ID: 1167956211

View in Genome Browser
Species Human (GRCh38)
Location 19:53066238-53066260
Sequence TACTATGTATTTTCACTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167956208_1167956211 11 Left 1167956208 19:53066204-53066226 CCGTGCCTGGCCTGATTTATATT No data
Right 1167956211 19:53066238-53066260 TACTATGTATTTTCACTTCATGG No data
1167956209_1167956211 6 Left 1167956209 19:53066209-53066231 CCTGGCCTGATTTATATTTCTCG No data
Right 1167956211 19:53066238-53066260 TACTATGTATTTTCACTTCATGG No data
1167956210_1167956211 1 Left 1167956210 19:53066214-53066236 CCTGATTTATATTTCTCGCATTC No data
Right 1167956211 19:53066238-53066260 TACTATGTATTTTCACTTCATGG No data
1167956207_1167956211 14 Left 1167956207 19:53066201-53066223 CCACCGTGCCTGGCCTGATTTAT No data
Right 1167956211 19:53066238-53066260 TACTATGTATTTTCACTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167956211 Original CRISPR TACTATGTATTTTCACTTCA TGG Intergenic
No off target data available for this crispr