ID: 1167983520

View in Genome Browser
Species Human (GRCh38)
Location 19:53296520-53296542
Sequence AATATGTAGGGCCTTCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167983520_1167983526 28 Left 1167983520 19:53296520-53296542 CCTGCTTGAAGGCCCTACATATT No data
Right 1167983526 19:53296571-53296593 CTGAGAGAAAAATGATTTTCTGG No data
1167983520_1167983523 -2 Left 1167983520 19:53296520-53296542 CCTGCTTGAAGGCCCTACATATT No data
Right 1167983523 19:53296541-53296563 TTTCATGACAGTCTTGATGATGG No data
1167983520_1167983525 2 Left 1167983520 19:53296520-53296542 CCTGCTTGAAGGCCCTACATATT No data
Right 1167983525 19:53296545-53296567 ATGACAGTCTTGATGATGGTGGG No data
1167983520_1167983524 1 Left 1167983520 19:53296520-53296542 CCTGCTTGAAGGCCCTACATATT No data
Right 1167983524 19:53296544-53296566 CATGACAGTCTTGATGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167983520 Original CRISPR AATATGTAGGGCCTTCAAGC AGG (reversed) Intergenic