ID: 1167951583

View in Genome Browser
Species Human (GRCh38)
Location 19:53031940-53031962
Sequence CCCAGCCTGTTGCTGGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167951579_1167951583 -6 Left 1167951579 19:53031923-53031945 CCTTTTGAAAGACAGCTCCCAGC No data
Right 1167951583 19:53031940-53031962 CCCAGCCTGTTGCTGGGCCTTGG No data
1167951577_1167951583 18 Left 1167951577 19:53031899-53031921 CCATCCTCTGCAGATAACTACTC 0: 7
1: 198
2: 208
3: 121
4: 258
Right 1167951583 19:53031940-53031962 CCCAGCCTGTTGCTGGGCCTTGG No data
1167951576_1167951583 22 Left 1167951576 19:53031895-53031917 CCTACCATCCTCTGCAGATAACT No data
Right 1167951583 19:53031940-53031962 CCCAGCCTGTTGCTGGGCCTTGG No data
1167951578_1167951583 14 Left 1167951578 19:53031903-53031925 CCTCTGCAGATAACTACTCACCT No data
Right 1167951583 19:53031940-53031962 CCCAGCCTGTTGCTGGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167951583 Original CRISPR CCCAGCCTGTTGCTGGGCCT TGG Intergenic
No off target data available for this crispr