ID: 1167958857

View in Genome Browser
Species Human (GRCh38)
Location 19:53090136-53090158
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 2, 1: 4, 2: 15, 3: 43, 4: 361}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167958857 Original CRISPR CTGGTGACAAGGAGAGCAGA GGG (reversed) Intronic
900423140 1:2564367-2564389 CAGGTGACAAGGAAAGGAGAGGG - Intronic
900597842 1:3490590-3490612 CTGGGGAAAAGGAGAAAAGAGGG + Intronic
900767773 1:4516784-4516806 CTGGGGACAAGGTGGGCAGAGGG + Intergenic
901800249 1:11704315-11704337 CCAGTCACAAGGAGAGCAGGGGG + Intronic
903098171 1:21000758-21000780 ATGGTCACTAGCAGAGCAGATGG + Intronic
903294460 1:22334925-22334947 CTTGTGACCAGGTGAGCACAGGG - Intergenic
903388147 1:22943198-22943220 CTGGTGACATGGGGATCATAGGG + Intergenic
904479107 1:30783048-30783070 CTGGCTCCAGGGAGAGCAGAGGG - Intergenic
904860696 1:33535765-33535787 CTGGTGCAAAGGAGTGCTGAGGG - Intronic
907718876 1:56953031-56953053 CTGGTGACAAACACAGCAGTGGG + Intronic
908386348 1:63645863-63645885 CTGGTGACTAGCATAGCACAAGG - Intronic
909149208 1:71979462-71979484 GTGGTGAGAAGGAAATCAGATGG + Intronic
909476835 1:76090447-76090469 CTTGTGGCAGGGAGAGCAGTAGG - Intronic
909988282 1:82189571-82189593 CTGGTGATGAGGAGGGAAGAGGG - Intergenic
910055118 1:83024482-83024504 CTGGTAACAAGTACAACAGAGGG + Intergenic
910105453 1:83626997-83627019 CTGAAGACAAGGAGGGCACAGGG + Intergenic
910159804 1:84260612-84260634 CTGGGGACAAGTAGAGGAGTGGG - Intergenic
910758088 1:90712112-90712134 GTGGGGAGATGGAGAGCAGAGGG + Exonic
912180044 1:107208591-107208613 CTGGGGACAGGGACAACAGATGG - Intronic
912373601 1:109192588-109192610 CTGGAGACAAGGAAACAAGAGGG - Intronic
912481299 1:109984169-109984191 GTGGAGACCAGGAGAGCTGATGG - Intergenic
912704666 1:111903178-111903200 CTGGTGACCATCAGACCAGAGGG + Intronic
913539209 1:119802922-119802944 CTGGTGAAATGGAGAGAAGAGGG - Intronic
913569745 1:120108778-120108800 CAGGTTACACAGAGAGCAGATGG - Intergenic
914290555 1:146269740-146269762 CAGGTTACACAGAGAGCAGATGG - Intergenic
914342981 1:146776145-146776167 CAGGAGCCAAGGAGTGCAGAAGG - Intergenic
914551599 1:148720523-148720545 CAGGTTACACAGAGAGCAGATGG - Intergenic
914816124 1:151063929-151063951 CTGATGATAATGAGAGCAAATGG - Intronic
915289456 1:154873383-154873405 CTGGTGAGAAGGAAGGCAGAGGG - Intergenic
915488939 1:156241006-156241028 ATGGTGACAAGGTGGGCAGAGGG - Intronic
915755348 1:158254434-158254456 TTGGTGACAAGGAGAGAAGCTGG + Exonic
916531552 1:165661112-165661134 CAGGTAAAAAGGAGGGCAGAAGG + Intronic
917058035 1:171004768-171004790 CTGGTGACAAGGAGGGATCATGG - Intronic
918277353 1:182966398-182966420 CTGGGTACAAAGACAGCAGATGG + Intergenic
921014565 1:211176623-211176645 CTGGAGACAGGGAGACCAGTTGG + Intergenic
921705915 1:218323172-218323194 CAGGTGACAAGGAAAGAAGAAGG - Intronic
921947353 1:220895100-220895122 CTGGTGACAACGTGAGTAAAGGG - Intergenic
923805906 1:237257764-237257786 AGGGTGAGAAGGAGAGGAGAGGG + Intronic
924303599 1:242664738-242664760 TAGCTGACAAGGAGATCAGAAGG + Intergenic
1062894098 10:1089750-1089772 CTGGAGGCCAGAAGAGCAGATGG - Intronic
1063607955 10:7539554-7539576 GTGGTGAGAAAGAGAGAAGATGG + Intergenic
1065198927 10:23295276-23295298 TTTGTGAAAAGGAGAGCAGGTGG - Intronic
1065701418 10:28429581-28429603 GTGGTGACCAGCAGTGCAGATGG - Intergenic
1067318697 10:45197998-45198020 CTGGGGACGAGGGGAGCAGGTGG - Intergenic
1068874992 10:61986419-61986441 GTGCTGAGAAGGAGAGCTGAAGG + Intronic
1069836113 10:71309186-71309208 AAGGTCACATGGAGAGCAGATGG - Intergenic
1069869833 10:71526366-71526388 CTGGGTCCAAGGTGAGCAGAGGG + Intronic
1069880754 10:71591434-71591456 CTGGACACAAGGAGAGCTGCTGG + Intronic
1070230046 10:74556200-74556222 GTAGTGAAAAGGAGAGCAAATGG - Intronic
1070642413 10:78179318-78179340 CTGGGGAGAAGGAGGGGAGAAGG + Intergenic
1070690674 10:78522617-78522639 CTGGCTGCAAGGTGAGCAGAAGG - Intergenic
1072611377 10:97019511-97019533 CTGCTGACTAGGAGGACAGAAGG + Intronic
1072739050 10:97898703-97898725 CTAGAGACAAGGAGAGCAGCTGG + Intronic
1072960862 10:99927796-99927818 CTGGTTTCAGGGAGATCAGAGGG + Intronic
1073583316 10:104686687-104686709 TTGATGACAAGGAGGGAAGAGGG - Intronic
1073824784 10:107308132-107308154 CTAGTGACAAGGTGAGAACATGG + Intergenic
1074587872 10:114786615-114786637 CAGGTGGCAAGAAAAGCAGAGGG + Intergenic
1076610617 10:131723681-131723703 CAGGTGTCAGGGACAGCAGATGG - Intergenic
1076716764 10:132369874-132369896 CTGGTTACATGCAGAGCAGTGGG + Intronic
1077482348 11:2821689-2821711 CAGGGAACAAGGTGAGCAGAGGG - Intronic
1078062882 11:8059855-8059877 CTGCAGTCAAGGAGACCAGAAGG + Intronic
1078329436 11:10407763-10407785 CCGGGGGCAAGGAGAGCAGGAGG - Intronic
1078908441 11:15708922-15708944 CTGGAGTCAAGGAGACCAGTAGG - Intergenic
1080765152 11:35289171-35289193 CTGGTGTCAGGGAGGACAGAGGG - Intronic
1081619201 11:44609041-44609063 CTGCTGACAACGAGGGCAGCAGG - Intronic
1081662941 11:44899538-44899560 CTGGTGTCTAGGAGAGCAGCTGG + Intronic
1084168715 11:67389933-67389955 CTGGTGACGAGGGGAGCAGAAGG + Intronic
1084322661 11:68382268-68382290 CTGGTAACTAGGTCAGCAGAGGG - Intronic
1084604098 11:70162450-70162472 GTGGGGACAAGGAGAGAGGAGGG + Intronic
1084623755 11:70292391-70292413 TGGGTGGCAAGGAGAGCAGTAGG + Intronic
1086498888 11:87431979-87432001 CGGGACACAAGGTGAGCAGACGG + Intergenic
1086582485 11:88415076-88415098 CTGGTGGCAAGGAGAAAAAAGGG + Intergenic
1089004299 11:115078105-115078127 CTCCTGACAAGAAGAGAAGATGG + Intergenic
1091195424 11:133726803-133726825 CTTGTACCAAGGAGAGCAGATGG - Intergenic
1091555344 12:1569306-1569328 CTGGTGAAAAGGAGAGGGAATGG - Intronic
1091928599 12:4376175-4376197 CGGGTGATAAGGACACCAGAGGG + Intronic
1092283900 12:7117667-7117689 CTGTTGAAAAGGAGAGCAGATGG + Intergenic
1093971413 12:25379495-25379517 CTGGAGACAAAGAGACAAGATGG - Intergenic
1094348883 12:29500776-29500798 CTGGTGACATGGACATCAGTAGG + Intergenic
1095145404 12:38721092-38721114 CAGGTGCCAAGAAGAGCAGCAGG + Intronic
1095212626 12:39510812-39510834 CTGGGGACAGGGATACCAGATGG - Intergenic
1096007776 12:48185992-48186014 CTGGAGGCAAGGAGAGAGGAGGG - Intergenic
1096686640 12:53292503-53292525 CAGGTGGCAAAGACAGCAGAGGG - Intronic
1097322273 12:58239350-58239372 CTGGAAAAAAAGAGAGCAGAAGG - Intergenic
1098225922 12:68323777-68323799 CTGATTACAAGGAAAGCAAATGG + Intronic
1098813543 12:75127311-75127333 CTGCTGACAAGAAGAGAAAAAGG + Intronic
1099206797 12:79737782-79737804 CTGGTGGGAAGCAGAGCAAAAGG + Intergenic
1100440688 12:94614460-94614482 CAGGTGGGAAGGACAGCAGAGGG + Intronic
1101448413 12:104754999-104755021 CTGGGGACCATGAGAGGAGATGG + Intronic
1103085012 12:118056092-118056114 CTGGAGGCAAGGAGAACCGATGG - Intronic
1103408229 12:120691020-120691042 CTAGTGACCAGGAGATCTGAGGG + Intronic
1104548187 12:129731568-129731590 CGGGTGGCAAGAAGAGTAGAGGG + Intronic
1105223870 13:18409155-18409177 CTGGGGACGAGGGGAGCAGGTGG + Intergenic
1106003726 13:25749468-25749490 CTGGAGAAAAGCAGAGCAGTGGG + Intronic
1106118460 13:26837675-26837697 CAGGAGAGAAAGAGAGCAGAAGG + Intergenic
1107658286 13:42613905-42613927 CTGGGAACTAGGAGAGCTGATGG + Intergenic
1107767816 13:43756425-43756447 CCTGTCACAAGGAGAGAAGAGGG + Intronic
1108543538 13:51467573-51467595 CTGAGAACCAGGAGAGCAGATGG - Intergenic
1109452849 13:62540821-62540843 CTGGTGGCCAGGAGGGCAGGTGG - Intergenic
1109683483 13:65783812-65783834 CCGGTAACATGGAGAGCAGGGGG + Intergenic
1112543389 13:100339731-100339753 CTGGAGAAAAGGAGAGCGGCTGG - Intronic
1114008017 14:18333981-18334003 CTGGGGACGAGGGGAGCAGGTGG + Intergenic
1114646790 14:24260438-24260460 CTGGTGCCCAGGTGAGCAGCTGG - Exonic
1114901335 14:27063513-27063535 CTGGGGACAGAGAGAGCAGCAGG - Intergenic
1118376524 14:65182097-65182119 CTGGTGATAAAGACAGCCGAGGG - Intergenic
1118398241 14:65355724-65355746 CTGGTGTCTAGGGGAGCAGTTGG - Intergenic
1118715415 14:68556367-68556389 CTTCAGACAAGGAGAGCAGCTGG - Intronic
1118895519 14:69942561-69942583 CTGGAGATAAGGAGAGAAGCAGG - Intronic
1118903468 14:70005546-70005568 CTGGTGACAAGGGGTGGACATGG + Intronic
1120629312 14:86870578-86870600 CTGGAGACCAGGAGAGCAGATGG + Intergenic
1121961808 14:98266869-98266891 CTGATGCCAAGGAGAGAATAAGG - Intergenic
1122975638 14:105169596-105169618 CTGGTGACCAGGGCAGCAGTGGG - Intergenic
1124004653 15:25786074-25786096 GTGGGGAGAAGGAGAGCTGAGGG + Intronic
1124606333 15:31172615-31172637 CTTCTGAAAAGGAGAGCAAAAGG + Intergenic
1130297998 15:82660615-82660637 CTGGTGTGCAGGAGAGCAGACGG - Intronic
1130829973 15:87589459-87589481 CTGGAGACAAGGACACCAGAGGG + Intergenic
1130892004 15:88141357-88141379 CTCATGACAAGAAGAGCAGAAGG + Intronic
1131182448 15:90249784-90249806 GTGGTTACGAGGAGAGCTGAGGG - Exonic
1131322550 15:91408741-91408763 CTGGTGACAAAGAAATCGGAGGG + Intergenic
1131658416 15:94485741-94485763 CTTGTGAAAAGGACACCAGATGG - Intergenic
1131916589 15:97272270-97272292 GAGGTGACAGGGAGAGAAGATGG - Intergenic
1132574619 16:658731-658753 GTGGGGGCAGGGAGAGCAGAAGG + Intronic
1132689350 16:1175547-1175569 CTCGGGACACGGCGAGCAGACGG - Intronic
1132843412 16:1989577-1989599 CTGGTCCCAAGAAGACCAGATGG - Intergenic
1133398056 16:5464232-5464254 CTGGTGCTCAGGAGAGCAGTTGG + Intergenic
1135425554 16:22332489-22332511 CTAGTGACAAGCAGAGAAGAGGG - Intronic
1135503672 16:23018209-23018231 CTGCTGACAAGGAGATGAGAGGG + Intergenic
1136284188 16:29231580-29231602 GTGGTGACAAGGACAGCACTGGG - Intergenic
1137253371 16:46756480-46756502 CTGGGGACCAGGACAGGAGACGG + Intronic
1137958142 16:52853380-52853402 CTTGTGACCAGGATTGCAGAAGG + Intergenic
1138177895 16:54918420-54918442 CTGGTGAGAAGGAGTGCTTAGGG - Intergenic
1138311492 16:56027322-56027344 CTGGTGGCAGGAAGAGGAGACGG - Intergenic
1138590296 16:57995988-57996010 CTGGGGACTGGGAGGGCAGAGGG - Exonic
1139682086 16:68572976-68572998 CTGATGTCAAGGAAAACAGATGG - Intronic
1139991005 16:70939183-70939205 CAGGAGCCAAGGAGTGCAGAAGG + Intronic
1140057801 16:71540745-71540767 CTGGTGACAAGCATAGAGGATGG + Intronic
1141049188 16:80745251-80745273 CTGGTGTCATGGACAGCACATGG - Intronic
1141848503 16:86627699-86627721 CAGGTGACCAGTAGAGTAGAAGG - Intergenic
1142089223 16:88201089-88201111 GTGGTGACAAGGACAGCACTGGG - Intergenic
1142419382 16:89961100-89961122 GTGGTGGCAGGGAGAGAAGAGGG + Intronic
1142889830 17:2936052-2936074 GTGGAGACAGGGAGAGGAGATGG - Intronic
1143233739 17:5379995-5380017 AGGGTGACAAGGGGAGAAGATGG - Intronic
1145292657 17:21561346-21561368 CTGGTGACCTGGGGAGCTGACGG - Intronic
1146664931 17:34693262-34693284 CTGGTGAGAAGGGGAGCCCATGG - Intergenic
1147054093 17:37820906-37820928 ATGCTGAGAAGGAGAGCAAAGGG - Intergenic
1147610346 17:41798342-41798364 CTGGGGACAGGGAGAGGAGAGGG - Intergenic
1147884890 17:43677795-43677817 CTGGTTGCAAGGAGAGAAAAAGG - Intergenic
1148745396 17:49915272-49915294 TTGGTGACAGGGTGAGCAGAGGG - Intergenic
1149036676 17:52141957-52141979 CCGGGGACAAGAAGAGCCGATGG + Intronic
1149746163 17:59100609-59100631 CTGGGGACAAGGCAAGTAGAGGG + Intronic
1149798250 17:59541480-59541502 TTGGTGACCAAGAGAGCTGAGGG - Intergenic
1150564205 17:66324092-66324114 CTGGTGGCAAAGAAAGCAGGAGG + Intronic
1152032789 17:77854363-77854385 TTGGTGCCGAGGAGAGGAGAGGG + Intergenic
1152541499 17:80979017-80979039 CTCGTGACCATGAGAGCAGCGGG - Intergenic
1152878558 17:82802535-82802557 CTGGAGACCAGGAGAGCTCATGG + Intronic
1153816675 18:8796414-8796436 CTGGCGGCAAGGGAAGCAGATGG + Exonic
1153874632 18:9358183-9358205 ATGGTCACAAGGAGAAGAGAAGG - Intronic
1153976649 18:10274035-10274057 ATGGTGACAGGCAGAGAAGAGGG + Intergenic
1154475295 18:14748725-14748747 CTGGGGACGAGGGGAGCAGGTGG + Intronic
1154529435 18:15329959-15329981 CTGGGGACGAGGGGAGCAGGTGG - Intergenic
1157866129 18:51186390-51186412 CAGATGGGAAGGAGAGCAGAGGG + Intronic
1159920244 18:74221265-74221287 CAGGTGAGAAGGAGAGAAGGAGG + Intergenic
1162042830 19:7980756-7980778 CTGGCCCCAAGGAGCGCAGAGGG + Intronic
1162062788 19:8107040-8107062 ATGGATACAAGGATAGCAGAGGG + Intronic
1162994357 19:14324599-14324621 CTGCACACCAGGAGAGCAGATGG + Intergenic
1163013570 19:14440415-14440437 TTGGGAACAAGGAGAGGAGATGG + Intronic
1164530558 19:29045138-29045160 CTGAGAACTAGGAGAGCAGATGG - Intergenic
1165431083 19:35773601-35773623 CTGGTGAAAGGGAGTGCTGAGGG - Intergenic
1167476586 19:49704984-49705006 CTGGGGACCAGGAGAGGGGATGG - Intronic
1167647979 19:50716084-50716106 CTGGTCAGAAGCAGAACAGATGG + Intronic
1167838428 19:52094675-52094697 TGGGTGACAAGCAGAGTAGAGGG - Intronic
1167846612 19:52170430-52170452 TGGGTGACAAGCAGAGTAGAGGG - Intronic
1167859392 19:52270576-52270598 CCGGTGACAAGGAGGGCAAAGGG + Intronic
1167862742 19:52298204-52298226 CTGGTGACAACGAGAGCAGAGGG + Intronic
1167867105 19:52337256-52337278 CTGATGACAAGGAGAGCAGAGGG + Intronic
1167873329 19:52391205-52391227 CCAGTGATAAGGAGAGCACAGGG + Intergenic
1167884148 19:52486641-52486663 CTTGTGTCAAGGAGAACAGAGGG + Intronic
1167885090 19:52493503-52493525 CTGGTGGCAAGGAGAACCGAGGG + Intronic
1167889593 19:52528684-52528706 CTGGTGTCAAGGAGAACCGAGGG + Intronic
1167890663 19:52536698-52536720 CTGGTGGCAATGAGAACAGAGGG + Intronic
1167894676 19:52571293-52571315 CTGGTGGCAAGGAGAACAGAGGG + Intronic
1167903152 19:52637342-52637364 CTGGTGGCAAGGAGAACAGAGGG - Intronic
1167909326 19:52689446-52689468 CTGGTGGCAAGGAGAACAGAGGG - Intronic
1167913837 19:52724739-52724761 CTGGTGGCACGGAGACCAGAGGG - Intronic
1167915042 19:52733993-52734015 CTTGTGTCAAGGAGAACAGAGGG - Intronic
1167925848 19:52820593-52820615 CTGGTGGCAAGGAGAACAGAGGG - Intronic
1167930034 19:52856582-52856604 CTGGTGGCAAGGAGAACAGAGGG - Intronic
1167934169 19:52892814-52892836 CTGGTGGCAAGGAGAACAGAGGG - Intronic
1167937845 19:52922371-52922393 CTGGTGGCAAGGAGAACAGAGGG - Intergenic
1167958857 19:53090136-53090158 CTGGTGACAAGGAGAGCAGAGGG - Intronic
1167960651 19:53102350-53102372 CTGGTGACAAGGCGAGCAGAGGG - Intronic
1167967205 19:53157714-53157736 CCGGTGACGAGGAGAGCAGAAGG - Intronic
1167971758 19:53192313-53192335 CTGGTGACAAGGAGAGCAGAGGG - Intronic
1167991828 19:53366722-53366744 CTGGTGGCAAAGAGAACAGAGGG + Intronic
1167995221 19:53396172-53396194 CTGGTGGCAAGGAGAACAGAGGG + Intronic
1167999479 19:53432968-53432990 CTGGTGGCAAGGAGAACAGAGGG + Intronic
1168139677 19:54376840-54376862 CTGGCGACAGGAAGAGCAGCTGG + Intergenic
1168158204 19:54490399-54490421 CTGGCGACAGGAAGAGCAGCTGG - Intergenic
925271774 2:2614939-2614961 AAGGAGACAAGGGGAGCAGATGG + Intergenic
926297595 2:11579874-11579896 CTGGAGTCCAGGAGAGCAGTCGG - Intronic
926704526 2:15827249-15827271 CTGGAGGCAAGGAGAGGAGCTGG - Intergenic
927185904 2:20482318-20482340 CTGGTCAAAAGAAGAGAAGAAGG - Intergenic
928615435 2:33034001-33034023 CTGGGGGACAGGAGAGCAGATGG + Intronic
929303116 2:40328831-40328853 CTGGAGGCAAGCAGATCAGATGG - Intronic
931462148 2:62458356-62458378 CTGGAGCCAAGGGGAGCAGAAGG - Intergenic
931978240 2:67666663-67666685 TTGGTGACAAAGAGTCCAGAGGG + Intergenic
932052496 2:68412693-68412715 CTGTAGTGAAGGAGAGCAGAGGG - Intergenic
932298704 2:70647944-70647966 CTGGTGACAAGAAGAGACCAAGG + Intronic
932570143 2:72934209-72934231 TTGGAGACACGGAGAGCAGCTGG - Exonic
933323432 2:80806131-80806153 CAGGTTATAAAGAGAGCAGATGG + Intergenic
933721860 2:85402037-85402059 CTGGGGATGAGGAGAGCAGTGGG + Intronic
933776177 2:85772469-85772491 CTGGCGCCACGGAGGGCAGAGGG + Intronic
934615361 2:95767401-95767423 CTGGAGAGTAGGAGAGGAGAGGG - Intergenic
935475011 2:103508627-103508649 CTGGGGACAATGATGGCAGATGG - Intergenic
937916891 2:127103678-127103700 CTGGGGAGAAGGACAGCTGAGGG - Intronic
938528533 2:132161381-132161403 CTGGGGACGAGGGGAGCAGGTGG - Intronic
938642038 2:133291431-133291453 CGGGAGGAAAGGAGAGCAGAGGG + Intronic
939332811 2:140786758-140786780 CTTGTGTCATGGAGAGCTGAAGG + Intronic
939403389 2:141724703-141724725 ATGGTGACAAGGTGGGGAGAAGG + Intronic
941400585 2:165025966-165025988 AGGGTGACAAGGAGATCTGAAGG - Intergenic
941501554 2:166284672-166284694 TTGGAGACAATGAGAGCAGAAGG - Exonic
942882919 2:180883878-180883900 CTGGGGACCAGGATAACAGATGG - Intergenic
942890952 2:180987345-180987367 GTGGTGACTAGGAGAGGACAAGG - Intronic
943436571 2:187871037-187871059 CTGGGGAGAAGGGTAGCAGAAGG + Intergenic
945062934 2:205924568-205924590 CTGGAGGCAAGGAAAGCAGGTGG + Intergenic
945165207 2:206935983-206936005 ATGGTCACAAGGAGAGCTGGAGG - Intergenic
946143436 2:217711296-217711318 CTGGAGACAGGGAGAGCCCATGG - Intronic
947447038 2:230172183-230172205 TTGGACACAAGGTGAGCAGAGGG + Intronic
948102799 2:235388911-235388933 TTAGTGATAATGAGAGCAGAAGG - Intergenic
948175495 2:235939537-235939559 GTGGTGAGAAGGAGAATAGAAGG - Intronic
948477280 2:238228113-238228135 CTGGTGAGATGGGGAACAGAAGG + Intronic
948574991 2:238944138-238944160 CTGGTGACCAGGAGGGGAGGTGG - Intergenic
948802359 2:240438630-240438652 CTCGTGGGAAGGAGAGCAGTTGG + Intronic
948883933 2:240873739-240873761 CTGGGGACCAGCACAGCAGAGGG + Intronic
1169275174 20:4228877-4228899 CTGGAGACGTGGAGAGAAGAAGG - Intronic
1169312973 20:4562979-4563001 CTGGAGATCAAGAGAGCAGAAGG - Intergenic
1169668531 20:8068069-8068091 TTGGTGACAGGGAGACCAGTTGG + Intergenic
1170145848 20:13173589-13173611 CTTGTGGCCAGGACAGCAGATGG - Intergenic
1170903713 20:20491411-20491433 CTGGTGACCAGTTGACCAGAGGG - Intronic
1171385314 20:24765862-24765884 CTGTTGACAAGCAGAGAAGTAGG + Intergenic
1172588301 20:36100328-36100350 CTGGGGACAAGGTGGGGAGAGGG - Intronic
1174148992 20:48472880-48472902 CTGGAGACCTGGAGAGGAGATGG - Intergenic
1174149054 20:48473297-48473319 CTGGAGACCAGGAGAGGAGCTGG - Intergenic
1175391660 20:58631453-58631475 CTGGGGACAAGGGGAGTGGAGGG - Intergenic
1175428173 20:58883672-58883694 CTGCTGAGTGGGAGAGCAGAGGG + Intronic
1175724019 20:61304615-61304637 CTAGAGAAAAGGACAGCAGAAGG + Intronic
1175919084 20:62441671-62441693 CTGGTGACCCTGGGAGCAGAGGG - Intergenic
1175974238 20:62702348-62702370 CTGGTGCCAGGGTGGGCAGAGGG + Intergenic
1176767963 21:13038509-13038531 CTGGGGACGAGGGGAGCAGGTGG + Intergenic
1177045886 21:16169471-16169493 CTGGTTTCAAGGAGAGGAGGAGG + Intergenic
1177306131 21:19318232-19318254 TTGGTGAGAATGTGAGCAGAGGG + Intergenic
1178188486 21:30253296-30253318 CTGGTGAGAATGAGAAGAGAAGG + Intergenic
1178933275 21:36838225-36838247 CTGGTGGCAGGAAGGGCAGAAGG - Intronic
1179078662 21:38149034-38149056 CTGGAGACCAGGAGAGCCAATGG - Intronic
1180231055 21:46426924-46426946 CTGGTGCCATGGAGAGCCGGTGG + Intronic
1180432524 22:15264791-15264813 CTGGGGACGAGGGGAGCAGGTGG + Intergenic
1182599265 22:31447566-31447588 CTGCTGAAAAGGAGAGGGGAGGG + Intronic
1183094133 22:35542086-35542108 CTGGGGACAAGGGGAGGGGAGGG - Intronic
1183256938 22:36768545-36768567 CTGTTGACCAGCAGAGGAGAGGG - Intronic
1183417899 22:37692984-37693006 TTGGTGGCAGGGAGAGCAGGTGG - Exonic
1183929104 22:41225960-41225982 CTGATGGCAAGGACAGCAGGTGG - Intronic
1184399699 22:44266799-44266821 CTGGAGACCAGGGGAGCTGACGG - Intronic
1184672442 22:46021958-46021980 CTGGTGGCAAGTTGAGCTGATGG + Intergenic
949159298 3:860726-860748 CTGGAGACATGGAGAGGAGCGGG - Intergenic
950703421 3:14765963-14765985 CTTCTGACAAACAGAGCAGAAGG + Intronic
951123092 3:18951381-18951403 CAGGTGCTAAGGAGAGGAGAAGG + Intergenic
951583241 3:24187744-24187766 GAGCTGACAAGCAGAGCAGATGG + Intronic
952007928 3:28863836-28863858 CTGGTGAGAGGGAAAGGAGAAGG - Intergenic
952654124 3:35763499-35763521 ATGGTGACAAGCATGGCAGAGGG - Intronic
953395907 3:42569603-42569625 CTGGTGACAAGGAAAGCAGAAGG + Intronic
953571714 3:44076525-44076547 CTGGTGACAAAGGGAGGAGAGGG + Intergenic
954367113 3:50152074-50152096 TGGGTGTCAAGGAGAGCACAGGG + Intergenic
954440019 3:50516680-50516702 CTGGAGAGAAGGAATGCAGAGGG - Intergenic
955339260 3:58112333-58112355 CTGGGGGCCAGGGGAGCAGAGGG - Intronic
959520172 3:107316443-107316465 CTGGTGACAAGTAGGGTGGAGGG + Intergenic
960567616 3:119151204-119151226 CTGCTGAGAAAGAGAGCATAAGG - Exonic
961316602 3:126040476-126040498 CTGGGGATAATGCGAGCAGAAGG + Intronic
961524386 3:127487335-127487357 ATGGTGGCAGGGAGACCAGAGGG - Intergenic
962010973 3:131390517-131390539 CTGGCCACAGAGAGAGCAGAGGG - Intergenic
963233293 3:142931408-142931430 CTGGTGACAAGGAGGGCCCAGGG - Intergenic
963275568 3:143326447-143326469 ATGGTGAGAGGGAGAGAAGAGGG - Intronic
964764192 3:160162609-160162631 CTGGTAACAAGAAGGCCAGAAGG + Intergenic
965608334 3:170518850-170518872 CTGGTGCCAAGAAGAAGAGAGGG + Intronic
965633119 3:170753748-170753770 TTTGTGACATGGAGAGCAAATGG + Intronic
966407976 3:179618910-179618932 CTGGTGACAAGGAGACTATTAGG + Intronic
966432486 3:179846785-179846807 CTGAGGACCAGGAGAGCTGATGG - Intronic
967856488 3:194121645-194121667 CTGGAGAGCAGGAGAGCAGGAGG - Intergenic
969396779 4:6926932-6926954 CTGAGGACAAGGAAACCAGAAGG - Intronic
969615395 4:8249505-8249527 CTGGAGACCAGGAGAGCTGGTGG + Intergenic
971363662 4:25959092-25959114 TTGGTGCTAAGGAGAGCAAAGGG + Intergenic
974037456 4:56829295-56829317 ATGATGACAAGGGGAGCAGCAGG - Intergenic
975369598 4:73569057-73569079 CTTGGGAGAAGGAGAGCACAAGG - Intergenic
975912955 4:79290451-79290473 CTGATGAGAGAGAGAGCAGAGGG - Intronic
976871293 4:89796785-89796807 CTTGTGATCAGCAGAGCAGAAGG - Intronic
979490145 4:121316706-121316728 CTGGTGACATGAAGAGGAAATGG + Intergenic
981424133 4:144584146-144584168 CTGGTGAGAAGGATGGAAGAAGG - Intergenic
981926963 4:150151024-150151046 CTGGCGACAAGCAGGGCAGTAGG - Intronic
984468078 4:180126902-180126924 GTGGAGACAATGAGAACAGATGG + Intergenic
985034131 4:185821121-185821143 CGGGGGGCAAGGGGAGCAGAGGG + Intronic
985124799 4:186682777-186682799 CTGATGACATGGAGAAAAGAAGG - Intronic
986808305 5:11329669-11329691 TTGGAGACCAGGAGAGAAGAAGG + Intronic
986830520 5:11572231-11572253 ATGCTTAGAAGGAGAGCAGAGGG - Intronic
989034045 5:37150942-37150964 CTGGGAACAAGGAGACCACATGG - Intronic
990568318 5:57052480-57052502 CTGCTTAGAAGGAGAGCTGATGG - Intergenic
990630612 5:57664901-57664923 CTGGTGCCAAGTAGATCAAAGGG + Intergenic
990771752 5:59254466-59254488 ATGATGTCAAGCAGAGCAGATGG + Intronic
991197484 5:63953396-63953418 CTGGAGACAAGGAGACCAGATGG - Intergenic
993815919 5:92545640-92545662 CTGGAAACAAAGAGAGGAGATGG + Intergenic
994419086 5:99509923-99509945 CTGTTGAGAAATAGAGCAGACGG + Intergenic
994926305 5:106121127-106121149 CTGGTGACGAGGAGAGCAAAGGG - Intergenic
995635852 5:114189294-114189316 CTGAGAACAAGGAGAGCTGATGG + Intergenic
996589618 5:125132102-125132124 CTGGGAACAAGGAGTGCTGATGG + Intergenic
997366494 5:133328695-133328717 CTGGTGACAGGGAGAGTGGGAGG - Intronic
998216473 5:140241596-140241618 CCTGTGACAGGGAGAGCACAGGG + Intronic
999738881 5:154534238-154534260 GTGGTGACAGGGAGACCAGTTGG + Intergenic
1000351647 5:160357167-160357189 GAGCTGACAAGGGGAGCAGATGG + Intronic
1001181944 5:169528742-169528764 CTGGTGGCAATTAGAGGAGAAGG - Intergenic
1001589403 5:172855215-172855237 CTGGTTTCCAGGAGAGCAGTGGG + Intronic
1002094482 5:176823016-176823038 CTGGAGGCAAGGAGACCAGCCGG + Intronic
1002811690 6:637258-637280 CTGGTGACACGGGCAGCAGTTGG - Intronic
1003194681 6:3904128-3904150 CTGCCGGCAAGGAGAGCAGAGGG + Intergenic
1003246039 6:4383002-4383024 CTGGTGTCCAGTAGAGAAGAGGG + Intergenic
1003670266 6:8150870-8150892 CTGGAGACCAGGAGAGCTGATGG + Intergenic
1003872733 6:10414856-10414878 CTGGTTGCAAGGAGAGGAGGAGG + Intronic
1004678725 6:17871055-17871077 CATGTGTCAAGGAGAGCACATGG - Intronic
1005157709 6:22826163-22826185 CTGGTGACCATCAGAGGAGAAGG + Intergenic
1005173010 6:23009821-23009843 CTGGAGACCAGGAGAGCTGATGG - Intergenic
1005206240 6:23408501-23408523 CTGGTGGCAAAGCAAGCAGACGG - Intergenic
1005252150 6:23959542-23959564 CTGTTGACAAGTAGAGAAGATGG - Intergenic
1006203349 6:32316976-32316998 CTGGCCACTAGGAGAGGAGAGGG + Intronic
1006990098 6:38208035-38208057 ATGGTGACAAGGAGTGGAAAAGG + Intronic
1010365380 6:75044615-75044637 ATGGCAACAAAGAGAGCAGAGGG + Intergenic
1011457408 6:87566873-87566895 ATGTGGACAAGGAAAGCAGACGG + Intronic
1011551866 6:88537562-88537584 CTGGGGGCAAGGAGACCAGTTGG + Intergenic
1011765351 6:90613829-90613851 CAGGAGACAAAGAAAGCAGAAGG - Intergenic
1016117389 6:140303776-140303798 CTGCAGAGAAGGAGAGCAGAGGG - Intergenic
1016259318 6:142148716-142148738 GTGGTGGCAGGGAGTGCAGATGG + Intronic
1016731231 6:147430581-147430603 CTGGGAACAAGAAGAGCTGATGG - Intergenic
1017096825 6:150812151-150812173 CGGGTGCCAGTGAGAGCAGAGGG - Intronic
1017776317 6:157683782-157683804 CTGGAGATAATGAGAACAGATGG + Intergenic
1018047891 6:159980760-159980782 TTGGTGACAGGGAGAGTAGGGGG + Intronic
1018072595 6:160178678-160178700 ATGGTGAGGAGGAGAGTAGAAGG - Intronic
1019420604 7:949017-949039 TTGGGGACAAGGAGGGCCGAGGG - Intronic
1020364945 7:7371190-7371212 CTGGTTTTAAGGAGAGCAAATGG + Intronic
1021049443 7:15964656-15964678 CTGGTTACAGGGAGATCTGAGGG + Intergenic
1021580918 7:22152244-22152266 CTGGTGACATGTATAGCGGATGG + Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022383271 7:29880650-29880672 CTGGTGACAAGCAGACCAGTAGG - Intronic
1022469843 7:30675320-30675342 CTGGTGGTAAGGAGTGCACAGGG + Intronic
1024013667 7:45292219-45292241 CTGGTCACAAGCATGGCAGATGG + Intergenic
1024516645 7:50265016-50265038 GAGGTGACAAGGAGAGGTGAGGG + Intergenic
1024875136 7:54013570-54013592 CAGGTGAGCAGGAGAGCAGATGG + Intergenic
1025233469 7:57218319-57218341 CTGGAGACCTGGATAGCAGATGG + Intergenic
1025932926 7:66010842-66010864 CTGGAGACAGAGAGAGGAGAAGG + Intergenic
1025950457 7:66141411-66141433 CTGGAGACAGAGAGAGGAGAAGG - Intronic
1028127582 7:87131384-87131406 CTGAGAACCAGGAGAGCAGATGG - Intergenic
1028242919 7:88443287-88443309 CTGGTGACCAGGATAGGAGCTGG + Intergenic
1028698547 7:93747436-93747458 TTGGTGACAAGAAGAGGAAATGG - Intronic
1029095836 7:98084556-98084578 TTGGTTACTAGGTGAGCAGATGG + Intergenic
1030470538 7:109957663-109957685 CTGGTGGCCAGAAGAGCAGACGG - Intergenic
1030899298 7:115102862-115102884 GTTGAGACAATGAGAGCAGAGGG - Intergenic
1031105559 7:117537921-117537943 GTGATGACAAGGATATCAGAGGG + Intronic
1032862899 7:135898448-135898470 CTGAGAACAAGGGGAGCAGATGG + Intergenic
1033854192 7:145536916-145536938 CTGGAGACTGGGAGAGGAGATGG + Intergenic
1034337626 7:150333637-150333659 CTGGTGACAAGGATGGCACTTGG - Intronic
1035577566 8:717565-717587 CTGGTGATGAGCAGAGGAGATGG + Intronic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1036034650 8:5005692-5005714 CTGGTGTCAAGGAGAGGTGGAGG + Intergenic
1036101139 8:5786506-5786528 CTGGCGCACAGGAGAGCAGAGGG - Intergenic
1037410881 8:18595602-18595624 TTGGTAACAAAAAGAGCAGAGGG + Intronic
1037418145 8:18673620-18673642 ATGGTGTCCAGTAGAGCAGAGGG - Intronic
1037542204 8:19883048-19883070 CTGGGAACCAGGAGAGCTGATGG + Intergenic
1038842238 8:31195652-31195674 CTTGTAATAAGGAAAGCAGAAGG - Intergenic
1039981509 8:42412756-42412778 CTAGCCACACGGAGAGCAGATGG + Intergenic
1041158360 8:55011161-55011183 ATGGAAACAAGGAGAGCGGAAGG + Intergenic
1042212505 8:66394887-66394909 CTGGTGTGATGGAGGGCAGAAGG + Intergenic
1042474873 8:69235766-69235788 GTGGTGACTTGTAGAGCAGATGG - Intergenic
1043823476 8:84896694-84896716 GTGGGGACAAGGAGAACAGAGGG + Intronic
1044378085 8:91499953-91499975 CTGGGGACAAGGATGGCAGTGGG - Intergenic
1046358990 8:113125810-113125832 CTGATGAGAAGGAGAGGAAAAGG + Intronic
1046795147 8:118363566-118363588 TTGAGGACCAGGAGAGCAGATGG - Intronic
1047188302 8:122655440-122655462 CTGGTGGCCAGGAGAGGAGGTGG - Intergenic
1047801625 8:128316078-128316100 CTGGAGGTAAGGAGAGCAGGAGG + Intergenic
1048872950 8:138813796-138813818 CTGGTGACCTGGAGAGAGGATGG - Intronic
1049004050 8:139843696-139843718 CGGGAGCCAAGGAGAGCAGGTGG + Intronic
1049151603 8:141038590-141038612 CTGGGGAGGAGGAGAGCAGCGGG - Intergenic
1049618776 8:143588520-143588542 CAGGTGACAAGGAAAGCTGGGGG + Intronic
1049700954 8:144012314-144012336 CTGGTGGCATGGAGAGCTGAGGG + Intronic
1051019548 9:12525729-12525751 CTGGTGACCAGGAGGGCAGGTGG - Intergenic
1051439214 9:17066199-17066221 CATTTGACAAGGAGAGAAGAAGG + Intergenic
1051973788 9:22923897-22923919 CAGGTGACATGAAGAGCAAAGGG + Intergenic
1052251899 9:26408457-26408479 CTTGAGACAAGGAGAACAGATGG - Intergenic
1053020605 9:34691430-34691452 CAGGAGCCAAGGAAAGCAGAAGG - Intergenic
1053707151 9:40767721-40767743 CTGGGGACGAGGGGAGCAGGTGG - Intergenic
1054417064 9:64888489-64888511 CTGGGGACGAGGGGAGCAGGTGG - Intergenic
1054878447 9:70120913-70120935 CTGCTGCCATGGTGAGCAGACGG - Intronic
1055052013 9:71990594-71990616 TTGGTGACAAGCAGATGAGAGGG - Intergenic
1055132738 9:72794080-72794102 CTGGTGACAAGGAGGGGGGTGGG - Intronic
1055394823 9:75862921-75862943 CTGGGAACCAAGAGAGCAGATGG + Intergenic
1056061874 9:82891635-82891657 ATGGGGATAAGTAGAGCAGATGG - Intergenic
1057291247 9:93808808-93808830 TTGGGGACAAGGAGAGGATAAGG + Intergenic
1057571669 9:96208481-96208503 CTGGTGGCGAGGTGAGGAGAGGG + Intergenic
1058545191 9:106053686-106053708 CTGCCGACAAGAAGAGCACAAGG - Intergenic
1058909857 9:109511164-109511186 CTGGTGTAAAGGAGATGAGAAGG - Intergenic
1061475021 9:130859420-130859442 CTGGTGAAAAGCCGAGCACATGG + Intronic
1061921533 9:133785159-133785181 CTGGTGAAATGGAGAGGGGAAGG - Intronic
1062168775 9:135122635-135122657 GTGGGGCCTAGGAGAGCAGATGG - Intergenic
1062430121 9:136523189-136523211 CTGGAGACAAGGGGACAAGAGGG + Intronic
1062622131 9:137427914-137427936 CTGGTTCCAAGGAGACCTGAGGG - Intronic
1187985272 X:24803279-24803301 CTGGAGAGAAGGAGAGCACACGG + Intronic
1188253500 X:27929477-27929499 CTGATTACAAGGACAGCAGTAGG + Intergenic
1189552002 X:42102851-42102873 CTGGGGAGAAGGAGAGCATGGGG - Intergenic
1189583629 X:42434370-42434392 CTAGTGACAAGCAAAGCAGCAGG - Intergenic
1190333509 X:49249628-49249650 CTGGGGACAACAGGAGCAGAAGG - Intronic
1192261309 X:69507119-69507141 CAGATGACAAGGAGACCAGGAGG + Intronic
1192573114 X:72222333-72222355 CTGATGAAAAGGAGAGCATCTGG + Intronic
1193775975 X:85642075-85642097 CTGGGGAAAAGGAGAGCATCAGG - Intergenic
1197782745 X:130173265-130173287 CTTGTGTCATGGGGAGCAGAGGG + Intronic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198557727 X:137813545-137813567 CTGATTACAGGGAGAACAGAGGG - Intergenic
1199220577 X:145311384-145311406 CTGGAGGCCAGGAGAACAGAAGG - Intergenic
1199411541 X:147529313-147529335 CTGGTGGGAAGGAGGGTAGAAGG - Intergenic
1200127572 X:153823733-153823755 ATTGTGACAAGGAAAACAGATGG - Intronic
1200218069 X:154377417-154377439 CTGGTGACAAGGGAAGAAGAGGG - Intergenic
1201693254 Y:16793192-16793214 ATGGGGACAGGGAGAGCATAAGG - Intergenic