ID: 1167956549

View in Genome Browser
Species Human (GRCh38)
Location 19:53069944-53069966
Sequence CCTGAACTGCAGCTATTTCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167956549 Original CRISPR CCTGAACTGCAGCTATTTCA AGG (reversed) Exonic
905852057 1:41281841-41281863 CCTGCATTGCAGCTAGTTCAGGG + Intergenic
906296019 1:44649719-44649741 CTTGAACGGCAGCTATCTCGTGG + Exonic
908587150 1:65582323-65582345 CCAGGACTGCAGTCATTTCAAGG + Intronic
909752764 1:79184038-79184060 CCTGAACTGCCATTCTTTCATGG - Intergenic
912975151 1:114323024-114323046 CCTGGATTGCAGCAATTTCTGGG - Intergenic
913450837 1:118991558-118991580 CCTGAAATGGAGTCATTTCAGGG - Intergenic
915770134 1:158412699-158412721 CCTGAACTGCTGCTATTCTTAGG + Intergenic
916530242 1:165649787-165649809 CCAGCACTGTGGCTATTTCATGG - Intronic
917747905 1:178028331-178028353 ACTGAACTGCAACTATTTCAGGG - Intergenic
919119813 1:193325263-193325285 ACTGACCTGGAACTATTTCATGG + Intergenic
920057078 1:203200606-203200628 CCAGTTCTGCAGCTATTTTAGGG + Intergenic
920834931 1:209502023-209502045 CCTGAATTGCAGCTATACCCTGG - Intergenic
921897785 1:220418766-220418788 ACTGAATTGCTGCAATTTCATGG + Intergenic
922537576 1:226392531-226392553 CCTGATATGCTGCTCTTTCAAGG - Intronic
924931715 1:248738278-248738300 CCAGAACTGCCGCTGTTTGAAGG + Intronic
1066305803 10:34139547-34139569 TCCAAACTTCAGCTATTTCATGG + Intronic
1067699842 10:48562761-48562783 AATGAACTGCACATATTTCATGG - Intronic
1067728016 10:48787714-48787736 CCTGGAGTGCATCTATTTCATGG + Intronic
1067925074 10:50500317-50500339 ACAGAACAGCAGCTATTTGATGG - Intronic
1068733538 10:60386761-60386783 CCTGAACTGCAGGAGTGTCATGG + Intronic
1068809915 10:61243759-61243781 CCAGAACTGCATTTATTACATGG + Intergenic
1069075978 10:64038870-64038892 CCTGAACTTAAGCCATTTGATGG - Intergenic
1070513287 10:77180222-77180244 CCTGAAATGCCCCTATTTAATGG + Intronic
1075171784 10:120122170-120122192 CCAGAACTGAAGCCATCTCAAGG - Intergenic
1076583684 10:131531649-131531671 CCTGAACAGCAGCTATGGAAAGG - Intergenic
1081353086 11:42079534-42079556 CCTGACCTGCATGTATTTCAGGG + Intergenic
1084380450 11:68808667-68808689 CCAGAAATGCAGCTATTTTGTGG + Intronic
1084633386 11:70372283-70372305 CCAGTACCGCAGCTACTTCATGG + Exonic
1084664244 11:70567865-70567887 CCAGCCCTGCAGCTATTCCAGGG - Intronic
1086161691 11:83728778-83728800 CAGGAACTGAACCTATTTCAAGG - Intronic
1090260711 11:125317128-125317150 ACTGAACTGCTGCAATCTCATGG - Intronic
1091131125 11:133148076-133148098 CCTGAAAGGCAGCTATTTGGGGG - Intronic
1092672258 12:10877151-10877173 TCTGAATAGGAGCTATTTCAAGG - Intronic
1092985250 12:13838782-13838804 CCTGAAATACAGATATTTCTTGG - Intronic
1097034024 12:56110405-56110427 CCTCAAATTCAGCTTTTTCATGG - Exonic
1098068168 12:66642352-66642374 CCTGAACTGCTGCTAGCCCATGG - Intronic
1098513428 12:71345989-71346011 CCTGAATTGCAGCTGTCTCTGGG - Intronic
1100169355 12:91956380-91956402 ACTGAATTGCTGCAATTTCATGG + Intergenic
1102135162 12:110568111-110568133 CCAAAACTACAGCTGTTTCATGG - Intronic
1102804655 12:115769143-115769165 TCTGAACTACAGCTAGTCCATGG - Intergenic
1103346204 12:120251968-120251990 CAGGAAATGCACCTATTTCATGG + Intronic
1106529419 13:30575790-30575812 CCTGTAGTCCAGCTATTCCAGGG + Intronic
1109130910 13:58584462-58584484 CCTACACTGCAGGTATTGCATGG - Intergenic
1113119523 13:106911464-106911486 CCTGCACTTCACCTACTTCAGGG + Intergenic
1115348119 14:32364662-32364684 ACTGAAGTGTAGATATTTCAAGG + Intronic
1118897619 14:69959045-69959067 ACTTAACTGTTGCTATTTCAGGG - Intronic
1121883794 14:97524391-97524413 CTTGAACTGCAGCTCTTCCTCGG - Intergenic
1122651247 14:103228354-103228376 CCTGAAGTGCAGCCTTTGCAGGG + Intergenic
1122816761 14:104317881-104317903 GCTGAACTGCAGGGATTTCAGGG + Intergenic
1131863690 15:96682729-96682751 CCAGAATTGCAGTTATCTCAAGG - Intergenic
1132027336 15:98414691-98414713 CCTCCACTGCACTTATTTCAAGG + Intergenic
1134182030 16:12055619-12055641 CCTGAACTGCAACTCTTCCCTGG - Intronic
1134255002 16:12603347-12603369 TCTCAACTGCAGCTGTCTCAAGG + Intergenic
1139081980 16:63533229-63533251 ACTGAATTGGTGCTATTTCATGG - Intergenic
1140834275 16:78778978-78779000 TCTGATCTCCATCTATTTCAGGG + Intronic
1147352659 17:39863808-39863830 CCAGATTTGCAGCCATTTCAGGG + Intronic
1147995664 17:44359016-44359038 CCTGCTCTGGAACTATTTCAGGG + Intronic
1157168717 18:45382649-45382671 CCTAAGATACAGCTATTTCAGGG - Intronic
1159469967 18:68839720-68839742 CCTGCACTGGGGCTATTTAAGGG + Intronic
1162152035 19:8653374-8653396 CCTGGCCTGCATTTATTTCATGG + Intergenic
1163111765 19:15165616-15165638 CCTGAACCTCACCAATTTCAGGG - Intronic
1163527939 19:17832619-17832641 GCTGTGCTGCAGCTGTTTCACGG + Exonic
1163817553 19:19476005-19476027 CCTGAACTTCAGCTTCTCCAAGG + Intronic
1164613193 19:29647405-29647427 ACTGAACAGCAGCTTCTTCAAGG - Intergenic
1165603480 19:37078549-37078571 CCTGAACTGCACCTCTGTCAAGG + Exonic
1166173328 19:41047819-41047841 CCTGTACCCCAGCTACTTCAGGG + Intergenic
1166780800 19:45341689-45341711 CCAGAAGTGGAGCTGTTTCATGG + Intronic
1167861790 19:52290146-52290168 CCAGAACTGGAGATATTTCAAGG + Exonic
1167956549 19:53069944-53069966 CCTGAACTGCAGCTATTTCAAGG - Exonic
926333061 2:11841171-11841193 CCTCAACTTCTACTATTTCATGG - Intergenic
926724437 2:15986528-15986550 TCTGTACTGCAGCTGTTTCCTGG + Intergenic
926994677 2:18721666-18721688 CCTGAACAGCATCATTTTCAGGG + Intergenic
927841084 2:26444638-26444660 CCTGCCCTGCTGCTATTTGAGGG + Intronic
931905620 2:66839892-66839914 CCTGAACTCCAGCTTTGTCTGGG - Intergenic
932049402 2:68383799-68383821 CCTGACCTGGACCAATTTCATGG - Intronic
934917203 2:98309882-98309904 GCTGAACTGCACGTTTTTCAGGG - Intronic
935309442 2:101769121-101769143 AGTGAACTGCAGTTATTTCCAGG - Intronic
937678636 2:124619722-124619744 CTGGAACTGCAGCTACTTCCTGG + Intronic
937742207 2:125368585-125368607 CATGCACTGCTTCTATTTCATGG + Intergenic
939475169 2:142677477-142677499 CCAGAACTGAAACTATTTTATGG - Intergenic
941460305 2:165763026-165763048 CCTGAACTCAAGCTATTTGCAGG + Intronic
946596472 2:221310882-221310904 TCTCAAGTGCAGCTGTTTCATGG - Intergenic
948686668 2:239674672-239674694 ACTGATCTGAAGCTACTTCAGGG + Intergenic
1170072136 20:12380696-12380718 CCTCAAATTCAGCTTTTTCATGG - Intergenic
1172852720 20:37978173-37978195 CCTGAACTGCAGCAATCTCGGGG - Intergenic
1174928948 20:54792731-54792753 CCTTATCTGCATCTCTTTCAGGG + Intergenic
1182703701 22:32261233-32261255 CCTGAACTGCAGCCAGCTCTTGG - Intergenic
949847380 3:8385554-8385576 ACTGAACTGCAACTCTTTCCTGG + Intergenic
950189873 3:10969359-10969381 CCTGGGATGCAGCTATCTCAGGG - Intergenic
951522511 3:23622388-23622410 CTAGAACTGCAGTTATTTGAAGG - Intergenic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
952969641 3:38642848-38642870 CCTGAAGTCCAGCTATCTCTGGG + Intronic
953711685 3:45276650-45276672 CTTCATCTCCAGCTATTTCAGGG - Intergenic
954913438 3:54128641-54128663 CATGAGCAGCAGCTACTTCAGGG + Intronic
955039146 3:55298061-55298083 CCTGAACTGCACCTCCATCATGG + Intergenic
955750934 3:62184924-62184946 CTTGAACTGCAGATAGTTTAAGG + Intronic
955790931 3:62588067-62588089 GCTGGAGTGCAGCTACTTCAGGG - Intronic
956257691 3:67301945-67301967 CATGCACTGCAACAATTTCATGG + Intergenic
957469019 3:80634269-80634291 ACTGAATTGCTGCTATCTCATGG - Intergenic
958189472 3:90166350-90166372 CTTGAACTGCAGTTCTTCCAAGG - Intergenic
958411785 3:93825954-93825976 CTTGAACTGCAGTTCTTCCAAGG - Intergenic
958506747 3:94988604-94988626 CTTGAACTGGTGCTATTCCATGG + Intergenic
962819695 3:139036599-139036621 TCTGAACTGCAGGTTTTTTATGG + Intronic
963873054 3:150440571-150440593 TTTGAACTGCAGATATTTCTTGG + Intronic
964689465 3:159434018-159434040 CTTGAACTGCAATTATTTTAAGG + Intronic
966222212 3:177562039-177562061 CCTGCCCTGCAGCTCTTTCAGGG - Intergenic
967588500 3:191243989-191244011 CCCAAACTGCAGCTGTCTCATGG - Intronic
970389869 4:15597793-15597815 ATTGAACTGCAGCTAGTTTATGG + Intronic
976205558 4:82620145-82620167 CCAGAACTGCCCCTCTTTCAGGG + Intergenic
979325870 4:119378868-119378890 CCTGAACAGCAGCTAAAGCAAGG - Intergenic
980014343 4:127631540-127631562 CCTGAATTGTAGCTGTTGCAGGG - Intronic
980571331 4:134624067-134624089 TCTGCATTGCTGCTATTTCAAGG + Intergenic
985509800 5:306630-306652 CGTGAACTTCAGCGAGTTCACGG + Exonic
991614149 5:68478614-68478636 CCTGAAATGTTTCTATTTCAGGG + Intergenic
993787509 5:92161439-92161461 ACTGAACTGCTGCAATCTCACGG + Intergenic
994064710 5:95525453-95525475 CATGAACTTCAGCTAGGTCAGGG + Exonic
995469461 5:112485163-112485185 CCTGAAGTCCAGCTATTTCCAGG - Intergenic
997580394 5:135013188-135013210 CCTGAACTGGAGCCATTGCCTGG - Intergenic
998142013 5:139705337-139705359 CCTCAACTGCAGACATCTCATGG + Intergenic
999722221 5:154406970-154406992 CCTGAACTGCTTCTACCTCAAGG - Intronic
1001435109 5:171693970-171693992 CCTGAACACCTGCTAGTTCAGGG - Intergenic
1001703180 5:173722078-173722100 TCTGAACTGCACCTACCTCAGGG + Intergenic
1002292570 5:178209829-178209851 CCTGAACTGCATCTTTTTAAAGG + Intronic
1002797665 6:487868-487890 CCTGACCTGGGGCCATTTCAGGG + Intronic
1003985649 6:11432007-11432029 TCTGAACAACAGCTCTTTCATGG + Intergenic
1004738088 6:18428367-18428389 CCATAACTGCAGCTAATCCATGG - Intronic
1005450971 6:25972083-25972105 CCTCACCTGCAGCAATTTCTGGG - Exonic
1008749742 6:54718010-54718032 CCTGTACTGCAGCTATGTATGGG - Intergenic
1009318504 6:62255486-62255508 CCTGCTCTGCAGCTAGTGCATGG - Intronic
1010069203 6:71723541-71723563 CCTCAGCTTCAGCTATTTTAGGG + Intergenic
1010853697 6:80811196-80811218 CCAGAACTGAAGCTATTTGGGGG - Intergenic
1011764339 6:90603977-90603999 CTAGAACTGGAGCTATTTCTGGG + Intergenic
1015031680 6:128602948-128602970 CTTGATCTGCAGTGATTTCATGG - Intergenic
1015226411 6:130862009-130862031 CCTTAACTGCTGCTGTTGCAAGG - Intronic
1016583274 6:145653681-145653703 CTTGAACTGCAGCTCTTCCCTGG - Intronic
1018274947 6:162120492-162120514 TCTGAACTGCAACCAATTCATGG + Intronic
1020202675 7:6092521-6092543 CCTGAACAGCATCCACTTCAGGG + Intergenic
1020600297 7:10267017-10267039 CCTGCACTGCAGCTTATTCTTGG - Intergenic
1020894874 7:13927710-13927732 ACTTAACTGCAGCAATTTCATGG + Intronic
1021537274 7:21720092-21720114 CCTGAACAGCATTTCTTTCAAGG + Intronic
1022066918 7:26867949-26867971 ACTGAACTGCTGCAATCTCATGG + Intronic
1022548798 7:31216364-31216386 ACTGAATTGCTGCAATTTCATGG - Intergenic
1024666101 7:51548719-51548741 CCTGACTTTCAGCTATTTCAGGG + Intergenic
1026471641 7:70698374-70698396 CCTGCAGTGCAGCTATTTGCTGG - Intronic
1026948059 7:74328594-74328616 CCTCATCTGCAGCCATCTCAAGG - Intronic
1027880679 7:83831274-83831296 CTTGAGCTGCAGTTATCTCAAGG - Intergenic
1029019887 7:97353549-97353571 CCTGACTTGCAGTTATTTAATGG + Intergenic
1029306973 7:99626705-99626727 CCTGACTTGCAGCTACTTCCAGG - Intronic
1029476671 7:100789154-100789176 CCTGACCTGCTGCCATTTCCTGG - Intronic
1031641581 7:124171423-124171445 CTTTAACTTCAGCTATTCCAAGG + Intergenic
1032298244 7:130662185-130662207 CCTGTAAGGCAGCTGTTTCAGGG - Intronic
1033488645 7:141817809-141817831 CCTTGACTGCAGCTGTTTGAGGG + Intergenic
1033709961 7:143932758-143932780 TCTGAAATGCAGGTATTTCTGGG + Intergenic
1037264392 8:17042072-17042094 CATGAAATGCAGTTTTTTCATGG + Intronic
1037470749 8:19207658-19207680 ACTGAATTGCAACTCTTTCATGG - Intergenic
1038082197 8:24151226-24151248 CCTGAACTTGATCTCTTTCATGG + Intergenic
1038435643 8:27534005-27534027 CATGAACAGCAGCTGTTTCTGGG + Intronic
1038669853 8:29573992-29574014 CCTGAACTGGAGGGATTTCATGG - Intergenic
1039421342 8:37444381-37444403 CCTGAACTGCACATATGTCAGGG + Intergenic
1039906801 8:41792278-41792300 CCTGGACTGCAGCCCTCTCAGGG - Intronic
1040771291 8:50979689-50979711 TCTGAAGTGCACCTATTACAGGG - Intergenic
1044355146 8:91213741-91213763 TCTGAATTCCACCTATTTCAAGG - Intronic
1044441164 8:92225865-92225887 CCTGAACTGCAACCTTTGCATGG - Intergenic
1047182176 8:122599475-122599497 CTTGAACTGCTGTTCTTTCATGG + Intergenic
1047214560 8:122865855-122865877 CCTGCCCTGCAGCTATGCCAGGG - Intronic
1048012103 8:130466143-130466165 CCAGAGCTGCAGTCATTTCAAGG - Intergenic
1048851268 8:138647270-138647292 CCTGAGCTGCAGTCATCTCAGGG - Intronic
1050087733 9:1983892-1983914 CGTATACTGCAGCTAATTCATGG + Intergenic
1050463394 9:5896016-5896038 CCTGAACTGAAGCTGTCACAAGG - Intronic
1050652975 9:7792949-7792971 ACTGAAGTGGAACTATTTCACGG + Intergenic
1053428567 9:38027054-38027076 CCTGAATTGCAGCTATGTGTAGG + Intronic
1053506756 9:38649849-38649871 CGGGAGCTGCAGCTATCTCAAGG + Intergenic
1055222406 9:73952613-73952635 CCTGAAGTGCTGGGATTTCAAGG - Intergenic
1055797442 9:79990187-79990209 TCTGAACTGCAGTTATTGCTAGG - Intergenic
1055817330 9:80221963-80221985 CCAGAACTGCAGCTTTTCCTTGG + Intergenic
1055913527 9:81376928-81376950 TCTGAACTGCAAGTATTTCTAGG + Intergenic
1056766952 9:89450194-89450216 CCTCAAATTCAGCTTTTTCATGG - Intronic
1060471596 9:123952540-123952562 CCTGCAGTGCAGCTCTTGCAGGG + Intergenic
1203426655 Un_GL000195v1:46758-46780 CCTGAACTCCAGATATGTGATGG - Intergenic
1187334968 X:18373960-18373982 CCGGAACTGCAGCTACTAGATGG + Intergenic
1189513266 X:41684909-41684931 ACTGTACTGCAGCTATGTAAAGG + Intronic
1194570864 X:95553222-95553244 CCTGAACTGCATCAGCTTCATGG - Intergenic
1196696259 X:118615690-118615712 CCTAAACTGCAGCGGGTTCAAGG + Exonic
1196747270 X:119082312-119082334 AGTCAACTGCTGCTATTTCATGG + Intronic
1197920464 X:131587873-131587895 CTTGGACTACAGCTATATCAGGG - Intergenic
1198741138 X:139844413-139844435 CCTGCATTGCAGGTATTGCAGGG - Intronic