ID: 1167951578

View in Genome Browser
Species Human (GRCh38)
Location 19:53031903-53031925
Sequence AGGTGAGTAGTTATCTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167951578_1167951580 7 Left 1167951578 19:53031903-53031925 CCTCTGCAGATAACTACTCACCT No data
Right 1167951580 19:53031933-53031955 GACAGCTCCCAGCCTGTTGCTGG No data
1167951578_1167951583 14 Left 1167951578 19:53031903-53031925 CCTCTGCAGATAACTACTCACCT No data
Right 1167951583 19:53031940-53031962 CCCAGCCTGTTGCTGGGCCTTGG No data
1167951578_1167951581 8 Left 1167951578 19:53031903-53031925 CCTCTGCAGATAACTACTCACCT No data
Right 1167951581 19:53031934-53031956 ACAGCTCCCAGCCTGTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167951578 Original CRISPR AGGTGAGTAGTTATCTGCAG AGG (reversed) Intergenic
No off target data available for this crispr