ID: 1167952375

View in Genome Browser
Species Human (GRCh38)
Location 19:53037715-53037737
Sequence TGTGACTTACTAGCAGTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 102}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167952368_1167952375 17 Left 1167952368 19:53037675-53037697 CCCAAATCACTGAAACGACCCCA No data
Right 1167952375 19:53037715-53037737 TGTGACTTACTAGCAGTGAGGGG 0: 1
1: 0
2: 1
3: 5
4: 102
1167952369_1167952375 16 Left 1167952369 19:53037676-53037698 CCAAATCACTGAAACGACCCCAA No data
Right 1167952375 19:53037715-53037737 TGTGACTTACTAGCAGTGAGGGG 0: 1
1: 0
2: 1
3: 5
4: 102
1167952367_1167952375 18 Left 1167952367 19:53037674-53037696 CCCCAAATCACTGAAACGACCCC No data
Right 1167952375 19:53037715-53037737 TGTGACTTACTAGCAGTGAGGGG 0: 1
1: 0
2: 1
3: 5
4: 102
1167952372_1167952375 -3 Left 1167952372 19:53037695-53037717 CCAAGAGTCTCATAGCGATGTGT No data
Right 1167952375 19:53037715-53037737 TGTGACTTACTAGCAGTGAGGGG 0: 1
1: 0
2: 1
3: 5
4: 102
1167952371_1167952375 -2 Left 1167952371 19:53037694-53037716 CCCAAGAGTCTCATAGCGATGTG No data
Right 1167952375 19:53037715-53037737 TGTGACTTACTAGCAGTGAGGGG 0: 1
1: 0
2: 1
3: 5
4: 102
1167952370_1167952375 -1 Left 1167952370 19:53037693-53037715 CCCCAAGAGTCTCATAGCGATGT No data
Right 1167952375 19:53037715-53037737 TGTGACTTACTAGCAGTGAGGGG 0: 1
1: 0
2: 1
3: 5
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167952375 Original CRISPR TGTGACTTACTAGCAGTGAG GGG Intergenic
903308125 1:22429002-22429024 TTAGACTTACTAGCAGTCCGGGG - Intergenic
913173993 1:116257223-116257245 TGTGACTTGGTTGCAGTGACGGG - Intergenic
913255948 1:116953773-116953795 AGTGAATTACTAGCTTTGAGAGG - Intronic
915305573 1:154975594-154975616 TGCGGCTTCCTAGCTGTGAGCGG + Intronic
920252609 1:204631793-204631815 AGTGAGTTCCAAGCAGTGAGTGG + Intronic
1067340317 10:45396030-45396052 GGTGACTTTCCAGCAGTGACAGG - Intronic
1070846359 10:79525218-79525240 TGTGACTCAGGAGCTGTGAGTGG + Intergenic
1074430865 10:113393395-113393417 TGAGATTTACAAGAAGTGAGTGG + Intergenic
1074490580 10:113935897-113935919 TTTGACTTACTAGCTGTGTAGGG + Intergenic
1078443005 11:11383112-11383134 TGTGACCTCCCAGGAGTGAGTGG - Intronic
1081537243 11:44004911-44004933 TGCAACTTCCTAGCAGGGAGAGG + Intergenic
1082059236 11:47846474-47846496 TGTGACTAACCAGATGTGAGTGG - Intronic
1084501755 11:69539380-69539402 TCTGACTAACTGGCTGTGAGTGG - Intergenic
1085442440 11:76577148-76577170 TGTCACTTATTAGCTGTGACTGG - Intergenic
1088864659 11:113836267-113836289 TGTTACTTACTAGATGTGAATGG - Intronic
1092138827 12:6168585-6168607 TGTGACTGACAAGCAATTAGAGG - Intergenic
1093854810 12:24088590-24088612 TGTGACTTACTAGATGCGAAAGG + Intergenic
1097763985 12:63501689-63501711 TGTCACTTACTAGTTGTGAGAGG + Intergenic
1098950661 12:76637383-76637405 CATCACTCACTAGCAGTGAGGGG + Intergenic
1101537024 12:105627805-105627827 TGTGACTAAATTCCAGTGAGAGG + Intergenic
1106883515 13:34157691-34157713 TGGGACCTACTAGCTCTGAGAGG - Intergenic
1107919702 13:45191743-45191765 TGTGATTTATTAGAAGTGTGAGG + Intronic
1110694362 13:78470943-78470965 TGTTAGTGACTAGCAGAGAGAGG + Intergenic
1114348338 14:21821478-21821500 TTTTACTTATTAGGAGTGAGTGG + Intergenic
1116905744 14:50401838-50401860 TGTAACATTCTAGCAGTGATTGG - Intronic
1122106497 14:99460848-99460870 TGTAACTTACTGGAGGTGAGTGG - Intronic
1122389389 14:101369932-101369954 TGGGACTTACTAGCGGGCAGAGG - Intergenic
1125592707 15:40864696-40864718 CCTGACTTCTTAGCAGTGAGGGG - Intergenic
1128324437 15:66714799-66714821 AGGGACTTACTAGCTGTGAAAGG + Intronic
1128773489 15:70301445-70301467 AGTGGCTTCCTAGCTGTGAGAGG - Intergenic
1130215287 15:81962790-81962812 TGTGAATTTCCACCAGTGAGGGG + Intergenic
1131741991 15:95402936-95402958 TGTGAATTTCTAGAAGTGATTGG + Intergenic
1132079847 15:98854623-98854645 CGTGACTTACTGGCACTTAGAGG - Intronic
1136485620 16:30570143-30570165 TGTGGCTGACCAGCAGTGAGGGG + Exonic
1137396264 16:48117849-48117871 TCCAACCTACTAGCAGTGAGGGG - Intronic
1138385007 16:56630403-56630425 TGTGACTTAGTGGCATAGAGTGG + Intergenic
1140799204 16:78469788-78469810 TGTGGCTGGCTAGCACTGAGAGG - Intronic
1142511312 17:395304-395326 GGTGACTGACTAGCATTGTGAGG + Intergenic
1142511323 17:395411-395433 GGTGACTGACTAGCATTGTGAGG + Intergenic
1142569340 17:862636-862658 TGTAACTAACGAGCAGTAAGTGG - Intronic
1143953525 17:10652146-10652168 TGTGACTTACCAACTGTGGGAGG - Intronic
1145845457 17:28034647-28034669 TGGGGCTTGCTAGCAGTAAGTGG - Intergenic
1148289755 17:46434543-46434565 TGCGACTTACTGGAAGTGGGAGG - Intergenic
1148311923 17:46652115-46652137 TGCGACTTACTGGAAGTGGGAGG - Intronic
1148806093 17:50264706-50264728 TGTGACTGACTCAGAGTGAGAGG - Intergenic
1153449066 18:5206305-5206327 TATGACATACAAGCAGGGAGTGG - Intergenic
1157657233 18:49402559-49402581 TGTGATTTAGTAACAGTTAGTGG - Intronic
1161604858 19:5209061-5209083 AGTGAGTTACCAGCAGTGGGTGG - Intronic
1165858623 19:38894945-38894967 TGGGACATAGTAGGAGTGAGAGG - Intronic
1166829959 19:45633256-45633278 AGTGCATTAATAGCAGTGAGCGG + Intronic
1166964523 19:46520577-46520599 AATGACTTACTAGCATTCAGAGG + Intronic
1167006824 19:46781693-46781715 TGTGACTTACAAGAAGGGACTGG - Intronic
1167952375 19:53037715-53037737 TGTGACTTACTAGCAGTGAGGGG + Intergenic
926265582 2:11316777-11316799 AATGACTTATTAGCAGTCAGAGG - Intronic
926369729 2:12167800-12167822 TGTGACTGGCCAGGAGTGAGTGG + Intergenic
926829514 2:16945871-16945893 TGTGAATTACTAGAAGTACGTGG - Intergenic
927798981 2:26079537-26079559 TATGACTTCCCAGCAGAGAGAGG - Intronic
932948729 2:76268234-76268256 TATGACTTACTAGAAGTCATGGG + Intergenic
934166536 2:89299136-89299158 TTTTACTTTTTAGCAGTGAGTGG + Intergenic
934200741 2:89883320-89883342 TTTTACTTTTTAGCAGTGAGTGG - Intergenic
936956007 2:118022894-118022916 TTTGACTTCCTAGCATCGAGAGG - Intergenic
940388114 2:153097892-153097914 TTTGAATTTCTAGCAGAGAGGGG - Intergenic
942333483 2:174853929-174853951 TGTGAGCTACTAGAAGGGAGAGG + Intronic
942775694 2:179579915-179579937 TGTCACTTATTAACAGTAAGTGG - Intronic
943404850 2:187468754-187468776 TGGGAATTACTGTCAGTGAGGGG + Intronic
944411813 2:199452628-199452650 AGTGAATTACTAGCTGAGAGGGG + Intronic
945367576 2:208974874-208974896 TGTGACTGGCTATCAGTGACAGG - Intergenic
1171933506 20:31250108-31250130 TTTGGCTTCCTAGCATTGAGAGG + Intergenic
1174130279 20:48339719-48339741 TGTGACTGAGGAGCAATGAGTGG - Intergenic
1179839871 21:44065081-44065103 TTTGTCTTACTAGCCGGGAGGGG + Intronic
1184088467 22:42280013-42280035 GGTGAGTTACTAGCAGGGACAGG + Intronic
951578279 3:24135426-24135448 TGTGTGTTGCTGGCAGTGAGTGG + Intronic
954397188 3:50299010-50299032 TGTGACCCACTAGGAGGGAGGGG - Intronic
962280723 3:134049786-134049808 TGTGAGTCACTAGCAGTAGGTGG - Intronic
963166469 3:142209361-142209383 TGTGGCTGAAAAGCAGTGAGGGG + Intronic
964101962 3:152997606-152997628 TGTGACTGACTTCCAGAGAGGGG - Intergenic
964738269 3:159939060-159939082 TGTTACTAACAAGCAGTGAAAGG - Intergenic
968159996 3:196418626-196418648 TGTGACTGAGAAGCACTGAGAGG + Intronic
968277876 3:197454795-197454817 TGTGACTTTCTTGCTGGGAGAGG - Intergenic
972403526 4:38726282-38726304 TGTGACTAAACTGCAGTGAGTGG - Intergenic
976480102 4:85532782-85532804 TGTGACTTCCTAGCAGTGACAGG - Intronic
986275146 5:6267944-6267966 TGTGATTTGCTAGGAGTGAGTGG + Intergenic
994566293 5:101449898-101449920 TGTGACTTACTTGAGGTTAGAGG + Intergenic
998188166 5:139998994-139999016 TGTGACTTTCAAGCAGGAAGTGG - Intronic
1003029893 6:2592856-2592878 TGTGACTTAACCCCAGTGAGTGG - Intergenic
1010259698 6:73801141-73801163 TGTGATTTACTAGGAGACAGTGG + Intronic
1015535080 6:134259299-134259321 TATGACTTAGAAGCAGAGAGAGG - Intronic
1022787436 7:33652473-33652495 TGTGAATTCCTTTCAGTGAGTGG + Intergenic
1023621487 7:42077681-42077703 TGTGAGTTACTAGGAGTAAGTGG - Intronic
1026459545 7:70601591-70601613 TGTGACTTGCTAGGATAGAGTGG + Intronic
1033010237 7:137614134-137614156 TGTGACTTCATAGTACTGAGTGG - Intronic
1034814816 7:154162933-154162955 TATGCCTTGCTAGCATTGAGTGG + Intronic
1040598262 8:48860839-48860861 TGTGGCTTGATAGCAGTGAGTGG + Intergenic
1040992041 8:53362885-53362907 TGTCTCTAACTAGCAGTGGGAGG + Intergenic
1042032376 8:64490361-64490383 TGCCACTTACTAGAAGTCAGCGG + Intergenic
1045332372 8:101166466-101166488 TGTGGCTTACAAGCCCTGAGAGG + Intergenic
1047190544 8:122675170-122675192 TTGGACTTCCTTGCAGTGAGGGG - Intergenic
1047705104 8:127490936-127490958 TCTTTCTTACTATCAGTGAGAGG - Intergenic
1049939646 9:533101-533123 TGTGACTTATTGCCAGTCAGAGG + Intronic
1050023172 9:1305993-1306015 TGTGAATTACTATCTGTGGGAGG + Intergenic
1055668280 9:78573865-78573887 TGGGGCTTTCAAGCAGTGAGAGG - Intergenic
1056715082 9:89021950-89021972 TGTGACTTACAAGTTCTGAGTGG - Intronic
1057832456 9:98417761-98417783 TGTGAGTTGCTAGGAGAGAGTGG + Intronic
1058168572 9:101650329-101650351 TGTGACTTGCTAGTAGTCACTGG + Intronic
1058979643 9:110157268-110157290 TGTGACTTAAGTGCAGTCAGGGG - Intronic
1059680342 9:116579795-116579817 TGTGACTTAGGGCCAGTGAGGGG - Intronic
1061363889 9:130160508-130160530 TGAGACTTACTACCAGTATGAGG + Intergenic
1200117630 X:153776287-153776309 TGTGTCTTACTATGAGTGTGGGG + Intronic
1201981797 Y:19916989-19917011 TGTGCCTTACAAGCAGTAGGAGG - Intergenic