ID: 1167958888

View in Genome Browser
Species Human (GRCh38)
Location 19:53090281-53090303
Sequence CTGGGTCTCCAGAGAGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 393}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167958888 Original CRISPR CTGGGTCTCCAGAGAGATGA AGG (reversed) Intronic
900012846 1:131538-131560 CTGGGTGTCAGGAGACATGATGG - Intergenic
900042911 1:487525-487547 CTGGGTGTCAGGAGACATGATGG - Intergenic
900064348 1:722522-722544 CTGGGTGTCAGGAGACATGATGG - Intergenic
900351017 1:2234598-2234620 CAGGGCCTCCAGAGAGAAGGCGG + Intronic
901753305 1:11425347-11425369 CTGGGTCTCCTGATAGGTCAGGG + Intergenic
901778288 1:11575591-11575613 CTTGGCCTCCGGTGAGATGATGG - Intergenic
902468055 1:16630343-16630365 CCGGGACCCCAGGGAGATGAGGG - Intergenic
903986786 1:27234641-27234663 CTGGGTCCCCAGACAGCTGGAGG + Exonic
905788498 1:40776676-40776698 CTGGGAGTTCACAGAGATGATGG - Intergenic
905801327 1:40845096-40845118 CTGGGCCTCCAGAGGCCTGATGG - Intergenic
907029649 1:51157980-51158002 CTTGCCCTCCAGGGAGATGATGG + Intergenic
907431614 1:54415378-54415400 CTGTGTGCCCAGAGAGGTGAAGG - Intergenic
907454428 1:54566057-54566079 CTGGCTCTCCAGAGGGAAGGGGG - Intronic
908403912 1:63795146-63795168 CTGGTGCTCCAGAGGGCTGATGG + Intronic
908520501 1:64936538-64936560 CTGGGTGTCTAGACAGGTGATGG - Intronic
913046133 1:115074944-115074966 TTGAGTCGCCACAGAGATGAGGG - Intronic
914716525 1:150258916-150258938 GTGGGTGTCCAGAGAGCAGAAGG + Intronic
915109049 1:153551400-153551422 CTGAGTCTCCAAGGAGAGGACGG - Intergenic
915118274 1:153613518-153613540 CTGGGTCTCAGTAGAGCTGATGG - Intergenic
915840934 1:159212418-159212440 CTGGGGCTTGAGGGAGATGATGG - Intergenic
918303627 1:183226735-183226757 CTGGGGCTCCAGAGACAGGGCGG - Exonic
918396745 1:184121203-184121225 CTGGTCCTCCAGAGAGAAGTAGG + Intergenic
920298292 1:204973315-204973337 CTGGGTGTCCCGGAAGATGATGG - Exonic
920857133 1:209672388-209672410 CTGGGGCTCCAGGCAGCTGAAGG - Intergenic
921594505 1:217039526-217039548 GTGGGTCTCACGAGAGCTGATGG - Intronic
922079269 1:222279083-222279105 CTGGCTGTCCAGAGAGCAGAAGG + Intergenic
922099247 1:222468534-222468556 CTGGGTGTCAGGAGACATGATGG - Intergenic
922261285 1:223948028-223948050 CTGGGTGTCAGGAGACATGATGG - Intergenic
922735787 1:227977712-227977734 CTGGGTGTCAGGAGACATGATGG + Intergenic
922806719 1:228394147-228394169 AAGAGTCTTCAGAGAGATGATGG - Exonic
923280836 1:232441617-232441639 CTGGGTCTCCAGATGCAGGAGGG - Intronic
924342446 1:243050208-243050230 CTGGGTGTCAGGAGACATGATGG - Intergenic
1063236184 10:4118824-4118846 CTTGGTCTTCAGAAAGATAAAGG + Intergenic
1063454491 10:6173653-6173675 CTGGGTCTCCAGAGATCTGGGGG + Intronic
1065154110 10:22852185-22852207 TGGGGTAGCCAGAGAGATGAGGG + Intergenic
1065347207 10:24759983-24760005 CTGGGTCTCCAGCTTGCTGACGG + Intergenic
1065615828 10:27521910-27521932 CTGGTTCTGCAGGGAGAGGAAGG + Intronic
1065895374 10:30158669-30158691 CAAGGTGGCCAGAGAGATGAAGG - Intergenic
1065910630 10:30301079-30301101 ATAGGTCTCCAGGGAGATGGGGG - Intergenic
1066734026 10:38455347-38455369 CTGGGTGTCAGGAGACATGATGG + Intergenic
1067113169 10:43415090-43415112 CTGAGGCTCCATAGAGCTGAAGG - Intergenic
1068264147 10:54625513-54625535 ATGGGTCTCCTGAGATCTGATGG + Intronic
1068761126 10:60710746-60710768 CTGGGTCTCCAGCTTGCTGATGG - Intronic
1069338696 10:67385446-67385468 CTGGGTCTCAATAGAGATTAGGG - Intronic
1069755607 10:70772829-70772851 CTGTTTCTCCAGAGACAGGAGGG - Intronic
1069775582 10:70925398-70925420 CTGGAGCTCAAGAGAGATGAGGG + Intergenic
1070780625 10:79135642-79135664 CTGGGTGGCCAGAGAGCTAAGGG + Intronic
1071511918 10:86267458-86267480 CTGGGTTGCCAGGGAGATGTAGG - Intronic
1071769662 10:88713053-88713075 CTGTGTCTCCTGTGTGATGATGG - Intergenic
1072070408 10:91909601-91909623 CTGTCTCTCCAGATGGATGATGG + Intergenic
1072683248 10:97521683-97521705 CTGGGGCTTCAGGGAGATCAGGG - Intronic
1073496054 10:103892149-103892171 CTTGTTTTCCAGAAAGATGATGG - Exonic
1074108566 10:110406756-110406778 CAGGAGCTCCAGAGAGGTGAAGG + Intergenic
1074987761 10:118672549-118672571 ATGAGTCTCCAGAGATCTGATGG + Intergenic
1075202052 10:120412671-120412693 CAGGAGCTCCAGAGAGACGAAGG + Intergenic
1075383743 10:122039567-122039589 CTGGGCCTTCAGGCAGATGAGGG + Intronic
1076225741 10:128773637-128773659 ATGGGTCTCATGAGAGCTGACGG + Intergenic
1076368449 10:129936707-129936729 CTGGGTCCCCACACAGCTGAGGG - Intronic
1076368465 10:129936745-129936767 CTGGGTCCCCACACAGCTGAGGG - Intronic
1076368481 10:129936783-129936805 CTGGGTCCCCACACAGCTGAGGG - Intronic
1076840506 10:133043004-133043026 CTGGGTCGCGAGGGAGATGGCGG + Intergenic
1076969184 11:123742-123764 CTGGGTGTCAGGAGACATGATGG - Intergenic
1077344795 11:2041680-2041702 CTGGGTCTGCACAGAGTGGAGGG + Intergenic
1077498515 11:2898267-2898289 CTGGGTCTGGAGAGAGAGGCAGG - Intronic
1077921958 11:6647966-6647988 CTGACTCTCCAGGAAGATGAGGG + Intronic
1078846483 11:15123448-15123470 CTGAGTAACCAGATAGATGATGG + Intronic
1078867440 11:15311193-15311215 CTGTGTGTACAGAGACATGAAGG - Intergenic
1079019311 11:16896120-16896142 CTGGGACTCTAGAGAGTGGACGG - Intronic
1079488607 11:20962513-20962535 CTGGGTCTCAATAGAGAAGTGGG - Intronic
1079694264 11:23459491-23459513 ATGGGTCTCACGAGAGCTGATGG - Intergenic
1081340489 11:41921519-41921541 CTGGGTCTCCAGAAAGGGAAAGG - Intergenic
1083932856 11:65855345-65855367 CTTGCCCTCCAGGGAGATGACGG + Exonic
1084689868 11:70718832-70718854 CTGCCTCTCCAGGGGGATGAAGG - Intronic
1085715048 11:78864968-78864990 AAGGATCTTCAGAGAGATGAAGG + Intronic
1085875613 11:80403626-80403648 GTGGGTCTCAAGAGATCTGATGG + Intergenic
1086334312 11:85784152-85784174 CAGGGTCTCTAGAAAGGTGAGGG - Intronic
1086764190 11:90674803-90674825 ATGGGTCTCAAGAGATCTGATGG + Intergenic
1087129474 11:94655876-94655898 CAGGGTCTCCAAAGTGATAATGG + Intergenic
1087924184 11:103900362-103900384 ATGGGTCTCATGAGATATGATGG + Intergenic
1088740942 11:112766178-112766200 ATGGGTCTCAAGAGATCTGATGG + Intergenic
1088765330 11:112970009-112970031 CTGGACCTCCACAGATATGAAGG + Intronic
1089261319 11:117225774-117225796 CTGGGAATCTAGAGAAATGAAGG + Intronic
1090653422 11:128825255-128825277 CAGTGGCTCCAGAGAGGTGAGGG - Intergenic
1202827781 11_KI270721v1_random:96870-96892 CTGGGTCTGCACAGAGTGGAGGG + Intergenic
1091537802 12:1429689-1429711 CCAGGTCTCCAGAGAGATTTAGG + Intronic
1091859438 12:3766712-3766734 CTGGGTCTCCAGCTTGCTGATGG - Intergenic
1093313617 12:17621934-17621956 CTGGGTCCCTATAAAGATGATGG + Intergenic
1094759422 12:33513416-33513438 ATGGGTCTCATGAGACATGATGG + Intergenic
1095953037 12:47791777-47791799 CTGGGGCCCATGAGAGATGAGGG - Intronic
1096797143 12:54085061-54085083 AGGGGTCCCCAGAGAGTTGAGGG - Intergenic
1097173036 12:57128180-57128202 CTGGTGCTCCAGAGAGCAGAAGG - Intronic
1097565775 12:61266219-61266241 ATGGGTCTCAAGAGATCTGATGG + Intergenic
1100288838 12:93194232-93194254 ATGGGTCTCAGGAGAGCTGATGG - Intergenic
1101928473 12:108992804-108992826 CTGGGACTAGACAGAGATGAGGG + Intronic
1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG + Intronic
1102038198 12:109783919-109783941 CTGGGGCTCAAGAGAGGTCAAGG + Intronic
1102544731 12:113646255-113646277 ATGGATGCCCAGAGAGATGAAGG + Intergenic
1103515616 12:121506309-121506331 CTGGGTCTCCAGGGAGAGTGAGG + Intronic
1103915969 12:124375912-124375934 CTGGGTCTCCGGGGAGATTCAGG + Intronic
1104980108 12:132569909-132569931 CTGGGCCTGCAGAGAGAGGGTGG - Exonic
1106436099 13:29724170-29724192 CTGGGGCTGCAGTGAGCTGAAGG + Intergenic
1106491737 13:30231011-30231033 CTGGATCTCTAGGGAGCTGATGG - Intronic
1106577877 13:30992716-30992738 ATGTGGCTCCAGAGAAATGAGGG + Intergenic
1107966407 13:45602172-45602194 CTGGGTCCCAGGAGAAATGATGG + Intronic
1109160632 13:58969382-58969404 GTGGGTCTCATGAGAGCTGATGG + Intergenic
1109816995 13:67597820-67597842 CTGGGGCTCCAGACATGTGAAGG + Intergenic
1109965414 13:69686748-69686770 CTGGCTCTCCAGATTGAAGATGG - Intergenic
1111497479 13:89071027-89071049 CTTTGTCTCTAGAGACATGAAGG + Intergenic
1112103726 13:96218177-96218199 CTGTGTCCCCAGAGAGAAGTGGG + Intronic
1112656066 13:101453731-101453753 CTTGGACCCCAGAGAGATGTGGG + Intronic
1112912657 13:104507514-104507536 CTGGGTCTCCAAAAGGAGGAAGG - Intergenic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1114285618 14:21239865-21239887 CTGGGTCTCAAGAGAGAAAAAGG + Intronic
1116525305 14:45896779-45896801 CTGTGTCTCCACAGAGTGGAAGG - Intergenic
1117810930 14:59546302-59546324 CTGGGACTCCAAAAAGATGGAGG + Intronic
1119193855 14:72702616-72702638 ATGGTTCTGCAGAGAGAAGATGG - Intronic
1121627077 14:95393686-95393708 CTGGGGCTCCAGAGGGATAAGGG - Intergenic
1122190952 14:100043395-100043417 CTGGGTCTCCAGCGTGCAGACGG - Intronic
1122344572 14:101050532-101050554 ATGGGTCTCATGAGAGCTGATGG + Intergenic
1123060738 14:105593110-105593132 TTGGGTCTCTAGTGAGATCAGGG + Intergenic
1124143150 15:27095461-27095483 CTCGGTCTCCACATAGATGCTGG + Intronic
1125038396 15:35154009-35154031 CTAGATCTCCAGAGAGAGGAAGG + Intergenic
1125750286 15:42023225-42023247 CTGGCCCTCCAGAGAGCAGAGGG - Intronic
1126277707 15:46903481-46903503 ATGTGTCTCCATAGAGATAAAGG + Intergenic
1126704483 15:51394894-51394916 CTGGGCCTGCAGGGAAATGAGGG + Exonic
1127946224 15:63756859-63756881 ATGATTCTCCAGAGAGATTAAGG + Intronic
1128476555 15:68001694-68001716 CTGGAGCACAAGAGAGATGAGGG + Intergenic
1128564302 15:68690239-68690261 CTGGGTCTCCAGAGAAAAAAAGG - Intronic
1129339179 15:74873649-74873671 CTTGGTCTACAGAGAAGTGAAGG - Intergenic
1130895969 15:88170763-88170785 CTGACTTTCCAGAGTGATGAGGG - Intronic
1132623610 16:879732-879754 CTGGGTCTGCAGGGACAGGAGGG + Exonic
1132627774 16:899990-900012 CTGGGTGTAAAGAGAGATGTGGG + Intronic
1132851998 16:2028988-2029010 CTGGATCTGCAGAGAGGGGAAGG - Intronic
1132968828 16:2674908-2674930 CTGTGTCTCCAGAGGGCAGAGGG - Intergenic
1133622440 16:7539373-7539395 CTGGGAATAGAGAGAGATGAGGG - Intronic
1134235942 16:12466637-12466659 CTGGGGCTCCAGGTAGATCATGG - Intronic
1136010949 16:27363193-27363215 CTGTGTCCCCAGAGAAATGTGGG + Exonic
1136690953 16:32028641-32028663 CTGGATGTCCAGAGAGAAGATGG - Intergenic
1137543062 16:49377884-49377906 CTGGGTCTCCAAATGGAGGAGGG + Intronic
1137799385 16:51248327-51248349 GTGGATCTTCAGAGAAATGAGGG + Intergenic
1138706778 16:58923193-58923215 CTGGCACTCAAGAGAGAAGATGG - Intergenic
1138715399 16:59016395-59016417 GTGAGTGTCTAGAGAGATGAAGG + Intergenic
1138983607 16:62299939-62299961 CAGGCACTCCAGAGAGCTGATGG - Intergenic
1140710436 16:77672471-77672493 CTGACTCTCCAGAGAAGTGAGGG - Intergenic
1141811072 16:86376466-86376488 CAGGCACTGCAGAGAGATGAGGG + Intergenic
1142422164 16:89978284-89978306 CTGTGTCTCCACAGAGTAGAAGG + Intergenic
1142451491 16:90175380-90175402 CTGGGTGTCAGGAGACATGATGG + Intergenic
1142850052 17:2700469-2700491 TCGGGTCTGCAGAGAGATCAGGG + Exonic
1143197540 17:5087648-5087670 CTGGGCCTGAAGAGAGAGGAGGG + Intronic
1144016898 17:11204728-11204750 CTGGCTATCCACAGTGATGATGG - Intergenic
1144777941 17:17794156-17794178 CTGGGTGTCCACAGAGCTGGTGG - Exonic
1144877052 17:18403636-18403658 CTCTGTCCCCAGAGAGGTGATGG + Intergenic
1145155178 17:20540772-20540794 CTCTGTCCCCAGAGAGGTGATGG - Intergenic
1146181088 17:30698422-30698444 CTGGGACTGGAGAGAGATAAAGG + Intergenic
1146318299 17:31826374-31826396 CTGTGTCTCCAGAGTGGTCAAGG - Intergenic
1146380072 17:32321713-32321735 CTGGGGCTCCAGTAAGAAGAGGG + Exonic
1148063625 17:44853177-44853199 CGGGGTTTCCAGAGAGAGGAGGG + Intronic
1148581212 17:48745249-48745271 CAGGGTCTGCAGGGAGCTGAGGG - Intergenic
1153352933 18:4101269-4101291 CTGTGTCTCCGGAAATATGAAGG + Intronic
1156288425 18:35722236-35722258 GTGGGCCTCCAGAGAGCTGTGGG + Intergenic
1156344789 18:36247115-36247137 ATAGGTCTCCAGAGACATGGGGG + Intronic
1157404065 18:47408949-47408971 CATGGACTCCAGAGAGGTGAGGG + Intergenic
1157497874 18:48169389-48169411 CTGTGTCTCCGGAGAGGTCAGGG + Intronic
1159855958 18:73587809-73587831 CTGGGACTCCAGTGATAAGAAGG - Intergenic
1160508151 18:79438657-79438679 CTGAGTCTGCAAAGAGGTGAGGG + Intronic
1160645989 19:193668-193690 CTGGGTGTCAGGAGACATGATGG - Intergenic
1161108231 19:2455137-2455159 CTGGGCCTGGTGAGAGATGAGGG + Intronic
1162448920 19:10742621-10742643 CTTGGACTCCAGAGACAGGAAGG - Intronic
1162977510 19:14217155-14217177 CTGGGACTGGAGAGAGATAAAGG - Intergenic
1163455844 19:17405187-17405209 GTGGGTCTCCAGGGAGATGCAGG - Intronic
1163817322 19:19474867-19474889 CTGGGTCCCCAGAGAGGTTGAGG + Intronic
1163830671 19:19545803-19545825 CGGCTTCTCCAGAGAGATGAAGG + Exonic
1163846650 19:19642005-19642027 CTGGGTCTTCTGAGAGTAGAGGG + Exonic
1163887866 19:19984043-19984065 TAGTGTCTCCAGAGAAATGAAGG + Intergenic
1164977324 19:32582896-32582918 CTGGGTCTACAGAAATAGGAAGG + Intronic
1165429996 19:35767094-35767116 CTGGGTCCCCAGAGAACTGAGGG - Intronic
1166147399 19:40847052-40847074 CTGGGGTTGCAGAGAGAGGATGG + Intronic
1166151548 19:40878937-40878959 CTGGGGTTGCAGAGAGAGGATGG + Intronic
1166170420 19:41024441-41024463 CTGGGGTTGCAGAGAGAGGATGG + Intergenic
1166178639 19:41091709-41091731 CTGGGGTTGCAGAGAGAGGATGG - Intronic
1166368113 19:42287328-42287350 CTGGATCTCAGGAGACATGATGG - Exonic
1167422737 19:49413640-49413662 CTGCGTCACCAGAGAAAGGAGGG + Intronic
1167894657 19:52571162-52571184 CTAGATGTACAGAGAGATGAAGG + Intronic
1167898721 19:52602098-52602120 CTAGATGTACAGAGAGATGAAGG + Intronic
1167903176 19:52637462-52637484 CTAGATGTACAGAGAGATGAAGG - Intronic
1167909353 19:52689566-52689588 CTGGATGTACAGAGACATGAAGG - Intronic
1167925872 19:52820716-52820738 CTAGATGTACAGAGAGATGAAGG - Intronic
1167930058 19:52856701-52856723 CTAGATGTACAGAGAGATGAAGG - Intronic
1167934192 19:52892934-52892956 CTAGATGTACAGAGAGATGAAGG - Intronic
1167937868 19:52922495-52922517 CTGGATGTACAGAGAGATGAAGG - Intergenic
1167946390 19:52992429-52992451 CTAGATGTACAGAGAGATGAAGG - Intergenic
1167958888 19:53090281-53090303 CTGGGTCTCCAGAGAGATGAAGG - Intronic
1167964434 19:53132043-53132065 CACAGTATCCAGAGAGATGAAGG - Intronic
1167967237 19:53157858-53157880 CTCGATGTCCAGAGACATGAAGG - Intronic
1167971786 19:53192449-53192471 CTCGCTGTCTAGAGAGATGAAGG - Intronic
1167991803 19:53366602-53366624 CTAGATGTACAGAGAGATGAAGG + Intronic
1167999453 19:53432848-53432870 CTGGATGTACAGAGAGATGAAGG + Intronic
1168003824 19:53469609-53469631 CTAGATGTACAGAGAGATGAAGG + Intronic
926690827 2:15732161-15732183 CTGGATCTCCAGAGATCTAATGG - Intronic
926840283 2:17072073-17072095 ATAAGTCTCAAGAGAGATGATGG + Intergenic
927707965 2:25308602-25308624 CTGGGTCTCTGAAGAGGTGAGGG + Intronic
927715913 2:25352734-25352756 CTGCTTCTCCAGAGGGAAGAGGG + Intergenic
928085983 2:28346715-28346737 CTGATTCTCCAGATAGATCACGG - Intergenic
929608724 2:43253961-43253983 CTGGGTCTCCAGAGGGAGACTGG - Intronic
930324443 2:49897696-49897718 CTGGGTCTCCAGATTGCAGAGGG - Intergenic
931614888 2:64145371-64145393 CTGGCTCTCCGGAGAGCTAAAGG + Intergenic
931830727 2:66048448-66048470 CTGGGTCTTCAGAAAGAAGGAGG - Intergenic
932789107 2:74637932-74637954 CTGGGACTTCAGAGAGACCAAGG - Intronic
933763084 2:85687480-85687502 CTGGGTGGCCAGGGAGATGGTGG - Intronic
934945103 2:98535051-98535073 CTGGATCTCCAGAGAGAAAAAGG + Intronic
935000317 2:99007797-99007819 CTGGCTTTCCAAAGAGAGGAGGG - Intronic
935708585 2:105877555-105877577 CTGTGTCTCCAGATGGAAGAGGG - Intronic
936344985 2:111668739-111668761 CTGGGTCTCCAGCTTGTTGATGG - Intergenic
937024389 2:118685838-118685860 CTGTGTCTCCTGATGGATGATGG - Intergenic
937087152 2:119179030-119179052 CTGAGGCTCCAGAGAGATGTTGG + Intergenic
937370422 2:121293715-121293737 CTGCGGCTCCAGAGACATGGAGG + Intergenic
937983512 2:127628359-127628381 CTGGGCCTCCCTGGAGATGAAGG - Exonic
940097723 2:149996891-149996913 CTTGGTCACCAGAGAAATGATGG - Intergenic
940133276 2:150408035-150408057 CAGGGTCTTCATAAAGATGAAGG + Intergenic
941408310 2:165120041-165120063 GTGGGTCTACAGAGGGATGATGG + Intronic
941873746 2:170412448-170412470 CTGAGTCTTCAGACAGAAGAAGG - Intronic
942458664 2:176154633-176154655 CTGTGTCTCCTGAGAGCTGAGGG + Intronic
943116873 2:183683663-183683685 ATGGGTCTCCTGAGATCTGATGG - Intergenic
945977189 2:216280143-216280165 ATGAGGCTCCACAGAGATGAGGG + Intronic
946748475 2:222869337-222869359 CAGGGGAGCCAGAGAGATGAAGG - Intronic
947168884 2:227290815-227290837 CATGGTCTCCAGGGAGATAAGGG + Exonic
948262937 2:236617561-236617583 CTGGGCCTCTAGATAGGTGAGGG + Intergenic
948481309 2:238252174-238252196 CTGGGTTTCCAAGGAGAGGAGGG - Intronic
948966115 2:241381671-241381693 ATGAATCTCCAGAGAGCTGATGG + Intronic
1168814796 20:728924-728946 GTGGGGGTCCAGGGAGATGAGGG + Intergenic
1170043830 20:12065359-12065381 CAGAGACTACAGAGAGATGATGG - Intergenic
1171848995 20:30294918-30294940 AGGGGTCCCCAGAGAGTTGAGGG - Intergenic
1172064072 20:32207324-32207346 CTGGGTCTCCAGGGAGCCTAGGG + Intronic
1173821997 20:46025605-46025627 CTGAGTCTGCAGAGGAATGAGGG + Intronic
1173993574 20:47321025-47321047 CTGGGTTTGCAGAGACATGGAGG + Intronic
1175068806 20:56314516-56314538 CTGGGGCTGCAGGGAGATGCAGG + Intergenic
1175284742 20:57830548-57830570 CTGGGTCTCCAGCGTGCAGATGG - Intergenic
1175308185 20:57992391-57992413 ATGGGGCTCCAGAGAGGTGTCGG + Intergenic
1175749535 20:61485642-61485664 CTGGTTCTCCATGGCGATGATGG + Intronic
1175916760 20:62429595-62429617 CTGGGTCCCCAGGGAGAAGGTGG + Intergenic
1176279517 20:64292548-64292570 CTGGGTGTCAGGAGACATGATGG + Intergenic
1177011892 21:15740487-15740509 TTGGGTTTCCATAGAGATGTTGG - Intronic
1177214394 21:18109632-18109654 CTGAATCTCCAGAAAGATGAGGG - Intronic
1177322990 21:19546093-19546115 CTGGGTTTACAGAAAGATTAAGG + Intergenic
1177581572 21:23030102-23030124 CTGAGTCTCAAGAGATCTGATGG - Intergenic
1178803502 21:35818823-35818845 CAAGGTCTCAGGAGAGATGAGGG + Intronic
1179395062 21:41031958-41031980 CTGGGTCTTGAGAGAGATGCAGG - Intergenic
1180014101 21:45071863-45071885 CTGGGTCTCCACAGAAGTGCTGG - Intergenic
1180173928 21:46078405-46078427 CGGGGGGTCCAGAGAGACGACGG + Intergenic
1181826456 22:25520101-25520123 TTGGGTCTCCATGGAGATCATGG - Intergenic
1181887193 22:26030672-26030694 CTGGGATTCCAGAGAGTTGATGG + Exonic
1182260333 22:29069495-29069517 CTGGGCCTCCAGAAAGATGTTGG - Intergenic
1182820800 22:33214514-33214536 CTGTGTCTCCAAATACATGATGG - Intronic
1183382950 22:37499616-37499638 CTGGGTCTTCAGGGAGCTGCAGG - Intronic
1183775685 22:39963313-39963335 CTGGGTCTACAAGGAGAGGATGG - Intronic
1183776640 22:39970553-39970575 CTGGGTCTCCAGAGTGACGCTGG + Intronic
1184368777 22:44069351-44069373 CTGCGGCCCCAGAGGGATGAGGG + Intronic
1185167289 22:49269508-49269530 TTGGGTCTCCAGAATGATGCAGG - Intergenic
949506925 3:4737337-4737359 CAGGCTCCCCAGAGAGATGCTGG - Intronic
950196265 3:11011222-11011244 CTGCCAGTCCAGAGAGATGATGG - Intronic
950699033 3:14727390-14727412 CAGGGGCTCCAGATGGATGATGG - Intronic
952157297 3:30657064-30657086 GTGGGTCTCCAGAGAGGAGCTGG + Intronic
952738768 3:36715862-36715884 CTGCGATTCCAGAGAAATGAAGG - Intronic
954379445 3:50211891-50211913 CTGGGTCTCAAAAAAGAGGATGG - Intronic
954690941 3:52395254-52395276 CTGGGGCTGCAGAGAGATCGGGG - Intronic
955369179 3:58336283-58336305 CTGAGTCACCAGAAGGATGAAGG + Intronic
955888609 3:63626636-63626658 CTGGGTTCCAAAAGAGATGAAGG + Intergenic
955928749 3:64034107-64034129 CTGGGCTTCCAGAGAGCTAAAGG - Intergenic
958644712 3:96855082-96855104 CTGGCTCTGAAGAGAGAGGAAGG - Intronic
959442009 3:106388605-106388627 CTGGGTATTCAGAGAGACCATGG - Intergenic
960086603 3:113597573-113597595 CTGAGTCTTCAGAGACATAATGG + Intronic
960727020 3:120680864-120680886 CTGAGTCTTCAGAGAGAAGTTGG - Intronic
962123978 3:132595097-132595119 CTGGGAGTCCAGATGGATGAGGG + Intronic
963715729 3:148801608-148801630 CTGGGTCTTTGGAGAGGTGAAGG - Intronic
966274407 3:178147485-178147507 CTGGATCTCATGAGACATGATGG - Intergenic
967505384 3:190247172-190247194 ATGGGTCTCATGAGATATGATGG - Intergenic
968229434 3:196996619-196996641 CTGGGTCACCCCACAGATGAAGG + Intronic
968338006 3:197930222-197930244 CTGGGTCCCCAGCGACTTGAGGG + Intronic
968371692 3:198225858-198225880 CTGGGTGTCAGGAGACATGATGG + Intergenic
968716887 4:2166842-2166864 CTGGGTCTCCAGCTTGAAGAAGG + Intronic
975108006 4:70591018-70591040 CTGGGGCTCAAAAGAGATTAAGG + Intergenic
975803909 4:78092493-78092515 CTGGGTCTCATGAGAGCTGTTGG - Intronic
976131882 4:81893179-81893201 ATGGGTCACCAGAGAGAAGCCGG + Intronic
976197661 4:82548775-82548797 CTGGGTCTTCAGGGATGTGAAGG + Intronic
976609898 4:87019592-87019614 CTGGGTCTCCAGAGAGCTTCTGG + Intronic
979369084 4:119862259-119862281 ATGGGTCTCAAGAGATCTGATGG - Intergenic
979876635 4:125899565-125899587 CAGGGTGGCCAGAGAGATAATGG - Intergenic
980610157 4:135150338-135150360 CTGTGTTCCCAGAAAGATGATGG - Intergenic
980886021 4:138763621-138763643 CGGGGTCTCCAGACAGACGGTGG + Intergenic
983250957 4:165345924-165345946 ATAGCTCTCCAGAGAGAGGAGGG - Intergenic
984788276 4:183589904-183589926 CTCAGGCTGCAGAGAGATGAAGG + Intergenic
985165359 4:187088508-187088530 CTGGCTCTGCAGAGAGCCGAGGG + Intergenic
985914458 5:2906930-2906952 CTGTCTCTGCAGAAAGATGATGG - Intergenic
986233708 5:5888220-5888242 CTGTGTCTCCTGTGAGATGTTGG + Intergenic
986508221 5:8474691-8474713 CTGGGCCTACAGAGAGAGAAAGG + Intergenic
988143192 5:27268792-27268814 CTGGCTTTCCTGAAAGATGAGGG - Intergenic
988812635 5:34800787-34800809 CTGGTTCTCCAAAGACAAGATGG - Intronic
988866624 5:35342290-35342312 CTGGATTTCCAGAGAGATGTTGG + Intergenic
990332336 5:54740278-54740300 CTGAGTGAGCAGAGAGATGAGGG - Intergenic
991700661 5:69313380-69313402 CTTGCCCTCCAGGGAGATGATGG + Intronic
992660878 5:78959363-78959385 CTGGCCCTCCAGTGAGCTGAGGG - Intronic
994240507 5:97414637-97414659 CAGGGTCTCCAGAGTCATGTGGG - Intergenic
994301673 5:98155282-98155304 CTGGGTCTCCAGGGAGATAAGGG - Intergenic
994378957 5:99047755-99047777 TTGGGTATCCAGACAGATTATGG + Intergenic
994799116 5:104348145-104348167 ATGGGTCTCATGAGATATGATGG - Intergenic
994816897 5:104596364-104596386 CTGGGATTCGAGTGAGATGAAGG - Intergenic
995399131 5:111720735-111720757 CTGGGTCTCCAGCTTGAAGATGG + Intronic
995857950 5:116613670-116613692 CTGGGTATCAGGAGAGCTGAGGG - Intergenic
996297696 5:121942495-121942517 ATGGGTCTCATGAGAGCTGATGG - Intergenic
996390277 5:122952932-122952954 CTGGGACTCCAGAAAGAAGTAGG - Intronic
997864181 5:137446350-137446372 TTGGATCTCCAGAGAGCTGTTGG + Intronic
997957003 5:138286553-138286575 CTGGGTGTCCAAAGGGACGATGG + Exonic
997979317 5:138459153-138459175 CTGGGTCTCAAGCTAGGTGAAGG - Intergenic
998172696 5:139881851-139881873 CTGGGGCTTCAGAAAGAAGAGGG - Intronic
1000124127 5:158226896-158226918 CTGGGTCTCCCGAGTAATGTGGG - Intergenic
1002730932 5:181331404-181331426 CTGGGTGTCAGGAGACATGATGG + Intergenic
1002753601 6:142700-142722 CTGGGTGTCAGGAGACATGATGG - Intergenic
1004112857 6:12737431-12737453 ATATGTGTCCAGAGAGATGAGGG + Intronic
1004962664 6:20808679-20808701 CTGGGTTTCAGGAGAGAAGATGG + Intronic
1006173382 6:32108136-32108158 CTGGGTCCCCAGGGACTTGAAGG + Intronic
1006256444 6:32836251-32836273 CTGGGGCTCCAGAGAATTGTGGG - Intronic
1006558608 6:34889658-34889680 TTGGGTCCCCAGAGAGATCGGGG + Intronic
1007652757 6:43433380-43433402 TGGGGTCTCCAGATAGCTGAGGG - Intronic
1010662955 6:78592630-78592652 CTGGGTCTCCAGTTTGAAGATGG - Intergenic
1011001151 6:82589864-82589886 CTGGGTCACCGGGGAGTTGAGGG + Intergenic
1011110763 6:83834548-83834570 ATGGGTCTCACGAGATATGATGG + Intergenic
1011460247 6:87595619-87595641 CTGGTGCTTCCGAGAGATGATGG - Intronic
1011785395 6:90837821-90837843 CTGGGTCTCCAGCTTGCTGATGG + Intergenic
1013227235 6:108128787-108128809 GTGGGTCTCAAGAGATCTGATGG + Intronic
1013458899 6:110357463-110357485 GTGGATCTTCAGCGAGATGAAGG + Intronic
1013927594 6:115492516-115492538 ATGGGTCTCAAGAGATCTGATGG - Intergenic
1014003238 6:116388172-116388194 CTGGGTCTCCAGAGTGCAAATGG - Intronic
1015221850 6:130813270-130813292 CAGGGTCTTCAGGGAGATGAGGG - Intergenic
1015585040 6:134767630-134767652 GCAGGTCTCCAGAGAGGTGATGG + Intergenic
1016498477 6:144690671-144690693 CCCAGTCTCCAGAGGGATGAAGG - Intronic
1018948551 6:168364001-168364023 CTGGGACCCCACAGAGCTGATGG + Intergenic
1019609843 7:1930851-1930873 CTGGGTCACGAGAGAGACCAGGG - Intronic
1019861491 7:3662537-3662559 CTGGAGGTCCAGAGAGAAGAAGG + Intronic
1020168098 7:5823652-5823674 CTGGGTCTCTAGGGGGAAGAAGG + Intergenic
1020743057 7:12046493-12046515 CTGGTTTCGCAGAGAGATGAAGG - Intergenic
1020997146 7:15279123-15279145 CTGGGTCTGCAGAGTAATCAGGG - Intronic
1022067525 7:26874848-26874870 CTGGATCTCCAGAGAAGAGATGG + Intronic
1022289704 7:28989139-28989161 CTGGCTCTACAGAGACAAGATGG + Intergenic
1022380527 7:29855082-29855104 CTGGGACTTCATAGAGCTGAGGG - Intronic
1023680771 7:42684999-42685021 CAGGCTTTCTAGAGAGATGAGGG + Intergenic
1023780896 7:43654139-43654161 CTGGGTGTGGAGAGAGGTGAAGG - Intronic
1024103646 7:46059236-46059258 TTGGGTCCTCAGAGACATGATGG + Intergenic
1024647526 7:51382723-51382745 CTGGGTGTCAGGAGACATGACGG - Intergenic
1025060130 7:55798474-55798496 CTGGGTGTCAGGAGACATGACGG - Intronic
1025128328 7:56362886-56362908 CTGGGTGTCAGGAGACATGACGG - Intergenic
1025176711 7:56805767-56805789 CTGGGTGTCAGGAGACATGACGG - Intergenic
1025301340 7:57821536-57821558 CTGGGGCTCCGGAAAGCTGACGG - Intergenic
1025695083 7:63770619-63770641 CTGGGTGTCAGGAGACATGACGG + Intergenic
1026413422 7:70152223-70152245 TGGAGTCTCCAGAGAGAGGAGGG + Intronic
1026660597 7:72298777-72298799 CTGAGTCTCAAGAGATCTGATGG + Intronic
1028860307 7:95641648-95641670 CTGGCTCCACAGAGAGATGCTGG - Intergenic
1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG + Intronic
1030838598 7:114319585-114319607 ATGGGTCTCAATAGAGCTGATGG - Intronic
1032052610 7:128658329-128658351 CTGGGTGTCAGGAGACATGATGG + Intergenic
1033579721 7:142721065-142721087 CAGTGTCTCTAGAGAGAAGAAGG + Intergenic
1033825416 7:145184017-145184039 GTGTGACTCCGGAGAGATGAGGG + Intergenic
1034413874 7:150955090-150955112 ATGGGTGCCCAGAGAGATGGTGG - Intronic
1034467770 7:151239869-151239891 CTGGGACTTCAGAGAAATCAGGG - Intronic
1034988015 7:155529477-155529499 CTGAGCCTGCAGAGAGATCACGG - Intronic
1035015305 7:155760637-155760659 CTGGTTCTCATGAAAGATGAGGG + Intronic
1035160249 7:156944764-156944786 CTGAGTCTCCAGGGAGCTGGGGG - Intergenic
1035239386 7:157520048-157520070 CCTGGTCCCCAGGGAGATGACGG + Intergenic
1035631652 8:1111274-1111296 CTGGGTCTTCCGGGAGCTGAGGG - Intergenic
1036100905 8:5783604-5783626 ATGGGTCTCAAGAGATCTGATGG + Intergenic
1036590723 8:10165627-10165649 CTCGGTCTACAGAGATATCATGG - Intronic
1036590789 8:10166118-10166140 CTGGCTCTCCAGAGTGAAGCTGG - Intronic
1039858518 8:41436815-41436837 CTGGGTATAAAGAGAGAAGAAGG + Intergenic
1040747635 8:50664600-50664622 CATGGTGCCCAGAGAGATGAGGG - Intronic
1042428520 8:68676924-68676946 ATGGGTCTCAAGACAGCTGATGG - Intronic
1043592683 8:81848414-81848436 CAGAGTCTCCAAAGAGATAATGG + Intergenic
1044445420 8:92269837-92269859 GTGAGTCTCCTGAGAGCTGATGG - Intergenic
1045572982 8:103388869-103388891 CTGGAACTACAGAGTGATGATGG + Intergenic
1046851985 8:118984936-118984958 ATGGGTCTCACGAGATATGATGG - Intergenic
1047183705 8:122613464-122613486 CAGAGTTTCCAGAGAGAAGATGG - Intergenic
1047255925 8:123213390-123213412 CTGGGCCTCAGGAGAGACGAAGG - Intergenic
1047298764 8:123594701-123594723 CTGGGTCTTCAAAGGAATGATGG - Intergenic
1048590741 8:135818479-135818501 CTGGAGGTCCTGAGAGATGAGGG + Intergenic
1048774848 8:137934555-137934577 CTGTGTATTCAGAGAAATGAAGG - Intergenic
1050839789 9:10134209-10134231 GTGGGTCTCCAGAGAGCTGCAGG + Intronic
1052006856 9:23359930-23359952 ATGGGTCTCCTGAGATCTGATGG - Intergenic
1052598933 9:30599586-30599608 CTGGGTCTCATGAGATCTGATGG - Intergenic
1052788221 9:32849847-32849869 CTGGGTCCCAAGATAGATGGAGG + Intergenic
1052990690 9:34517886-34517908 GTGGGTCTACACAGAGAGGAAGG + Intronic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053363174 9:37503960-37503982 CTGGGTCACCAGTGTGATGGGGG + Intergenic
1053420194 9:37972445-37972467 CTGGGGCTCCAGAAAGGTGATGG + Intronic
1053662144 9:40291471-40291493 CTGGGGATGCAGAGAGAGGAGGG - Intronic
1053912590 9:42921639-42921661 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054374270 9:64437712-64437734 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054450400 9:65400859-65400881 AGGGGTCCCCAGAGAGTTGAGGG - Intergenic
1054522466 9:66084813-66084835 CTGGGGATGCAGAGAGAGGAGGG + Intergenic
1055223095 9:73962735-73962757 CTGGGTCTCCAGATGGCAGATGG - Intergenic
1055478283 9:76685263-76685285 CTGGGTCTCCAAGGAGGTTATGG + Intronic
1056475902 9:86950680-86950702 ATGGGTCTCATGAGATATGATGG - Intergenic
1056751737 9:89356931-89356953 CTGGTGCACCAGAGAGAGGATGG - Intronic
1057950050 9:99362590-99362612 CTGGGTCTCTAGCCAGAAGAAGG - Intergenic
1059044849 9:110855354-110855376 CTAGGTCCCCAGAGAGAGTAGGG - Intergenic
1060817207 9:126641334-126641356 CTGAGGATGCAGAGAGATGATGG - Intronic
1061145200 9:128793607-128793629 CTGGGTCTCCACAGATACGTGGG + Intronic
1062755338 9:138283911-138283933 CTGGGTGTCAGGAGACATGATGG + Intergenic
1203791450 EBV:153901-153923 CTCGGCCTCCAGGGAGATGGGGG + Intergenic
1203579251 Un_KI270745v1:28083-28105 CTGGGTGTCAGGAGACATGATGG + Intergenic
1185621205 X:1452483-1452505 CTGGGTCCCCATAGGGATGGGGG - Intronic
1185824505 X:3236917-3236939 CTGGGTCTCCAGCCTGCTGATGG - Intergenic
1188245479 X:27831758-27831780 CTGGGATCACAGAGAGATGAGGG + Intergenic
1188445408 X:30249095-30249117 CTGGGTACTCAGAGAGGTGAAGG + Intronic
1189422867 X:40872143-40872165 GTGGGGCTGCAGAGAGAAGAAGG - Intergenic
1190255486 X:48759240-48759262 CTGGGTCTCCAGCTTGCTGATGG + Intergenic
1190477239 X:50840198-50840220 CTGTGCCTGCAGAGAGAGGAAGG - Intergenic
1190556856 X:51644627-51644649 CTGGGTATGGATAGAGATGATGG - Intergenic
1194206515 X:91017473-91017495 CTGCTTCTCTAGAGAGATTAGGG + Intergenic
1194283674 X:91983619-91983641 ATGGGTCTCCCGAGATCTGATGG - Intronic
1196820192 X:119694975-119694997 CTGGGTCTCCAGCACAATGAAGG - Intergenic
1197451910 X:126629436-126629458 CTGGGGCTGCATAGAGAAGAGGG + Intergenic
1198312489 X:135435934-135435956 CTGCATCTCCAGGGAGATGGTGG - Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200552267 Y:4592268-4592290 CTGCTTCTCTAGAGAGATTAGGG + Intergenic
1200601245 Y:5208183-5208205 ATGGGTCTCCTGAGATCTGATGG - Intronic
1201677567 Y:16604273-16604295 CTGAGACTCAAGAGAGTTGATGG - Intergenic
1202381859 Y:24280705-24280727 CTGGGTGTCAGGAGACATGATGG + Intergenic
1202488925 Y:25389420-25389442 CTGGGTGTCAGGAGACATGATGG - Intergenic