ID: 1167981677

View in Genome Browser
Species Human (GRCh38)
Location 19:53281420-53281442
Sequence CATCCCTACTTGGGTAAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167981670_1167981677 -9 Left 1167981670 19:53281406-53281428 CCAGTGCATCCCTCCATCCCTAC No data
Right 1167981677 19:53281420-53281442 CATCCCTACTTGGGTAAATAGGG No data
1167981668_1167981677 19 Left 1167981668 19:53281378-53281400 CCAAGTTACAGTGGGCGTGACTC No data
Right 1167981677 19:53281420-53281442 CATCCCTACTTGGGTAAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167981677 Original CRISPR CATCCCTACTTGGGTAAATA GGG Intergenic
No off target data available for this crispr