ID: 1167983632

View in Genome Browser
Species Human (GRCh38)
Location 19:53297293-53297315
Sequence TACACCCGCGCATTTCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167983627_1167983632 -6 Left 1167983627 19:53297276-53297298 CCCATGCTCACCCCATCTACACC No data
Right 1167983632 19:53297293-53297315 TACACCCGCGCATTTCCCACAGG No data
1167983624_1167983632 5 Left 1167983624 19:53297265-53297287 CCCTGGCAGGCCCCATGCTCACC No data
Right 1167983632 19:53297293-53297315 TACACCCGCGCATTTCCCACAGG No data
1167983626_1167983632 -5 Left 1167983626 19:53297275-53297297 CCCCATGCTCACCCCATCTACAC No data
Right 1167983632 19:53297293-53297315 TACACCCGCGCATTTCCCACAGG No data
1167983628_1167983632 -7 Left 1167983628 19:53297277-53297299 CCATGCTCACCCCATCTACACCC No data
Right 1167983632 19:53297293-53297315 TACACCCGCGCATTTCCCACAGG No data
1167983621_1167983632 15 Left 1167983621 19:53297255-53297277 CCTCCCTCTACCCTGGCAGGCCC No data
Right 1167983632 19:53297293-53297315 TACACCCGCGCATTTCCCACAGG No data
1167983623_1167983632 11 Left 1167983623 19:53297259-53297281 CCTCTACCCTGGCAGGCCCCATG No data
Right 1167983632 19:53297293-53297315 TACACCCGCGCATTTCCCACAGG No data
1167983625_1167983632 4 Left 1167983625 19:53297266-53297288 CCTGGCAGGCCCCATGCTCACCC No data
Right 1167983632 19:53297293-53297315 TACACCCGCGCATTTCCCACAGG No data
1167983622_1167983632 12 Left 1167983622 19:53297258-53297280 CCCTCTACCCTGGCAGGCCCCAT No data
Right 1167983632 19:53297293-53297315 TACACCCGCGCATTTCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167983632 Original CRISPR TACACCCGCGCATTTCCCAC AGG Intergenic
No off target data available for this crispr