ID: 1167951576

View in Genome Browser
Species Human (GRCh38)
Location 19:53031895-53031917
Sequence AGTTATCTGCAGAGGATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167951576_1167951580 15 Left 1167951576 19:53031895-53031917 CCTACCATCCTCTGCAGATAACT No data
Right 1167951580 19:53031933-53031955 GACAGCTCCCAGCCTGTTGCTGG No data
1167951576_1167951581 16 Left 1167951576 19:53031895-53031917 CCTACCATCCTCTGCAGATAACT No data
Right 1167951581 19:53031934-53031956 ACAGCTCCCAGCCTGTTGCTGGG No data
1167951576_1167951583 22 Left 1167951576 19:53031895-53031917 CCTACCATCCTCTGCAGATAACT No data
Right 1167951583 19:53031940-53031962 CCCAGCCTGTTGCTGGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167951576 Original CRISPR AGTTATCTGCAGAGGATGGT AGG (reversed) Intergenic
No off target data available for this crispr