ID: 1167950988

View in Genome Browser
Species Human (GRCh38)
Location 19:53027640-53027662
Sequence CTGTAATCACAGCTATTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167950988_1167950997 27 Left 1167950988 19:53027640-53027662 CCTCCCAATAGCTGTGATTACAG No data
Right 1167950997 19:53027690-53027712 TTGTATTTTTAGTAGACACAGGG 0: 1012
1: 67896
2: 164537
3: 185964
4: 112355
1167950988_1167950992 -3 Left 1167950988 19:53027640-53027662 CCTCCCAATAGCTGTGATTACAG No data
Right 1167950992 19:53027660-53027682 CAGGCATGTGCCACCACGCCTGG 0: 3509
1: 22956
2: 74163
3: 166015
4: 226688
1167950988_1167950996 26 Left 1167950988 19:53027640-53027662 CCTCCCAATAGCTGTGATTACAG No data
Right 1167950996 19:53027689-53027711 TTTGTATTTTTAGTAGACACAGG 0: 2373
1: 174005
2: 211917
3: 121686
4: 64546

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167950988 Original CRISPR CTGTAATCACAGCTATTGGG AGG (reversed) Intergenic
No off target data available for this crispr