ID: 1167947121

View in Genome Browser
Species Human (GRCh38)
Location 19:52997217-52997239
Sequence AACTGCCTATTGCACACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167947121_1167947129 27 Left 1167947121 19:52997217-52997239 CCTCCAGTGTGCAATAGGCAGTT No data
Right 1167947129 19:52997267-52997289 ATTATCCGCTCAAACAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167947121 Original CRISPR AACTGCCTATTGCACACTGG AGG (reversed) Intergenic
No off target data available for this crispr