ID: 1167982161

View in Genome Browser
Species Human (GRCh38)
Location 19:53284291-53284313
Sequence CAGGCGCTTGCCCTGGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167982149_1167982161 24 Left 1167982149 19:53284244-53284266 CCAACAGGCCTGACATGTCCTCC No data
Right 1167982161 19:53284291-53284313 CAGGCGCTTGCCCTGGGTCCTGG No data
1167982148_1167982161 28 Left 1167982148 19:53284240-53284262 CCAGCCAACAGGCCTGACATGTC No data
Right 1167982161 19:53284291-53284313 CAGGCGCTTGCCCTGGGTCCTGG No data
1167982156_1167982161 -10 Left 1167982156 19:53284278-53284300 CCAGCCTGCCATGCAGGCGCTTG No data
Right 1167982161 19:53284291-53284313 CAGGCGCTTGCCCTGGGTCCTGG No data
1167982153_1167982161 3 Left 1167982153 19:53284265-53284287 CCCATGGTGCTCTCCAGCCTGCC No data
Right 1167982161 19:53284291-53284313 CAGGCGCTTGCCCTGGGTCCTGG No data
1167982151_1167982161 16 Left 1167982151 19:53284252-53284274 CCTGACATGTCCTCCCATGGTGC No data
Right 1167982161 19:53284291-53284313 CAGGCGCTTGCCCTGGGTCCTGG No data
1167982152_1167982161 6 Left 1167982152 19:53284262-53284284 CCTCCCATGGTGCTCTCCAGCCT No data
Right 1167982161 19:53284291-53284313 CAGGCGCTTGCCCTGGGTCCTGG No data
1167982154_1167982161 2 Left 1167982154 19:53284266-53284288 CCATGGTGCTCTCCAGCCTGCCA No data
Right 1167982161 19:53284291-53284313 CAGGCGCTTGCCCTGGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167982161 Original CRISPR CAGGCGCTTGCCCTGGGTCC TGG Intergenic
No off target data available for this crispr