 TGGAATGCAAAGTTGGAGGGTGG - Intergenic
1120642299 14:87029817-87029839 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1120781827 14:88492511-88492533 TCGGATGCAAACATGGTGCAGGG + Intronic
1121038278 14:90724610-90724632 TGGAAGGCAAAGGGGGAGCAGGG - Intronic
1121507475 14:94487686-94487708 GTGAAGGAAAAGATGGTGCAGGG + Intronic
1122005557 14:98700590-98700612 TGAAATGCAGAGATGGAGGAAGG + Intergenic
1122051606 14:99064784-99064806 TTGGATGCAAAGATGAAGAAAGG - Intergenic
1123391489 15:19878446-19878468 TTGAAGGCAGAGAAAGAGCATGG + Intergenic
1125410930 15:39405465-39405487 GTGAATGCAATGATGTTGCAGGG - Intergenic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1127324630 15:57883327-57883349 ATGACTGCAAAGAAGGAGCATGG - Intergenic
1128355730 15:66925173-66925195 ATGAATTCACAGATGGAGCCTGG + Intergenic
1128602913 15:69012807-69012829 TTGAAAGCAGAACTGGAGCAGGG - Intronic
1130448634 15:84028950-84028972 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
1131179358 15:90229446-90229468 TTGAGTTCAAAGATGGAGCGAGG - Exonic
1131213320 15:90516583-90516605 TTGAATGCAAATATGATGCCTGG - Intergenic
1131953000 15:97701992-97702014 TTGAAAGCATAAATGGACCAGGG + Intergenic
1131993470 15:98112528-98112550 TTGGATGCAGAGATTGAGCGTGG - Intergenic
1132084422 15:98895526-98895548 TTGAATGCAATGGTAGAGGAAGG + Intronic
1133518648 16:6534718-6534740 CAGAATGCAAAGAGGGAGAAGGG + Intronic
1133650780 16:7812485-7812507 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1134855950 16:17519216-17519238 TTAACTGCAAAGATGAATCAAGG + Intergenic
1136065452 16:27755323-27755345 CAGAAGGCAGAGATGGAGCAGGG - Intronic
1137770212 16:51010349-51010371 CTGAATGGAAAGATGTAGCCTGG + Intergenic
1138748133 16:59387292-59387314 GTGCATGCAAGGATGGAGGATGG + Intergenic
1139510420 16:67425073-67425095 TGGTATGCAAATATCGAGCAGGG - Intergenic
1139974460 16:70797861-70797883 TGGAGGGCAAAGAGGGAGCAAGG - Intronic
1140248976 16:73277856-73277878 TGGAAGGCAAAGTGGGAGCAAGG + Intergenic
1140676585 16:77338197-77338219 ATGTATGAAAAGATGGAGCCAGG - Intronic
1140830370 16:78745301-78745323 TTGAAGGCAGAGGTGGAGGAAGG - Intronic
1140870445 16:79101576-79101598 TTGAATGAAAAGATTCACCAGGG - Intronic
1141283390 16:82649300-82649322 ATGAATGCATAGATGGAGGATGG + Intronic
1142526517 17:545642-545664 TTGAAGGTAAAGAGGGAGCCAGG - Intronic
1144866574 17:18339395-18339417 TTGAATGAAAGGAGGGTGCATGG - Intronic
1148535566 17:48435733-48435755 TAGAATTCAGAGTTGGAGCAGGG + Intergenic
1148772005 17:50072720-50072742 GTGATTGCAGGGATGGAGCAAGG + Intronic
1149141591 17:53438295-53438317 TGGAAGGCGAAGATGAAGCAAGG + Intergenic
1149831318 17:59874538-59874560 TCTAATGCAAAGATGGAAGAAGG - Exonic
1150352003 17:64452601-64452623 TTGAGTCCAAACATGGAGAAGGG - Intronic
1150998375 17:70345535-70345557 TTGATTTCAAAGATTGGGCATGG + Intergenic
1151000386 17:70369123-70369145 TAGAAAGCAAAGGTGGAGGAAGG - Intergenic
1151060813 17:71091596-71091618 TTAAATGGCAAGACGGAGCAAGG - Intergenic
1151148862 17:72066497-72066519 TGGAAGGCAAAGGAGGAGCAAGG + Intergenic
1151218772 17:72595886-72595908 TGGAAGGCAAAGGAGGAGCAAGG + Intergenic
1151905077 17:77042548-77042570 TGGAAAGCAGAGAAGGAGCATGG + Intergenic
1152886074 17:82850741-82850763 TTCAATGCAGGGATGGATCAGGG - Intronic
1154529158 18:15326093-15326115 TTGAAGGCAGAGAAAGAGCATGG - Intergenic
1155140986 18:23044260-23044282 TGGAAGGCAAAGAAGGAGCAAGG - Intergenic
1155278586 18:24214659-24214681 TTGAATGTAACTCTGGAGCAAGG + Intronic
1156524963 18:37758275-37758297 CTGAAGGCAAAGGGGGAGCAGGG + Intergenic
1157257813 18:46154037-46154059 GAGAATTCAAAGATGGAGGAAGG + Intergenic
1157434919 18:47660195-47660217 TTGAATGCCAGGATGGTGTAGGG + Intergenic
1158136079 18:54209683-54209705 GTGAAAGCAAACATGGAGGAGGG + Intronic
1158182991 18:54738940-54738962 TTGACTGCAAAGAAGCATCAGGG - Intronic
1158407781 18:57175662-57175684 TTAAATGCAGAGCTGGAGCAAGG - Intergenic
1158731188 18:60024346-60024368 ATGAATGTAAAGATGCAGGATGG + Intergenic
1158861204 18:61594005-61594027 TGGAAGGCAAAGAGGGAGCGAGG - Intergenic
1162308866 19:9892919-9892941 TTGAATCCTGAGATGGACCAGGG - Intronic
1164516837 19:28943862-28943884 TACAATGCACAGAGGGAGCAGGG - Intergenic
1165440581 19:35824775-35824797 TTCAATAGAAAGATGGAGCCAGG + Intergenic
1166426239 19:42680898-42680920 AGGAAGGCAAAGAGGGAGCAAGG - Intronic
1167144166 19:47672132-47672154 ATGGATGGAAGGATGGAGCATGG + Intronic
1167598418 19:50439461-50439483 GTGAATGCATGGATGGAGCTTGG - Intronic
1167945680 19:52986701-52986723 TTGAATGCAAAGATGGAGCAAGG - Intergenic
1168576525 19:57516177-57516199 CTGAATGCAAAGACAGAACAAGG + Intronic
1168680540 19:58312289-58312311 CTGAATGCAAAGACAGAACAAGG + Exonic
926068038 2:9859995-9860017 TGGAAAGCAAAGGTGAAGCAAGG + Intronic
927361272 2:22236982-22237004 TTGAATAGAAAGATGGAGATGGG - Intergenic
927381986 2:22489800-22489822 TTAAAGTCAAAGATGGAGAAGGG + Intergenic
928653653 2:33427160-33427182 TGGAATTCAAAGATGGGGCTTGG - Intergenic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929309828 2:40409827-40409849 TTGAAGGCAAAGCAGGATCAAGG - Intronic
931244558 2:60481312-60481334 TTGAAAACAAAAATGAAGCAGGG + Intronic
932557079 2:72833931-72833953 TTGGATGAAAAGATGGTGAAGGG - Intergenic
934926548 2:98385813-98385835 TGGAAGGCAAAGGGGGAGCAAGG + Intronic
935322721 2:101904756-101904778 TTGGATGCAAAGAGGCAGGAGGG - Intergenic
935738823 2:106128530-106128552 TAGAACACAAAGATGGAGGAAGG + Intronic
936444829 2:112587166-112587188 TGGAAAGTCAAGATGGAGCATGG - Intronic
936501288 2:113068529-113068551 TTGGATGGAAAGATTGAGTAAGG - Intronic
937167169 2:119830802-119830824 TGGAAGGCAAAGAGAGAGCAAGG - Intronic
938122562 2:128644287-128644309 TTGAAAGCAAGAAAGGAGCACGG - Intergenic
938528260 2:132157509-132157531 TTGAAGGCAGAGAAAGAGCATGG - Intronic
938574350 2:132590153-132590175 TCAAATGCAAAGATGCTGCAAGG + Intronic
938631715 2:133174721-133174743 TTGATTCCAAAGCTGGAGCAGGG - Intronic
939255133 2:139733617-139733639 TAGAAGGCAAAGTGGGAGCAAGG + Intergenic
940449434 2:153818783-153818805 TAAAATGCTCAGATGGAGCAGGG - Intergenic
942126170 2:172827813-172827835 TTGGATGCATAGACAGAGCAGGG + Intronic
942687818 2:178552304-178552326 AAGAATGCCAAGAAGGAGCATGG - Exonic
942816686 2:180060711-180060733 CTGAATGCGAAGATGGAACAAGG + Intergenic
942885492 2:180918744-180918766 TGGAAGGCAAAGGGGGAGCAAGG + Intergenic
945047814 2:205797546-205797568 TTGAATGCTAAAAAGAAGCAGGG + Exonic
945121958 2:206466893-206466915 TGGAAGGCAAAGTGGGAGCAAGG + Intronic
945373126 2:209045814-209045836 TTAAATTCAAAAATTGAGCAAGG - Intergenic
945804524 2:214474264-214474286 CTGAAAGCAAAGAGGCAGCATGG + Intronic
947784384 2:232802555-232802577 TAGAATGCAAGGATGGTTCAAGG - Intronic
1170801994 20:19598264-19598286 TTGAATGGAAACCTGGAGCCTGG + Intronic
1170839994 20:19916903-19916925 TCAAATGCACAGATGGAGCCAGG - Intronic
1170970472 20:21111347-21111369 TTCAGTGCAAATCTGGAGCATGG + Intergenic
1171306875 20:24114199-24114221 TAGACAGCAAAGATTGAGCATGG - Intergenic
1171749783 20:29037901-29037923 GTGAATGCAAACAAGAAGCAAGG + Intergenic
1171936829 20:31282601-31282623 TGGAAGGCAAAGGGGGAGCAAGG - Intergenic
1172528286 20:35614224-35614246 ATGAATGTTAAGAAGGAGCAGGG - Intergenic
1174094429 20:48076942-48076964 TTTAATGCAGAGATGGAGGCAGG - Intergenic
1175351082 20:58318743-58318765 TTTAATGGAAAGATGGAGGGAGG - Intronic
1176047158 20:63098773-63098795 GTGAATGCATGGATGGATCATGG + Intergenic
1176047174 20:63098894-63098916 GTGAATGCATGGATGGAACATGG + Intergenic
1176047190 20:63099015-63099037 GTGAATGCATGGATGGATCATGG + Intergenic
1176315452 21:5238100-5238122 GTGAATGCAAACAAGAAGCAAGG - Intergenic
1176768240 21:13042394-13042416 TTGAAGGCAGAGAAAGAGCATGG + Intergenic
1177086266 21:16709082-16709104 TGGAAGGCAAAGGAGGAGCAAGG + Intergenic
1177298675 21:19211344-19211366 TGGAAAGCAAAGACAGAGCAAGG - Intergenic
1177449151 21:21243065-21243087 TAGAATGTAGAGATGAAGCAGGG + Intronic
1178183496 21:30191944-30191966 ATGAATGCGAAGATGGAAGAAGG - Intergenic
1178485213 21:33014992-33015014 CTGAATGCAATGATGGTGCAAGG - Intergenic
1179081882 21:38178977-38178999 CTGAAAGGAAAGATGGAGGATGG - Intronic
1179432780 21:41335531-41335553 TGGAAGGCAAAGCGGGAGCATGG - Intronic
1180393242 22:12304055-12304077 GTGAATGCAAACAAGAAGCAAGG - Intergenic
1180406509 22:12560713-12560735 GTGAATGCAAACAAGAAGCAAGG + Intergenic
1180515371 22:16136621-16136643 TTGAAGGCAGAGAAAGAGCATGG + Intergenic
1180750496 22:18121199-18121221 GTGGTTGCAAAGATGAAGCAAGG - Intronic
1181768397 22:25108695-25108717 TTGAAGGCAAAGATGGGGTGGGG - Intronic
1184293024 22:43508418-43508440 ATGAATGGATAGATGGGGCATGG - Intergenic
1184935579 22:47718022-47718044 TTGAATGGGAAGCTGCAGCAGGG - Intergenic
949102510 3:163076-163098 TTGAAGGCAGAGAGGAAGCAGGG - Intergenic
949940457 3:9150466-9150488 TTCCATGCACAGATGGAGAAAGG + Intronic
950737660 3:15023326-15023348 TGGCAGACAAAGATGGAGCAAGG + Exonic
951872918 3:27385183-27385205 CTGAATGGGAAAATGGAGCAAGG + Intronic
952022742 3:29042259-29042281 ATGTCAGCAAAGATGGAGCAGGG - Intergenic
953185115 3:40630323-40630345 TGGAATGCAAAGGAGAAGCAAGG - Intergenic
953475591 3:43203213-43203235 TTTAATGCAAAGAGACAGCATGG - Intergenic
954562404 3:51568933-51568955 TTGAGTGCAAAGCTTGAGGATGG + Intronic
955754942 3:62217162-62217184 TCTAATGAAAAAATGGAGCAGGG + Intronic
955877872 3:63512639-63512661 CTGAATTCAAAGCTGGAGGAAGG + Intronic
956645286 3:71449197-71449219 TTAATTGCAAAAATAGAGCAGGG + Intronic
957042272 3:75345048-75345070 TTGAATGCAAATTTGGATCCAGG - Intergenic
957594001 3:82236992-82237014 AAGGATGCAAAGATGGAGAAAGG + Intergenic
957903168 3:86523728-86523750 CTGAATTCGAAGATGGAGGATGG - Intergenic
957938245 3:86971069-86971091 TTCAATGGAAAGATCTAGCAAGG - Intronic
959587426 3:108037987-108038009 TGGAATGCAAAGAAGGTGGAAGG - Intergenic
959979695 3:112502283-112502305 TTGCATCCAATGATGGAGCAAGG + Intergenic
960498825 3:118410236-118410258 TGGAAGGCAAAGGGGGAGCAAGG - Intergenic
960724884 3:120660104-120660126 TGGAAGGCAAAGGGGGAGCAAGG - Intronic
961047000 3:123715898-123715920 TTGAATGCAAATTTGGATCCAGG - Intronic
963006887 3:140734794-140734816 TGGAAGGCAAAGGGGGAGCAAGG - Intergenic
963176886 3:142307460-142307482 CTGAATGCATTGATTGAGCAAGG + Exonic
963255529 3:143140824-143140846 CTGAAGGCAAAGGTGAAGCAAGG - Intergenic
963318525 3:143786792-143786814 ATGAATGCACAGAGGAAGCATGG + Intronic
964507637 3:157416984-157417006 TTGAATCCATAGAAAGAGCAAGG + Intronic
965384020 3:168024364-168024386 TTTAAAGCAAAAATGGATCATGG - Intronic
966259005 3:177953003-177953025 TTGCAGGCAAAGAGAGAGCAAGG + Intergenic
967001504 3:185340048-185340070 TTGACTGGAAAGATGCACCAGGG + Intronic
967864246 3:194177331-194177353 TGGAAGGCACAGATGGAGGAAGG + Intergenic
970250554 4:14111017-14111039 TTTTATGCAAAGATTGAGGAGGG + Intergenic
970297482 4:14646085-14646107 TTGAATACCAACATAGAGCAGGG + Intergenic
970894474 4:21086341-21086363 TTCAATGCAACGATGGAGATGGG - Intronic
972348477 4:38213351-38213373 TGGAATGCTAGGATGCAGCAAGG + Intergenic
972413542 4:38816482-38816504 TGGAAGGCAAAGGGGGAGCAAGG + Intronic
973901862 4:55483432-55483454 TTTAATGCAAATATGGTGCAGGG + Intronic
974129239 4:57732292-57732314 GTGCACGCAAAGATGGAGTAGGG + Intergenic
974150801 4:58006817-58006839 TGGAATGCAAGGATGGTTCAAGG + Intergenic
976120630 4:81777033-81777055 TCCAATGCAAGGAAGGAGCAGGG + Intronic
976268666 4:83208553-83208575 TAGAATGCAAACATGGATTAAGG - Intergenic
977068029 4:92344160-92344182 TTTAATGCTAAGATGAAGCCAGG + Intronic
977262207 4:94811318-94811340 CTGAAGGCAAAGAAAGAGCAGGG + Intronic
977393018 4:96437392-96437414 TAGAAGGCAAAGAGGAAGCAAGG + Intergenic
977646160 4:99415178-99415200 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
977953646 4:103001945-103001967 TGGAAGGCAAAGGAGGAGCACGG + Intronic
978315405 4:107430343-107430365 CTCAGAGCAAAGATGGAGCAAGG + Intergenic
978781479 4:112559533-112559555 TTGAATGAAAATATGAAGTAAGG + Intronic
978905006 4:113995327-113995349 TGGAATGCAAAGGAGAAGCAAGG + Intergenic
979341121 4:119525454-119525476 TTGAATGCAAATATGGAATAGGG - Intronic
980012279 4:127610106-127610128 TTGATTACAAATTTGGAGCAAGG + Intergenic
980086110 4:128391709-128391731 GTGATAGCAAACATGGAGCATGG + Intergenic
980551060 4:134335798-134335820 TGGAATGCAAAGGGGAAGCAAGG - Intergenic
981442339 4:144797402-144797424 TAGAAGGCAAAGCAGGAGCAGGG - Intergenic
981638803 4:146911933-146911955 ATGTCTGCAAAGATGGAGGAAGG + Intronic
982103446 4:151990910-151990932 TTGAATGCACAGAGACAGCAGGG - Intergenic
983917828 4:173311510-173311532 TGGAATGCAAAGGGGGAGCAAGG + Intronic
984355814 4:178655592-178655614 TAGAATGCAAAGGGGAAGCAAGG - Intergenic
985220039 4:187694859-187694881 TTGAACAAAAAGATTGAGCAAGG + Intergenic
985431674 4:189887457-189887479 GTGAATGCAAACAAGAAGCAAGG + Intergenic
986545189 5:8889443-8889465 TAGACTGCTTAGATGGAGCATGG + Intergenic
987692268 5:21282605-21282627 CTGAATGCAAAGATGGAATGAGG - Intergenic
987915626 5:24209191-24209213 TTGAATGGAAAGATAGAGTAAGG - Intergenic
987964477 5:24853948-24853970 TTGAATGGACAAATGGACCAGGG - Intergenic
988149147 5:27353571-27353593 AGGAATGCAAAAATGGAACAGGG + Intergenic
988230169 5:28466425-28466447 TAGAAGGCAAAGAGGAAGCAAGG - Intergenic
988424382 5:31046497-31046519 TTGAATGAAATGAGGGAGCTTGG - Intergenic
988628414 5:32901726-32901748 TGGAAGGCAAAGAGGAAGCAAGG + Intergenic
988999119 5:36742842-36742864 CTGACTTCAAAGATGGAGGAAGG + Intergenic
989817075 5:45749843-45749865 TGGAAGGCAAAGAAGAAGCAAGG + Intergenic
990315923 5:54583343-54583365 CTGAATGAAAACATTGAGCATGG + Intergenic
991144870 5:63289300-63289322 TTGATTCCAGAGATGGGGCACGG - Intergenic
991405419 5:66296462-66296484 AGGAATGAAGAGATGGAGCATGG - Intergenic
991748092 5:69767446-69767468 CTGAATGCAAAGATGGAATGAGG + Intergenic
991799672 5:70347293-70347315 CTGAATGCAAAGATGGAATGAGG + Intergenic
991828925 5:70662745-70662767 CTGAATGCAAAGATGGAATGAGG - Intergenic
991892030 5:71346722-71346744 CTGAATGCAAAGATGGAATGAGG + Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992142726 5:73815733-73815755 TTAAATCCAAAGTTGAAGCATGG + Intronic
992334886 5:75756382-75756404 GTGAAGTCAAAGGTGGAGCATGG + Intergenic
992389839 5:76320296-76320318 AGGAATGAATAGATGGAGCATGG + Intronic
992948375 5:81832237-81832259 TAGAACAAAAAGATGGAGCAAGG - Intergenic
993450015 5:88061767-88061789 CTGAATCCAAAGATGCTGCAAGG + Intergenic
993881439 5:93366485-93366507 AGGAATGCAAAGATGGTGGAAGG - Intergenic
994992182 5:107010948-107010970 TGGAAGGCAAAGAGGAAGCAAGG + Intergenic
995288413 5:110419193-110419215 AAGAAAGCAAAGATGGAGGAAGG + Intronic
995353907 5:111215130-111215152 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
996257304 5:121419932-121419954 TTTAAAGCAAAGATGGGGCCGGG - Intergenic
996616247 5:125444628-125444650 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
998517387 5:142769002-142769024 TTAAATTCATAAATGGAGCATGG - Intergenic
998782390 5:145672356-145672378 TTGATTCCCAAGATGGAGGAAGG - Intronic
999023774 5:148201573-148201595 TAGAATGGAAAGAGGGAGGAAGG + Intergenic
1000666887 5:164009113-164009135 TTGAATGCAGAAATTGAGCTAGG - Intergenic
1001741422 5:174055961-174055983 TTGAATCCAAAGAGGGAGTGTGG + Intronic
1002761288 6:204423-204445 TTGAATGCAAGGAAGGAGCAGGG - Intergenic
1004281047 6:14280257-14280279 TTGCAGGCAGAGAGGGAGCAAGG + Intergenic
1004519217 6:16346498-16346520 CTAAATGCAAAGAGGGAGCAAGG - Intronic
1005250013 6:23934685-23934707 GTGAAGGCAAAGCAGGAGCAGGG + Intergenic
1005484895 6:26290334-26290356 CTGAATGCAAAGATGGAACAAGG - Intergenic
1005925981 6:30446089-30446111 ATGAATCCAAAGATGGAAGAGGG - Intergenic
1006445856 6:34079448-34079470 CTGAATGCAACGATGAAGCTGGG - Intronic
1007999096 6:46339781-46339803 TAGAATGCAAAGTTGGAACCAGG + Intronic
1007999980 6:46350211-46350233 TTTAATGCATGAATGGAGCAGGG + Intronic
1008469794 6:51871531-51871553 GTGGCTACAAAGATGGAGCAAGG + Intronic
1009354902 6:62731210-62731232 TTGAAATCAAAGAAGGGGCATGG + Intergenic
1010391885 6:75347089-75347111 TTCAATGCACAGAGGGAGAAAGG - Intronic
1010651240 6:78457631-78457653 TTGGATGAATAAATGGAGCAGGG - Intergenic
1011041342 6:83033112-83033134 TGGCAGGCAAAGAAGGAGCAAGG + Intronic
1011121728 6:83961547-83961569 TAGAAAGCAAAGAAGAAGCAAGG - Exonic
1011774960 6:90719582-90719604 TTTAACTCATAGATGGAGCATGG - Intergenic
1012219543 6:96631829-96631851 TTGAATAAAAATATAGAGCATGG - Intergenic
1013564457 6:111343411-111343433 TTGACTGCAAAGCTGTAGAAGGG + Intronic
1015491504 6:133831620-133831642 TTGAATGCTGAGATGGTGTAAGG - Intergenic
1015877349 6:137836242-137836264 TTGAATGGAAACATGGAAAAAGG - Intergenic
1016598274 6:145826136-145826158 TGGAAGACAAAGAGGGAGCAGGG - Intergenic
1016632698 6:146250498-146250520 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
1016683034 6:146852530-146852552 TGGAAGGCAAAGGGGGAGCAAGG + Intergenic
1016810502 6:148256697-148256719 TTGACTGCAAAGAGGCAGAAGGG + Intergenic
1017026284 6:150184244-150184266 TTTAAGGCACAAATGGAGCATGG + Intronic
1017195433 6:151695176-151695198 TTGAATGCATACCTGGAGCTTGG + Intronic
1017642936 6:156511988-156512010 TTGAATGCAAAGATACAGGATGG - Intergenic
1018645435 6:165943645-165943667 TAGAATGAAAAGGTGGAGGAAGG - Intronic
1020865255 7:13552138-13552160 TTGAATACAAAGGTGGTGGAAGG - Intergenic
1023148213 7:37174021-37174043 TTCAAGGCAAAGAGAGAGCAGGG - Intronic
1024011766 7:45272891-45272913 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1024573787 7:50747620-50747642 TGGCATGCAAGCATGGAGCAGGG + Intronic
1026314629 7:69217513-69217535 TTGAATGGAAAGATGGTTGAAGG - Intergenic
1027736316 7:81937078-81937100 TTGATTGCAAAGGAGGAGTAGGG - Intergenic
1028120373 7:87050452-87050474 TGGAAGGCAAAGGGGGAGCAGGG - Intronic
1028632320 7:92948383-92948405 TTGAATGCAAAGAGTTAGCATGG + Intergenic
1030076264 7:105739555-105739577 TGGAGTGAAAAGATGGAGGAGGG + Intronic
1030611365 7:111693142-111693164 TGGAAGGCAAAGAGGAAGCAAGG + Intergenic
1031511826 7:122659917-122659939 TTAAATGCAAAGAAGAAACAAGG + Intronic
1032704904 7:134413317-134413339 TTGAACGGAAAGGTGGAGGAGGG - Intergenic
1032896887 7:136261354-136261376 CTGAATGCAAAGATGGAACGAGG - Intergenic
1033813569 7:145046173-145046195 GAGAATGCACAGCTGGAGCATGG + Intergenic
1034276801 7:149827402-149827424 GTGAATGCAGACATGCAGCATGG + Intergenic
1034718802 7:153268437-153268459 CTGAATGTAAAGCTGTAGCATGG + Intergenic
1034910549 7:154994521-154994543 TTTTATGCAGAGATGGTGCAAGG + Intronic
1036488527 8:9201962-9201984 CTGAATGAAGAGCTGGAGCAAGG - Intergenic
1036985281 8:13522003-13522025 TTGAAAGGAAAGACGGAGAAGGG + Intergenic
1037676210 8:21052821-21052843 TGGAAGGCAAAGGGGGAGCAAGG + Intergenic
1038360771 8:26873787-26873809 TTGAAAGCAAATAAGAAGCAAGG + Intergenic
1039739453 8:40368673-40368695 TGGAAGGCAAAGGGGGAGCAGGG - Intergenic
1040060593 8:43100129-43100151 ATGAGTGCAAATAGGGAGCAGGG + Intronic
1041307161 8:56473235-56473257 TTGGATGCACAGATGGAGGCCGG + Intergenic
1041546199 8:59046133-59046155 TTGAATGAAAACATGCAACATGG - Intronic
1044598965 8:93984763-93984785 TTGCTTGTAAAGCTGGAGCAGGG + Intergenic
1046078138 8:109336677-109336699 TTAAATGCTATGATGGAACAAGG - Intronic
1046100237 8:109605467-109605489 TTGAATGAAAAAAAGGAGCAGGG - Intronic
1047415150 8:124658618-124658640 CAGAATGCAAAGAGGGAGCTAGG + Intronic
1047503461 8:125460357-125460379 TTGAGTGCAAAGATGCACAAAGG + Intergenic
1047756432 8:127922567-127922589 ATGAATGCAAGGATGGAGGTAGG - Intergenic
1049084872 8:140470802-140470824 CTGATGGCAAAGCTGGAGCAGGG - Intergenic
1049478576 8:142808206-142808228 GTGAAAGCAAAGAAGGGGCAGGG + Intergenic
1050623618 9:7480256-7480278 TTGAAAGCCAAAATGGGGCAGGG + Intergenic
1050929661 9:11307575-11307597 CTGAATGCTAAGATGAAGCTGGG - Intergenic
1050959651 9:11712230-11712252 ACGAGTGCAAAGATAGAGCAGGG - Intergenic
1051430091 9:16972811-16972833 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1052093847 9:24361456-24361478 TTTGTTACAAAGATGGAGCAAGG + Intergenic
1052528803 9:29655897-29655919 CTGAATGCAAAGATGGAACAAGG - Intergenic
1053165311 9:35840305-35840327 TTGAAGGCAGAGTTGGGGCAGGG + Intronic
1055064396 9:72104054-72104076 TGCAAGGCAAAGAGGGAGCAAGG - Intergenic
1055690562 9:78826068-78826090 TGGAATTCAAAAAGGGAGCAAGG + Intergenic
1055780161 9:79812124-79812146 TTGAATTCAAATAGGGAGTATGG - Intergenic
1057362074 9:94382505-94382527 GAGAATGAAAAGATGGACCACGG - Intronic
1057661281 9:97005658-97005680 GAGAATGAAAAGATGGACCACGG + Intronic
1058116795 9:101093582-101093604 TTGAATGCAAAATTGGTCCATGG - Intronic
1058627905 9:106954255-106954277 TGGAAGGCAAAGGGGGAGCAAGG + Intronic
1060624513 9:125098617-125098639 AAGAATGCTAAGATGGGGCATGG + Intronic
1060834562 9:126745355-126745377 ATTAATACAGAGATGGAGCAAGG + Intergenic
1062353304 9:136149582-136149604 TTTAAATCAAAGATGGAGGAGGG + Intergenic
1186022405 X:5271065-5271087 GTCAATGGAAGGATGGAGCATGG + Intergenic
1186235246 X:7500998-7501020 ATGATGGCAAAGATGGAACAAGG + Intergenic
1186821030 X:13288176-13288198 TTGAGTGCAAAGCTTGAGGATGG - Intergenic
1187082267 X:16003249-16003271 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1187323995 X:18269409-18269431 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
1188018897 X:25135413-25135435 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1189017220 X:37296809-37296831 CAGAAGGCAAAGAGGGAGCAAGG + Intergenic
1189027077 X:37406931-37406953 TTGAGTGCAAAGGTTGAGGACGG + Intronic
1190551184 X:51582704-51582726 TTGACTGCAATGATGGGGGAGGG - Intergenic
1190722287 X:53159678-53159700 CTGAGTGCAAAGATGGAGAGAGG - Intergenic
1191749053 X:64521194-64521216 TGGAAGGCAAAGAAGAAGCAAGG - Intergenic
1192295455 X:69842865-69842887 CAGAAGGCAAAGGTGGAGCAGGG - Intronic
1194786486 X:98090876-98090898 GTGAAAGCAAAGATGGAGAAGGG + Intergenic
1194839095 X:98716152-98716174 CAGAAGGCAAAGGTGGAGCAAGG - Intergenic
1197074918 X:122342610-122342632 TAGAATGCAAAGGGGGAGCAAGG + Intergenic
1197828047 X:130611976-130611998 TAGAATGCCAAGAAGCAGCATGG - Intergenic
1197835154 X:130686385-130686407 CAGAAGGCAAAGATGGAGCGAGG - Intronic
1198370010 X:135981231-135981253 TGGAAGGCAAAGAGGAAGCAAGG + Intergenic
1198551634 X:137751534-137751556 GGAAAGGCAAAGATGGAGCAGGG - Intergenic
1201646829 Y:16242749-16242771 GTCAATGGAAAGATGGAGCATGG - Intergenic
1201655982 Y:16342553-16342575 GTCAATGGAAAGATGGAGCATGG + Intergenic