ID: 1167951581

View in Genome Browser
Species Human (GRCh38)
Location 19:53031934-53031956
Sequence ACAGCTCCCAGCCTGTTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167951578_1167951581 8 Left 1167951578 19:53031903-53031925 CCTCTGCAGATAACTACTCACCT No data
Right 1167951581 19:53031934-53031956 ACAGCTCCCAGCCTGTTGCTGGG No data
1167951577_1167951581 12 Left 1167951577 19:53031899-53031921 CCATCCTCTGCAGATAACTACTC 0: 7
1: 198
2: 208
3: 121
4: 258
Right 1167951581 19:53031934-53031956 ACAGCTCCCAGCCTGTTGCTGGG No data
1167951576_1167951581 16 Left 1167951576 19:53031895-53031917 CCTACCATCCTCTGCAGATAACT No data
Right 1167951581 19:53031934-53031956 ACAGCTCCCAGCCTGTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167951581 Original CRISPR ACAGCTCCCAGCCTGTTGCT GGG Intergenic
No off target data available for this crispr